Characteristics and applications of a recombinant alkaline serine protease from a novel bacterium Bacillus lehensis

Bioresource Technology 131 (2013) 76–85

Contents lists available at SciVerse ScienceDirect

Bioresource Technology journal homepage: www.elsevier.com/locate/biortech

Characteristics and applications of a recombinant alkaline serine protease from a novel bacterium Bacillus lehensis Swati Joshi, T. Satyanarayana ⇑ Department of Microbiology, University of Delhi South Campus, New Delhi 110 021, India

h i g h l i g h t s " First report on the production of recombinant alkaline protease from Bacillus lehensis. " A 4.1-fold increase in enzyme activity was achieved by cloning and expression. " The enzyme is solvent tolerant and SDS-stimulated. " The enzyme is useful as detergent additive and in silver recovery from used films. " The enzyme is applicable in silk degumming and biocontrol of nematodes.

a r t i c l e

i n f o

Article history: Received 27 August 2012 Received in revised form 17 December 2012 Accepted 18 December 2012 Available online 25 December 2012 Keywords: Bacillus lehensis Alkaline protease Heterologous expression Alkalistable Biocontrol

a b s t r a c t A highly alkaline protease (BLAP) from a novel psychrotolerant and alkaliphilic bacterium, Bacillus lehensis was cloned and expressed in Escherichia coli. BLAP belongs to subtilase S8 family of proteases, comprising 27 aa secretion signal, 83 aa prosequence and 269 aa mature BLAP. The amino acids Asp 141, His 171 and Ser 324 form catalytic triad, while Ile 214, Leu 233 and Asn 267 are other active site moieties. Recombinant alkaline protease (rBLAP) is a monomeric protein of 39.0 ± 1.0 kDa, and it is active over broad pH (8–12) and temperature (30–60 °C) ranges, with optima at pH 12.8 and 50 °C. rBLAP is stimulated by SDS, Co2+, Ca2+, b-ME, and inhibited by Hg2+ and PMSF. The rBLAP is compatible with commercial detergents, useful in silk degumming and silver recovery from the used photographic films and a potent biocontrol agent for arresting the development of eggs of the nematode Meloidogyne incognita. Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction Proteases occupy a pivotal status with respect to their commercial applications, which are hydrolytic enzymes that cleave peptide bonds in proteins and peptides. Due to their extensive use in a wide range of industrial applications, they hold a major share in the enzyme market with two-thirds in the detergent industry alone (Haki and Rakshit, 2003). These enzymes are utilized in leather, food, pharmaceutical and textile industries, in peptide synthesis, waste water treatment and biocontrol. For being applicable as detergent additive, proteases need to be active at high pH and moderate temperature, and in the presence of various additives like solvents, surfactants and oxidizing agents (Manachini and Fortina, 1998). Although the production of alkaline proteases has been reported from a wide range of microbes, a large proportion ⇑ Corresponding author. Address: Department of Microbiology, University of Delhi South Campus, Bentio Juarez Road, New Delhi 110 021, India. Tel.: +91 1124112008; fax: +91 11 24115270. E-mail address: [email protected] (T. Satyanarayana). 0960-8524/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.biortech.2012.12.124

of the commercially available ones are derived from Bacillus spp. (Mehrotra et al., 1999). Bacillus strains are preferred because of their ability to produce enzymes extracellularly in a short time (Maurer, 2004). In order to produce alkaline proteases in a cost effective manner, attempts have been made to clone and express them in heterologous systems such as Escherichia coli (Fu et al., 2003; Karbalaei-Heidari et al., 2008). Proteases have been found useful in degrading gelatin coating over the used X-ray and photographic films that liberates silver present in the gelatin layer. About 18–20% of the world’s silver demand is met with that derived from waste products like X-ray and photographic films (Nakiboglu et al., 2003). According to Arami et al. (2007), 22–25% of natural silk is composed of sericin protein that gives harsh and stiff texture to the fibre, but diminishes the shine and whiteness of silk that affects the dyeing process. Enzymatic removal of sericin is an environment-friendly process of silk degumming (Arami et al., 2007). Proteases have also been tested as biocontrol agents against numerous agricultural pests. Several nematode species are known to be pathogenic to crop plants leading to huge economic losses.

