- Email: [email protected]
Characterisation and expression analysis of the WDR9 gene, located in the Down critical region-2 of the human chromosome 21
Biochimica et Biophysica Acta 1577 (2002) 377 – 383 www.bba-direct.com
Characterisation and expression analysis of the WDR9 gene, located in the Down critical region-2 of the human chromosome 21 Veronica C. Ramos a, Jose Manuel Vidal-Taboada a, Salvador Bergon˜on a, Aliana Egeo b, Elizabeth M.C. Fisher c, Paolo Scartezzini b, Rafael Oliva a,d,* a
Human Genetics Research Group, IDIBAPS, Faculty of Medicine, University of Barcelona, Casanova 143, 08023 Barcelona, Spain b Division of Pediatrics Hospital Galliera, Pediatric Service, Mura delle Capuccini Genoa 14, 4-16128, Italy c Neurogenetics Department, Imperial College, Norfolk Place, London, UK d Genetics Service, IDIBAPS, Hospital Clinic i Provincial, Villarroel 170, 08023, Barcelona, Spain Received 12 February 2002; received in revised form 29 May 2002; accepted 4 June 2002
Abstract We report the isolation and characterisation of the gene WDR9 (WD Repeat 9), located in the Down Syndrome critical region-2 (DCR-2) from the human chromosome 21. This gene spans 125 kb of genomic sequence and is organised in 41 exons and 40 introns. The WDR9 cDNA has a size of 13 kb and encodes for a putative protein of 2269 amino acids with a potential location in the nucleus. Expression analysis in different human adult tissues and in cultured cell lines indicates that the gene has several tissue-specific transcripts. The more significant protein signatures in the WDR9 protein sequence are for WD repeats, bromodomain, beta-ketoacyl synthases, and ribonucleoprotein (RNP). The WDR9 protein has a high similarity with the Mus musculus neuronal differentiation protein (NDRP) and a region of similarity with the region of the Yotiao protein that has been proposed to bind the NR1 subunit of the NMDA receptor. The presence of protein – protein interaction domains as such the WD repeats, and the similarity of the WDR9 protein to regulatory proteins suggest a potential involvement in some of the clinical features associated to the DCR-2. D 2002 Elsevier Science B.V. All rights reserved. Keywords: Down Syndrome; WD repeats; Expression analysis; 21q22; Down critical region; WDR9
Down Syndrome (DS) is usually caused by a full trisomy of chromosome 21, although a subset of the patients that carry only a partial trisomy of chromosome 21 also exhibit some of its features [1]. The partial trisomy of the region that includes D21S55 and MX1 markers on sub-bands 21q22.2 and 21q22.3 has been associated with different features of DS [2]. This chromosomal region has been postulated as the minimal region for six facial and dermatoglyphic features and, in some patients, the region is apparently determinant of the pathogenesis of mental retardation, congenital heart disease, and duodenal stenosis [3,4]. This region is known as the Down syndrome critical region-2 (DCR-2) [2]. As part of an effort to isolate, characterise and map the genes potentially responsible for some of the DS features, we have constructed high-resolution physical maps * Corresponding author. Human Genetics Research Group, Faculty of Medicine, University of Barcelona, Casanova 143, 08036 Barcelona, Spain. Tel.: +34-93-4021877; fax: +34-93-4035260. E-mail address: [email protected] (R. Oliva).
[5] and transcriptional maps [6] in the DCR-2 region. This approach has allowed us to locate and characterise several genes such as the SH3BGR gene [7] and the DSCR2 gene [8]. In addition, we had also isolated and located several additional transcription units in this region from human chromosome 21 [6]. Three previously mapped cDNAs, 903H1 (AJ222636), N143 (AJ002572), and N144 (AJ002574) [5,6], located in the A1047 cosmid clone and in the PAC clone 31K18 (Fig. 1), were used as the starting material in the present work. To determine whether these cDNAs were part of the same gene, the draft genomic sequence AF129408 was used to BLAST for new EST sequences, which were purchased and sequenced to completion. The sequences obtained were then assembled into three large sequences contigs and deposited to GenBank: 903H1, HGG-3 (AJ238554) and HGG-4 (AJ238555). Concomitant to the development of the present work, the PAC clone 31K18, which we had also previously mapped to the DCR2 region [5], entered in the genome sequencing project by the German Human Genome Project
0167-4781/02/$ - see front matter D 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 0 2 ) 0 0 4 2 1 - 9
378
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
Fig. 1. Map position of the WDR9 gene. The location of the WDR9 gene in the physical map of the Down critical region-2 is indicated as an asterisk and the orientation of the gene is indicated by a black arrow.