S. Joshi, T. Satyanarayana / Bioresource Technology 131 (2013) 76–85

Proteases from Pochonia chlamydosporia (Ward et al., 2012) and Pseudomonas fluorescens CHA0 (Siddiqui et al., 2005) have been found useful as biocontrol agents against root knot nematodes. In this investigation, an alkaline protease from a novel psychrotolerant and alkaliphilic Bacillus lehensis MTCC7633 was cloned and expressed in biologically active form in mesophilic host E. coli. The recombinant alkaline protease was purified and characterized, and its applicability in degrading gelatin from the used X-ray/photographic films, degumming of raw silk, as a detergent additive and in the biocontrol of plant pathogenic nematode Meloidogyne incognita was tested. 2. Methods 2.1. Bacterial strains and vectors B. lehensis, a psychrotolerant and alkaliphilic bacterium isolated from soil of Leh (India), was described as a novel species and maintained on nutrient agar plates at 20 °C (Ghosh et al., 2007) and deposited at Microbial Type Culture Collection, Institute of Microbial Technology, Chandigarh, India (MTCC 7633). E. coli DH5a (genotype: F endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG U80dlacZDM15 D (lacZYA-argF) U169, hsdR17 (rKmK+), k-) was used for cloning and DNA manipulations. E. coli DH5a was maintained on LB agar plates. E. coli BL21 (DE3) (genotype: F- ompT gal dcm lon hsdSB (rB  mB) k (DE3 (lacI lacUV5-T7 gene1 ind1 sam7 nin5) was used for expression studies and was grown in LB with kanamycin (50 lg/mL) for recombinant protein expression. TA cloning vector pGEM-T Easy (Promega) was used for primary cloning and sequencing purposes. pET28a (+) (Novagen CA, USA) was used as an expression vector. 2.2. Primer synthesis for PCR and sequencing Genomic DNA of B. lehensis was isolated according to Dulmau (1982). Isolated DNA was used as a template for amplification of alkaline protease (BLAP) gene. Various alkaline protease gene sequences, available at NCBI database, were aligned using ClustalW alignment tool. Conserved oligonucleotide sequences were identified from the aligned sequences. Based on the conserved nucleotide sequences, a pair of internal primers (BLAP Int F0 : 50 TCCGTTGAACTTGATCCAGAAG30 and Int BLAP Int R0 : 50 GCCATAGATG-TACCATTGAAGC30 ) was designed for amplifying alkaline protease encoding gene. The amplified partial fragment of alkaline protease gene was cloned into pGEM-T Easy vector and sequenced using T7 forward and SP6 reverse primers. Based on the homology of this partial sequence with the known proteases, a new set of primer pair (BLAP ‘F 50 ATGAATAAGAAAATGGGG30 and BALP R0 TTAACGTGTTGCCGCTTCTGCG) was designed to get full-length amplification of BLAP ORF. NCBI tool ORF finder was used for identifying BLAP ORF. A third pair of primers (BLAP NdeI F0 : CGACATATGGCCG-AGGAAGCAAAGG30 and BLAP XhoI R0 : 50 CGACTCGAGACGTGTTGCCGCTTCTGCG30 ) was designed to obtain BLAP gene, without secretion signal, for expression studies. Using BLAP NdeI F0 and BLAP XhoI R0 primers, BLAP gene was amplified using Pfu DNA polymerase (Fermentas) and Taq polymerase in 1:4 ratio under optimized PCR program (denaturation step at 95 °C for 5 min, followed by 30 cycles of denaturation at 95 °C for 50 s, annealing step at 52 °C for 40 s and extension step at 72 °C for 1 min 20 s) in 25 lL reaction with final extension step at 72 °C for 7 min in a C1000TM thermocycler (Biorad, USA). 2.3. Construction of recombinant rBLAP-pET28a The ORF of the amplified BLAP was cloned into pGEM-T vector. Positive rBLAP-pGEMT clones were screened both by blue–white