at Jena (http://genome.imb-jena.de). Subsequently, the sequence of this PAC clone became accessible through the GTS division of GenBank (AF129408). The comparisons of the cDNA sequence contigs obtained (903H1, HGG-3, HGG-4) with the genomic draft sequence indicated that these sequences were close to each other. The search also allowed us to identify and obtain several new ESTs (AA516132, R79267, AA962066, AI923376, AA649224, AA459446). The IMAGE consortium cDNA clones were obtained through the UK-HGMP-Resource center and the RZPD at Berlin and sequenced. The results obtained joined all the partial transcribed sequences obtained (903H1, HGG3, HGG4) into one large contig of 8158 bp (that we provisionally named 903H1 gene; AJ238214) containing an ORF distributed in three exons with an open reading frame at the 5Vend and a large 3VUTR (Fig. 2). To span the 903H1 gene at the 5’ region, the draft genomic sequence AF129408 was compared to the EST database and to the non-redundant division of GenBank (BLASTN) leading to the identification of different clusters of ESTs along the unfinished genomic sequence (AI733432, AI791742, BE219326, AI377710, AA251336, BE158873, AU90447,
AW991284, BF039796, AW996975, AW204322, AL544410, AL544381, BE158860, BG153849, AI004650, AI697898, BE348426, BG393428, BG619722) (Fig. 2). We continued with the strategy to try to join the EST clusters located 5Vof the 903H1 gene. Subsequently, we designed two primers, one in a EST cluster sequence located at the 5Vend of the expanded transcriptional unit and the other primer in the 5Vend of the sequence of the enlarged sequence of the 903H1 gene (PCR 12, 24; Fig. 2). We made a total of 52 different RTPCRs walks using this strategy which allowed us to span 3 kb the 5Vend until we detected an EST cluster containing the 5V UTR (Fig. 2). Finally, to further confirm the continuity of all clusters, we performed long RT-PCRs covering all the gene (PCRs 35, 25,33, 23, 24, Fig. 2). The designed primer sequences and the PCR conditions are provided on request by the corresponding author. During the characterisation of the 5Vend of the 903H1 gene, the chromosome 21 mapping and sequencing consortium made public a finished genomic sequence and the prediction of genes [9]. The entire transcribed unit that we have isolated was located in the genomic sequence AL163279 and the majority of the coding sequence was
Fig. 2. Structure of the WDR9 gene showing the position of the exons and introns in the genomic sequence. The ESTs and some of the PCRs performed to demonstrate continuity and structure of the sequence are indicated. The sizes of the exons in base pair, beginning in exon 1, are the following: 148, 59, 30, 60, 151, 99, 161, 222, 101, 71, 101, 41, 99, 151, 125, 129, 226, 186, 184, 94, 132, 95, 190, 126, 108, 125, 83, 112, 62, 156, 121, 126, 73, 42, 144, 153, 167, 221, 168, 900, and 1727. The sizes of the different introns are: 143, 139, 171, 14258, 2068, 361, 1710, 13562, 1334, 1391, 1037, 1700, 3700, 249, 4879, 205, 5787, 2658, 4756, 2610, 8615, 1694, 4096, 88, 2740, 729, 3302, 616, 5747, 232, 2789, 1683, 773, 1736, 638, 3720, 3562, 1938, 556, and 1347. The primer sequences used in the different PCRs, the PCR conditions, and the detected size of the PCR products are available from the authors upon request.
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
379
380
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
included within a predicted gene that was named WDR9 (WD repeat 9). To maintain the approved nomenclature, we adopted the name of WDR9 for our previously and provisionally named 903H1 cDNA. The isolation and characterization of the WDR9 gene, reported in this paper, involved the sequencing and assembling in our laboratory of 12 cDNA clones and 82 ESTs detected by homology to the draft genomic sequence of the DCR-2 region. The sequence obtained from the WDR9 gene has a total length of 12935 bp, featuring an ORF of 6810 bp, a partial 5V UTR of 99 bp and a long 3V UTR of 6026 bp, containing a polyadenylation signal at position 11727. However, other several polyadenylation signals more proximal to the CDS are present at positions 9197, 9317, 9793, 10084 and 10727 of the WDR9 cDNA. The WDR9 gene is organised in 41 exons spanning 125 kb of genomic sequence (Fig. 2). All of the 40 introns are flanked by the consensus GT/AG splice acceptor and donor sequences and have variable sizes ranging from 150 to 14 kb (Fig. 2). The potential CDS region starts at position 100 bp and the starting ATG of the ORF proposed agrees with the Kozak sequence consensus (GCCATGGA/GNNATGG) [10]. The insert from the cDNA 903H1 was used as a probe to perform Northern analysis from different adult human tissues (Fig. 3A), human cell lines (Fig. 3B), mouse embryos at different development stages (Fig. 3E) and different adult mouse tissues (Fig. 3D). The Northern analysis using RNA from adult human tissues indicates that the WDR9 gene has several different transcript sizes and that these different transcripts have tissue specificity (Fig. 3A). The shorter form has a length of 2.6 kb and is detected only in pancreas, the intermediate form is 5.0 kb in length and is only detected in liver, and the larger form of the transcript has a length about 13 kb and is detected in heart and skeletal muscle (Fig. 3A). The Northern analysis of complete mouse embryos of different developmental stages, using as a probe the human 903H1 cDNA, indicates that the gene is expressed from embryonic development stage E11 to stage E18 (Fig. 3E). There are no significant changes in the levels of expression of the gene during the development of the complete mouse embryos from day 11 to 18, and only a transcript size of 7.8 kb has been detected (Fig. 3E). The WDR9 mRNA is expressed in all the mouse tissues analysed and is expressed at higher levels in brain, kidney, testes, pancreas, and muscle as compared to heart, liver, and uterus (Fig. 3D). Only a single transcript has also been detected in the adult mouse tissues with the same size as that detected in the mouse embryonic tissues. Therefore, the transcript size of the mouse WDR9 mRNA is 7.8 kb in length in all of these tissues analysed (Fig. 3D). RT-PCR experiments using human RNA from different tissues indicates that the WDR9 mRNA is expressed in all the tissues analysed (Fig. 3C). Northern analysis in different human cell lines detected that the expression of the WDR9
gene is higher in Jurkat, HL6O and HT29, with an estimated length of 12 kb, as compared with RAJI, Hela, HepG2, and MCF-7, with an estimated length of 5 kb (Fig. 3B). In silico expression (BLAST N and human ESTs) indicates that the WDR9 gene is also expressed in other different tissues not analysed by northern or RT-PCR, such as the adrenal gland (AV705238), colon (AW968556), ovary (AA074939), amygdala (AL120123), testis (AA846522), thymus (L44549), prostate (AI669728), eye (H30353) and aorta (AI708846). The predicted ORF (Fig. 4A) from the WDR9 mRNA sequence encodes for a potential 2269 amino acid protein (257 kDa) with a predicted isoelectric point of 8.5, and 344 strongly basic, 318 strongly acidic, 678 polar and 598 hydrophobic amino acids. The following potential motifs were found (PROSITE-PSITE): 14 sites of N-glycosylation, 15 sites for cAMP- and cGMP-dependent protein kinase phosphorylation, 50 sites for protein kinase C phosphorylation, 50 sites for casein kinase II phosporylation, 3 sites for tyrosine kinase phosporylation, 25 sites for N-myristoylation, 10 sites for amidation, 1 site for eukaryotic putative RNA-binding region ribonucleoprotein (RNP), 1 signature of the beta-ketoacyl synthases family and 2 sites with the Trp –Asp (WD) repeat signature. The WDR9 protein also has a signature for a bromodomain. The exact function of this domain is not yet known but it is thought to be involved in protein – protein interactions and it may be important for the assembling or the activity of multicomponent complexes involved in transcriptional activation. The most significant similarities (BLASTP) detected for WDR9 were for the mouse protein BAB16299 related to neuronal differentiation protein (NDRP), involving the region 5-977 of the WDR9 protein with an identity of 59% and a similarity of 72%. NDRP shows predominant expression in neurons in retina and olfactory epithelia during embryonic development, and exhibits up-regulated expression in hypoglossal motor neurons after injury. In addition, this protein has been proposed as a regulatory protein and versatile for diverse functions such as signal transduction, RNA processing, gene regulation, and cell cycle [11]. The WDR9 protein has also some regions of identity with the Drosophila melanogaster CG6400 gene product (AAF56278), and to the IRS-1 PH domain of the human protein PHIP (Fig. 4B). Since the WDR9 protein has WD repeats, we also find similarity with proteins that contain these motifs, such as the Arabidopsis thaliana WD-40 repeat protein-like, the D. melanogaster WDs gene product, the human WDR5 and the human Katanin p80 (WD40-containing) subunit B1. Also a similarity (48%) was detected with the region of Yotiao protein that has been proposed to bind the NR1 subunit of the NMDA receptor and with other proteins that contain the Yotiao protein domain (CG-NAP, AKAP450, AKAP350, and Hyperion) which are also involved in protein associates [12 – 14]. Thus, through the
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
381
Fig. 3. Pattern of expression of the WDR9 gene. (A) Northern analysis from adult human tissues. (B) Northern analysis from different human cell lines. The length estimated from the different mRNA transcripts of the WDR9 gene is indicated at the right. (C) RT-PCR analysis from adult human tissues; the length of the PCR product is shown. (D) Northern analysis from different adult mouse tissues. (E) Northern analysis from different mouse embryo development stages. In the lower panel of B, D, and E, the 28 S RNA is shown for normalization. Northern blot: total RNA was isolated (tripure) from mouse adult tissues, mouse embryos in different stages of development, and different human cell lines. Ten micrograms of total RNA was electrophoresed in 1.2% denaturing agarose gel with formaldehyde, transferred with 20 SSC to a Nytran Plus nylon membrane (Schleider&Schuell). Northern analysis of human adult tissues was performed using commercial human Northern blots from Clontech. We used as probe the cDNA 903H1 clone labelled with the Rediprime II kit (Amersham). Hybridisations were done overnight at 42 jC in hybridisation solution (Ambion), and washes were performed with 0.1 SSC and 0.1% SDS (2 5Vroom temperature, 2 15Vat 37 jC, and 15Vat 55 jC). The filter was exposed for 2 days at an image plate BAS_MP (Fujifilm), and the image was captured in a Molecular Imager FX (Bio-Rad) and processed using the Quantity One 4.0 software (Bio-Rad). RT-PCR: was made using total RNA obtained from different tissues and Superscript II (Gibco), and the primer 903H1.1 (TGCTGAATGCTGCTACAAAG). The cDNA was amplified using the primers 903H1.1 and 903H1.2 (AGCAGCAATCTCAGGGTAAC).
region of similarity to the Yotiao protein, the WDR9 protein could be related to the protein –protein interactions such as with receptor proteins. The potential subcellular location of the WDR9 protein indicates a probable presence in the nucleus (reliability of 74%; PSORT). The fact that the WDR9 gene is expressed in human cell lines and tissues that have high rate of proliferation,
such as embryos, cancer tissues and tumour-derived cell lines could indicate a potential role of the WDR9 gene in cell proliferation. Consistent with this potential role, the WDR9 protein contains eight WD domains detected with the PFAM and Smart programs (Fig. 4A). Proteins containing WD repeats are generally regulatory proteins that are versatile for diverse functions such as signal trans-
382
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
Fig. 4. (A) Sequence of the protein showing the different domains and consensus patterns: The beta-ketoacyl synthases: G-X (4)-[LIVMFAP]-X (2)-[AGC]-C[STA](2)-[STAG]-X (3)-[LIVMF], RNP consensus pattern: [RK]-G- {EDRKHPCG -[AGSCI]-[FY]-[LIVA]-X-[FYLM], WD-repeat consensus pattern G/ AHXXXV/IXXV/L/I/CXF/W/L/I/VXX [O-?] P/S/DD/N7SG/S/P [0-3] XL I/V/FA/V/L/I. Bromo domain consensus pattern: [STANVF]-x (2)-F-x (4)-[DNS]-x (5,7)-[DENQTF]-Y-[HFY]-x (2)-[LIVMFY]-x (3)-[LIVM]-x (4)-[LIVM]-x (6,8)-Y-x (12,13)-[LIVM]-x (2)-N-[SACF]-x (2)-[FY]. (B) Blast results with the most important identities.
duction, RNA processing, gene regulation, vesicular traffic, and regulation of cytoskeletal assembly and cell cycle [15,16]. None of the WD proteins has been shown to have an enzymatic activity. The WD repeats form pro-
peller structures creating a stable platform that can form reversible complexes with several proteins, thus coordinating sequential and/or simultaneous interactions involving several sets of proteins [17].
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
The potential function related with protein – protein interaction, and a potential role in cellular proliferation makes the WDR9 protein an interesting protein to start functional studies to demonstrate these potential implications. The characterisation of the WDR9 gene opens up the possibility to develop functional strategies to study the implication of the gene in the features of DS associated with the chromosomal region where the gene is located. Acknowledgements This work has been supported by grants from the European Union BMHS-CT96-0554, from Marato´ de TV3 1994 (CANCER 953006), from Fundacio` Catalana Sindrome de Down (Marato´ de TV3) and from Generalitat de Catalunya (1999 SGR-00226) to R.O. We thank Maria Pique and Joan Gil for the help in the cell lines analysis and Nicos Katsanis for the help in providing the cDNA clones N143 and N144. References [1] J. Lejeune, et al., C.R.A.S. 148 (1959) 1721. [2] J.M. Delabar, D. Theophile, Z. Rahmani, Z. Chettouh, J.L. Blouin, M. Prieur, B. Noel, P.M. Sinet, Eur. J. Hum. Genet. 1 (1993) 114 – 124. [3] J.R. Korenberg, C. Bradley, C.M. Disteche, Am. J. Hum. Genet. 50 (1992) 294 – 302.
383
[4] J.R. Korenberg, X.N. Chen, R. Schipper, Z. Sun, R. Gonsky, S. Gerwehr, N. Carpenter, C. Daumer, P. Dignan, C. Disteche, et al., Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 4997 – 5001. [5] J.M. Vidal-Taboada, S. Bergonon, P. Scartezzini, A. Egeo, D. Nizetic, R. Oliva, Biochem. Biophys. Res. Commun. 241 (1997) 321 – 326. [6] J.M. Vidal-Taboada, S. Bergonon, M. Sanchez, C. Lopez-Acedo, J. Groet, D. Nizetic, A. Egeo, P. Scartezzini, N. Katsanis, E.M. Fisher, J.M. Delabar, R. Oliva, Biochem. Biophys. Res. Commun. 243 (1998) 572 – 578. [7] A. Egeo, M. Mazzocco, F. Sotgia, P. Arrigo, R. Oliva, S. Bergonon, D. Nizetic, Q.A. Rasore, P. Scartezzini, Hum. Genet. 102 (1998) 289 – 293. [8] J.M. Vidal-Taboada, S. Sanz, A. Egeo, P. Scartezzini, R. Oliva, Biochem. Biophys. Res. Commun. 250 (1998) 547 – 554. [9] M. Hattori, A. Fujiyama, T.D. Taylor, H. Watanabe, T. Yada, H.S. Park, A. Toyoda, K. Ishii, Y. Totoki, D.K. Choi, E. Soeda, M.Ohki, T. Takagi, Y. Sakaki, S. Taudien, K. Blechschmidt, A. Polley, U. Menzel, J. Delabar, K. Kumpf, R. Lehmann, D. Patterson, K. Reichwald, A. Rump, M. Schillhabel, A. Schudy, Nature 405 (2000) 311 – 319. [10] M. Kozak, Mamm. Genome 7 (1996) 563 – 574. [11] H. Kato, J. Biochem. 128 (2000) 923 – 932. [12] R.S. Westphal, S.J. Tavalin, J.W. Lin, N.M. Alto, I.D. Fraser, L.K. Langeberg, M. Sheng, J.D. Scott, Science 285 (1999) 93 – 96. [13] O. Witczak, B.S. Skalhegg, G. Keryer, M. Bornens, K. Tasken, T. Jahnsen, S. Orstavik, EMBO J. 18 (1999) 1858 – 1868. [14] M. Takahashi, H. Shibata, M. Shimakawa, M. Miyamoto, H. Mukai, Y. Ono, J. Biol. Chem. 274 (1999) 17267 – 17274. [15] C.T. Fong, G.M. Brodeur, Cancer Genet. Cytogenet. 28 (1992) 55 – 76. [16] E.J. Neer, C.J. Schmidt, R. Nambudripad, T.F. Smith, Nature 371 (1994) 297 – 300. [17] T.F. Smith, C. Gaitatzes, K. Saxena, E.J. Neer, Trends. Biochem. Sci 24 (1999) 181 – 185.
Characterisation and expression analysis of the WDR9 gene, located in the Down critical region-2 of the human chromosome 21 Veronica C. Ramos a, Jose Manuel Vidal-Taboada a, Salvador Bergon˜on a, Aliana Egeo b, Elizabeth M.C. Fisher c, Paolo Scartezzini b, Rafael Oliva a,d,* a
Human Genetics Research Group, IDIBAPS, Faculty of Medicine, University of Barcelona, Casanova 143, 08023 Barcelona, Spain b Division of Pediatrics Hospital Galliera, Pediatric Service, Mura delle Capuccini Genoa 14, 4-16128, Italy c Neurogenetics Department, Imperial College, Norfolk Place, London, UK d Genetics Service, IDIBAPS, Hospital Clinic i Provincial, Villarroel 170, 08023, Barcelona, Spain Received 12 February 2002; received in revised form 29 May 2002; accepted 4 June 2002
Abstract We report the isolation and characterisation of the gene WDR9 (WD Repeat 9), located in the Down Syndrome critical region-2 (DCR-2) from the human chromosome 21. This gene spans 125 kb of genomic sequence and is organised in 41 exons and 40 introns. The WDR9 cDNA has a size of 13 kb and encodes for a putative protein of 2269 amino acids with a potential location in the nucleus. Expression analysis in different human adult tissues and in cultured cell lines indicates that the gene has several tissue-specific transcripts. The more significant protein signatures in the WDR9 protein sequence are for WD repeats, bromodomain, beta-ketoacyl synthases, and ribonucleoprotein (RNP). The WDR9 protein has a high similarity with the Mus musculus neuronal differentiation protein (NDRP) and a region of similarity with the region of the Yotiao protein that has been proposed to bind the NR1 subunit of the NMDA receptor. The presence of protein – protein interaction domains as such the WD repeats, and the similarity of the WDR9 protein to regulatory proteins suggest a potential involvement in some of the clinical features associated to the DCR-2. D 2002 Elsevier Science B.V. All rights reserved. Keywords: Down Syndrome; WD repeats; Expression analysis; 21q22; Down critical region; WDR9
Down Syndrome (DS) is usually caused by a full trisomy of chromosome 21, although a subset of the patients that carry only a partial trisomy of chromosome 21 also exhibit some of its features [1]. The partial trisomy of the region that includes D21S55 and MX1 markers on sub-bands 21q22.2 and 21q22.3 has been associated with different features of DS [2]. This chromosomal region has been postulated as the minimal region for six facial and dermatoglyphic features and, in some patients, the region is apparently determinant of the pathogenesis of mental retardation, congenital heart disease, and duodenal stenosis [3,4]. This region is known as the Down syndrome critical region-2 (DCR-2) [2]. As part of an effort to isolate, characterise and map the genes potentially responsible for some of the DS features, we have constructed high-resolution physical maps * Corresponding author. Human Genetics Research Group, Faculty of Medicine, University of Barcelona, Casanova 143, 08036 Barcelona, Spain. Tel.: +34-93-4021877; fax: +34-93-4035260. E-mail address: [email protected] (R. Oliva).
[5] and transcriptional maps [6] in the DCR-2 region. This approach has allowed us to locate and characterise several genes such as the SH3BGR gene [7] and the DSCR2 gene [8]. In addition, we had also isolated and located several additional transcription units in this region from human chromosome 21 [6]. Three previously mapped cDNAs, 903H1 (AJ222636), N143 (AJ002572), and N144 (AJ002574) [5,6], located in the A1047 cosmid clone and in the PAC clone 31K18 (Fig. 1), were used as the starting material in the present work. To determine whether these cDNAs were part of the same gene, the draft genomic sequence AF129408 was used to BLAST for new EST sequences, which were purchased and sequenced to completion. The sequences obtained were then assembled into three large sequences contigs and deposited to GenBank: 903H1, HGG-3 (AJ238554) and HGG-4 (AJ238555). Concomitant to the development of the present work, the PAC clone 31K18, which we had also previously mapped to the DCR2 region [5], entered in the genome sequencing project by the German Human Genome Project
0167-4781/02/$ - see front matter D 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 0 2 ) 0 0 4 2 1 - 9
378
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
Fig. 1. Map position of the WDR9 gene. The location of the WDR9 gene in the physical map of the Down critical region-2 is indicated as an asterisk and the orientation of the gene is indicated by a black arrow.
at Jena (http://genome.imb-jena.de). Subsequently, the sequence of this PAC clone became accessible through the GTS division of GenBank (AF129408). The comparisons of the cDNA sequence contigs obtained (903H1, HGG-3, HGG-4) with the genomic draft sequence indicated that these sequences were close to each other. The search also allowed us to identify and obtain several new ESTs (AA516132, R79267, AA962066, AI923376, AA649224, AA459446). The IMAGE consortium cDNA clones were obtained through the UK-HGMP-Resource center and the RZPD at Berlin and sequenced. The results obtained joined all the partial transcribed sequences obtained (903H1, HGG3, HGG4) into one large contig of 8158 bp (that we provisionally named 903H1 gene; AJ238214) containing an ORF distributed in three exons with an open reading frame at the 5Vend and a large 3VUTR (Fig. 2). To span the 903H1 gene at the 5’ region, the draft genomic sequence AF129408 was compared to the EST database and to the non-redundant division of GenBank (BLASTN) leading to the identification of different clusters of ESTs along the unfinished genomic sequence (AI733432, AI791742, BE219326, AI377710, AA251336, BE158873, AU90447,
AW991284, BF039796, AW996975, AW204322, AL544410, AL544381, BE158860, BG153849, AI004650, AI697898, BE348426, BG393428, BG619722) (Fig. 2). We continued with the strategy to try to join the EST clusters located 5Vof the 903H1 gene. Subsequently, we designed two primers, one in a EST cluster sequence located at the 5Vend of the expanded transcriptional unit and the other primer in the 5Vend of the sequence of the enlarged sequence of the 903H1 gene (PCR 12, 24; Fig. 2). We made a total of 52 different RTPCRs walks using this strategy which allowed us to span 3 kb the 5Vend until we detected an EST cluster containing the 5V UTR (Fig. 2). Finally, to further confirm the continuity of all clusters, we performed long RT-PCRs covering all the gene (PCRs 35, 25,33, 23, 24, Fig. 2). The designed primer sequences and the PCR conditions are provided on request by the corresponding author. During the characterisation of the 5Vend of the 903H1 gene, the chromosome 21 mapping and sequencing consortium made public a finished genomic sequence and the prediction of genes [9]. The entire transcribed unit that we have isolated was located in the genomic sequence AL163279 and the majority of the coding sequence was
Fig. 2. Structure of the WDR9 gene showing the position of the exons and introns in the genomic sequence. The ESTs and some of the PCRs performed to demonstrate continuity and structure of the sequence are indicated. The sizes of the exons in base pair, beginning in exon 1, are the following: 148, 59, 30, 60, 151, 99, 161, 222, 101, 71, 101, 41, 99, 151, 125, 129, 226, 186, 184, 94, 132, 95, 190, 126, 108, 125, 83, 112, 62, 156, 121, 126, 73, 42, 144, 153, 167, 221, 168, 900, and 1727. The sizes of the different introns are: 143, 139, 171, 14258, 2068, 361, 1710, 13562, 1334, 1391, 1037, 1700, 3700, 249, 4879, 205, 5787, 2658, 4756, 2610, 8615, 1694, 4096, 88, 2740, 729, 3302, 616, 5747, 232, 2789, 1683, 773, 1736, 638, 3720, 3562, 1938, 556, and 1347. The primer sequences used in the different PCRs, the PCR conditions, and the detected size of the PCR products are available from the authors upon request.
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
379
380
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
included within a predicted gene that was named WDR9 (WD repeat 9). To maintain the approved nomenclature, we adopted the name of WDR9 for our previously and provisionally named 903H1 cDNA. The isolation and characterization of the WDR9 gene, reported in this paper, involved the sequencing and assembling in our laboratory of 12 cDNA clones and 82 ESTs detected by homology to the draft genomic sequence of the DCR-2 region. The sequence obtained from the WDR9 gene has a total length of 12935 bp, featuring an ORF of 6810 bp, a partial 5V UTR of 99 bp and a long 3V UTR of 6026 bp, containing a polyadenylation signal at position 11727. However, other several polyadenylation signals more proximal to the CDS are present at positions 9197, 9317, 9793, 10084 and 10727 of the WDR9 cDNA. The WDR9 gene is organised in 41 exons spanning 125 kb of genomic sequence (Fig. 2). All of the 40 introns are flanked by the consensus GT/AG splice acceptor and donor sequences and have variable sizes ranging from 150 to 14 kb (Fig. 2). The potential CDS region starts at position 100 bp and the starting ATG of the ORF proposed agrees with the Kozak sequence consensus (GCCATGGA/GNNATGG) [10]. The insert from the cDNA 903H1 was used as a probe to perform Northern analysis from different adult human tissues (Fig. 3A), human cell lines (Fig. 3B), mouse embryos at different development stages (Fig. 3E) and different adult mouse tissues (Fig. 3D). The Northern analysis using RNA from adult human tissues indicates that the WDR9 gene has several different transcript sizes and that these different transcripts have tissue specificity (Fig. 3A). The shorter form has a length of 2.6 kb and is detected only in pancreas, the intermediate form is 5.0 kb in length and is only detected in liver, and the larger form of the transcript has a length about 13 kb and is detected in heart and skeletal muscle (Fig. 3A). The Northern analysis of complete mouse embryos of different developmental stages, using as a probe the human 903H1 cDNA, indicates that the gene is expressed from embryonic development stage E11 to stage E18 (Fig. 3E). There are no significant changes in the levels of expression of the gene during the development of the complete mouse embryos from day 11 to 18, and only a transcript size of 7.8 kb has been detected (Fig. 3E). The WDR9 mRNA is expressed in all the mouse tissues analysed and is expressed at higher levels in brain, kidney, testes, pancreas, and muscle as compared to heart, liver, and uterus (Fig. 3D). Only a single transcript has also been detected in the adult mouse tissues with the same size as that detected in the mouse embryonic tissues. Therefore, the transcript size of the mouse WDR9 mRNA is 7.8 kb in length in all of these tissues analysed (Fig. 3D). RT-PCR experiments using human RNA from different tissues indicates that the WDR9 mRNA is expressed in all the tissues analysed (Fig. 3C). Northern analysis in different human cell lines detected that the expression of the WDR9
gene is higher in Jurkat, HL6O and HT29, with an estimated length of 12 kb, as compared with RAJI, Hela, HepG2, and MCF-7, with an estimated length of 5 kb (Fig. 3B). In silico expression (BLAST N and human ESTs) indicates that the WDR9 gene is also expressed in other different tissues not analysed by northern or RT-PCR, such as the adrenal gland (AV705238), colon (AW968556), ovary (AA074939), amygdala (AL120123), testis (AA846522), thymus (L44549), prostate (AI669728), eye (H30353) and aorta (AI708846). The predicted ORF (Fig. 4A) from the WDR9 mRNA sequence encodes for a potential 2269 amino acid protein (257 kDa) with a predicted isoelectric point of 8.5, and 344 strongly basic, 318 strongly acidic, 678 polar and 598 hydrophobic amino acids. The following potential motifs were found (PROSITE-PSITE): 14 sites of N-glycosylation, 15 sites for cAMP- and cGMP-dependent protein kinase phosphorylation, 50 sites for protein kinase C phosphorylation, 50 sites for casein kinase II phosporylation, 3 sites for tyrosine kinase phosporylation, 25 sites for N-myristoylation, 10 sites for amidation, 1 site for eukaryotic putative RNA-binding region ribonucleoprotein (RNP), 1 signature of the beta-ketoacyl synthases family and 2 sites with the Trp –Asp (WD) repeat signature. The WDR9 protein also has a signature for a bromodomain. The exact function of this domain is not yet known but it is thought to be involved in protein – protein interactions and it may be important for the assembling or the activity of multicomponent complexes involved in transcriptional activation. The most significant similarities (BLASTP) detected for WDR9 were for the mouse protein BAB16299 related to neuronal differentiation protein (NDRP), involving the region 5-977 of the WDR9 protein with an identity of 59% and a similarity of 72%. NDRP shows predominant expression in neurons in retina and olfactory epithelia during embryonic development, and exhibits up-regulated expression in hypoglossal motor neurons after injury. In addition, this protein has been proposed as a regulatory protein and versatile for diverse functions such as signal transduction, RNA processing, gene regulation, and cell cycle [11]. The WDR9 protein has also some regions of identity with the Drosophila melanogaster CG6400 gene product (AAF56278), and to the IRS-1 PH domain of the human protein PHIP (Fig. 4B). Since the WDR9 protein has WD repeats, we also find similarity with proteins that contain these motifs, such as the Arabidopsis thaliana WD-40 repeat protein-like, the D. melanogaster WDs gene product, the human WDR5 and the human Katanin p80 (WD40-containing) subunit B1. Also a similarity (48%) was detected with the region of Yotiao protein that has been proposed to bind the NR1 subunit of the NMDA receptor and with other proteins that contain the Yotiao protein domain (CG-NAP, AKAP450, AKAP350, and Hyperion) which are also involved in protein associates [12 – 14]. Thus, through the
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
381
Fig. 3. Pattern of expression of the WDR9 gene. (A) Northern analysis from adult human tissues. (B) Northern analysis from different human cell lines. The length estimated from the different mRNA transcripts of the WDR9 gene is indicated at the right. (C) RT-PCR analysis from adult human tissues; the length of the PCR product is shown. (D) Northern analysis from different adult mouse tissues. (E) Northern analysis from different mouse embryo development stages. In the lower panel of B, D, and E, the 28 S RNA is shown for normalization. Northern blot: total RNA was isolated (tripure) from mouse adult tissues, mouse embryos in different stages of development, and different human cell lines. Ten micrograms of total RNA was electrophoresed in 1.2% denaturing agarose gel with formaldehyde, transferred with 20 SSC to a Nytran Plus nylon membrane (Schleider&Schuell). Northern analysis of human adult tissues was performed using commercial human Northern blots from Clontech. We used as probe the cDNA 903H1 clone labelled with the Rediprime II kit (Amersham). Hybridisations were done overnight at 42 jC in hybridisation solution (Ambion), and washes were performed with 0.1 SSC and 0.1% SDS (2 5Vroom temperature, 2 15Vat 37 jC, and 15Vat 55 jC). The filter was exposed for 2 days at an image plate BAS_MP (Fujifilm), and the image was captured in a Molecular Imager FX (Bio-Rad) and processed using the Quantity One 4.0 software (Bio-Rad). RT-PCR: was made using total RNA obtained from different tissues and Superscript II (Gibco), and the primer 903H1.1 (TGCTGAATGCTGCTACAAAG). The cDNA was amplified using the primers 903H1.1 and 903H1.2 (AGCAGCAATCTCAGGGTAAC).
region of similarity to the Yotiao protein, the WDR9 protein could be related to the protein –protein interactions such as with receptor proteins. The potential subcellular location of the WDR9 protein indicates a probable presence in the nucleus (reliability of 74%; PSORT). The fact that the WDR9 gene is expressed in human cell lines and tissues that have high rate of proliferation,
such as embryos, cancer tissues and tumour-derived cell lines could indicate a potential role of the WDR9 gene in cell proliferation. Consistent with this potential role, the WDR9 protein contains eight WD domains detected with the PFAM and Smart programs (Fig. 4A). Proteins containing WD repeats are generally regulatory proteins that are versatile for diverse functions such as signal trans-
382
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
Fig. 4. (A) Sequence of the protein showing the different domains and consensus patterns: The beta-ketoacyl synthases: G-X (4)-[LIVMFAP]-X (2)-[AGC]-C[STA](2)-[STAG]-X (3)-[LIVMF], RNP consensus pattern: [RK]-G- {EDRKHPCG -[AGSCI]-[FY]-[LIVA]-X-[FYLM], WD-repeat consensus pattern G/ AHXXXV/IXXV/L/I/CXF/W/L/I/VXX [O-?] P/S/DD/N7SG/S/P [0-3] XL I/V/FA/V/L/I. Bromo domain consensus pattern: [STANVF]-x (2)-F-x (4)-[DNS]-x (5,7)-[DENQTF]-Y-[HFY]-x (2)-[LIVMFY]-x (3)-[LIVM]-x (4)-[LIVM]-x (6,8)-Y-x (12,13)-[LIVM]-x (2)-N-[SACF]-x (2)-[FY]. (B) Blast results with the most important identities.
duction, RNA processing, gene regulation, vesicular traffic, and regulation of cytoskeletal assembly and cell cycle [15,16]. None of the WD proteins has been shown to have an enzymatic activity. The WD repeats form pro-
peller structures creating a stable platform that can form reversible complexes with several proteins, thus coordinating sequential and/or simultaneous interactions involving several sets of proteins [17].
V.C. Ramos et al. / Biochimica et Biophysica Acta 1577 (2002) 377–383
The potential function related with protein – protein interaction, and a potential role in cellular proliferation makes the WDR9 protein an interesting protein to start functional studies to demonstrate these potential implications. The characterisation of the WDR9 gene opens up the possibility to develop functional strategies to study the implication of the gene in the features of DS associated with the chromosomal region where the gene is located. Acknowledgements This work has been supported by grants from the European Union BMHS-CT96-0554, from Marato´ de TV3 1994 (CANCER 953006), from Fundacio` Catalana Sindrome de Down (Marato´ de TV3) and from Generalitat de Catalunya (1999 SGR-00226) to R.O. We thank Maria Pique and Joan Gil for the help in the cell lines analysis and Nicos Katsanis for the help in providing the cDNA clones N143 and N144. References [1] J. Lejeune, et al., C.R.A.S. 148 (1959) 1721. [2] J.M. Delabar, D. Theophile, Z. Rahmani, Z. Chettouh, J.L. Blouin, M. Prieur, B. Noel, P.M. Sinet, Eur. J. Hum. Genet. 1 (1993) 114 – 124. [3] J.R. Korenberg, C. Bradley, C.M. Disteche, Am. J. Hum. Genet. 50 (1992) 294 – 302.
383
[4] J.R. Korenberg, X.N. Chen, R. Schipper, Z. Sun, R. Gonsky, S. Gerwehr, N. Carpenter, C. Daumer, P. Dignan, C. Disteche, et al., Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 4997 – 5001. [5] J.M. Vidal-Taboada, S. Bergonon, P. Scartezzini, A. Egeo, D. Nizetic, R. Oliva, Biochem. Biophys. Res. Commun. 241 (1997) 321 – 326. [6] J.M. Vidal-Taboada, S. Bergonon, M. Sanchez, C. Lopez-Acedo, J. Groet, D. Nizetic, A. Egeo, P. Scartezzini, N. Katsanis, E.M. Fisher, J.M. Delabar, R. Oliva, Biochem. Biophys. Res. Commun. 243 (1998) 572 – 578. [7] A. Egeo, M. Mazzocco, F. Sotgia, P. Arrigo, R. Oliva, S. Bergonon, D. Nizetic, Q.A. Rasore, P. Scartezzini, Hum. Genet. 102 (1998) 289 – 293. [8] J.M. Vidal-Taboada, S. Sanz, A. Egeo, P. Scartezzini, R. Oliva, Biochem. Biophys. Res. Commun. 250 (1998) 547 – 554. [9] M. Hattori, A. Fujiyama, T.D. Taylor, H. Watanabe, T. Yada, H.S. Park, A. Toyoda, K. Ishii, Y. Totoki, D.K. Choi, E. Soeda, M.Ohki, T. Takagi, Y. Sakaki, S. Taudien, K. Blechschmidt, A. Polley, U. Menzel, J. Delabar, K. Kumpf, R. Lehmann, D. Patterson, K. Reichwald, A. Rump, M. Schillhabel, A. Schudy, Nature 405 (2000) 311 – 319. [10] M. Kozak, Mamm. Genome 7 (1996) 563 – 574. [11] H. Kato, J. Biochem. 128 (2000) 923 – 932. [12] R.S. Westphal, S.J. Tavalin, J.W. Lin, N.M. Alto, I.D. Fraser, L.K. Langeberg, M. Sheng, J.D. Scott, Science 285 (1999) 93 – 96. [13] O. Witczak, B.S. Skalhegg, G. Keryer, M. Bornens, K. Tasken, T. Jahnsen, S. Orstavik, EMBO J. 18 (1999) 1858 – 1868. [14] M. Takahashi, H. Shibata, M. Shimakawa, M. Miyamoto, H. Mukai, Y. Ono, J. Biol. Chem. 274 (1999) 17267 – 17274. [15] C.T. Fong, G.M. Brodeur, Cancer Genet. Cytogenet. 28 (1992) 55 – 76. [16] E.J. Neer, C.J. Schmidt, R. Nambudripad, T.F. Smith, Nature 371 (1994) 297 – 300. [17] T.F. Smith, C. Gaitatzes, K. Saxena, E.J. Neer, Trends. Biochem. Sci 24 (1999) 181 – 185.