77

selection on IPTG-Amp-X-Gal LB agar plates and colony PCR. Plasmid from positive clones was double digested with NdeI and XhoI (New England Biolabs) restriction enzymes, and the fallout was cleaned up using Qiagen DNA purification kit (Qiagen, Germany). pET28a (+) was also double digested with NdeI and XhoI. Dephosphorylation of double digested pET28a (+) was done using Calf Intestinal Alkaline Phosphatase (CIAP). BLAP fallout and double digested pET28a (+) were ligated using T4 DNA ligase at 16 °C for overnight. The ligated product was transformed into competent E. coli DH5a cells. The positive rBLAP-pET28a clones were confirmed by colony PCR and double digestion of the construct with NdeI and XhoI. Ten positive clones were sequenced at the Nucleic acid Sequencing Facility, University of Delhi South Campus, New Delhi. 2.4. Gene expression in E. coli BL21 (DE3) A total of ten clones were sequenced, and one having the same sequence was selected for further studies. Plasmid rBLAP-pET28a from the selected clone was isolated and transformed into E. coli BL21 (DE3). A 16 h inoculum of the recombinant E. coli BL21 (DE3) was prepared in 5 mL Luria–Bertani medium containing kanamycin with 50 lg/mL (LB kan). Fifty milliliter LB-kan was inoculated with 1% (v/v) inoculum and incubated at 37 °C to 0.5– 0.6 OD600, followed by expression of rBLAP was induced by 0.5 mM isopropyl-b-D-1-thiogalactopyranoside (IPTG) at 30 °C. After 16 h of induction, biomass was harvested by centrifugation, and localization of the expressed rBLAP was studied according to Verma and Satyanarayana (2012). 2.5. Bioinformatic analysis of rBLAP The nucleotide and protein sequences of rBLAP were compared against the National Center for Biotechnology Information (NCBI) nucleotide/protein database, using Basic Local Alignment Search Tool for Nucleotides (BLASTn) and BLAST for proteins (BLASTp), respectively. Multiple sequence alignment (MSA) and phylogenetic analysis was performed by ESPript (2.2) and MEGA program (version 5, using neighbour-joining algorithm), respectively. The presence of a putative secretion signal peptide at N-terminus was predicted using SignalP 4.0 (http://www.cbs.dtu.dk/). 2.6. Homology modelling rBLAP amino acid sequence without signal peptide was used for homology modelling. SWISS-MODEL workspace server was used to identify the template and model building (http://swissmodel.expasy.org/workspace). PyMOL software was used for analysing the model (http://www.expasy.ch/swissmod/SWISSMODEL.html). 2.7. Purification of recombinant alkaline protease rBLAP was purified to homogeneity by Ni2+-affinity chromatography (IMAC) under non-denaturing conditions using NovagenÒ Ni–NTA HisBindÒ resin. The biomass of induced E. coli BL21 (DE3) cells was sonicated using SonicsÒ Vibra cell sonicator probe 630–0219: 13 mm at 25 amplitude (15 cycles of 1 min pulse, 2 s on/off) in binding buffer (containing 50 mM phosphate buffer (pH 8), 100 mM NaCl, 10 mM MgCl2, 1 mg mL1 lysozyme, 5 mM b-mercaptoethanol and 5% glycerol) for releasing intracellular rBLAP. After sonication, the supernatant containing rBLAP was collected for purification. A packed column volume (CV) of 5 mL resin was used for purification process. Ni2+-NTA resin was first washed with 5 CV of deionized water and then equilibrated with 5 CV of binding buffer. Thereafter the supernatant was passed through the column for binding of the 6X histidine containing recombinant

78

S. Joshi, T. Satyanarayana / Bioresource Technology 131 (2013) 76–85

protein to the matrix. After binding, column was washed with 2 CV of binding buffer containing 20 mM imidazole to wash out nonspecifically bound proteins and other impurities. Finally the bound recombinant protein was eluted with increasing gradient of imidazole (100 mM to 1 M concentration). One CV of each concentration was passed through column and fractions were collected. Collected fractions were checked for purity of the enzyme on 12.0% SDS–PAGE. The protease activity of purified rBLAP was confirmed by enzyme assay and zymography. The protein concentration was determined using Bio-Rad Protein Assay Kit. 2.8. Enzyme and plate diffusion assay Protease activity was assayed according to Meyers and Ahearn (1977) with slight modifications. The reaction mixtures containing 0.5 mL appropriately diluted enzyme, 0.5 mL 50 mM glycine– NaOH buffer (12.8) and 1 mL 1% substrate casein (prepared in 50 mM glycine–NaOH buffer pH 12.8) was incubated for 20 min at 50 °C, and the reaction was terminated by adding 4.0 mL 5.0% trichloroacetic acid (TCA) followed by incubation for 30 min in ice. The precipitate formed thus was removed by centrifugation, and the protein content in the supernatant was determined. One unit of alkaline protease is defined as the amount of enzyme that liberates 1.0 nmol of tyrosine s1 under the assay conditions. Plate diffusion assay was performed by dispensing soluble fraction from induced recombinant cells into wells bored in skim milk agar plate (2% Agar + 1% skim milk powder in 0.1 M Glycine–NaOH pH 10.0 buffer).Thereafter the plate was incubated overnight at 50 °C and observed for the development of halo of casein hydrolysis around the wells. 2.9. Zymogram development The substrate gelatin was copolymerized with acrylamide at 0.1% concentration. Zymography was performed in 12% SDS–PAGE. Purified rBLAP was subjected to electrophoresis at room temperature. After electrophoresis, the gel was immersed in water for half an hour with intermittent shaking to remove running buffer components. The gel was equilibrated with 50 mM glycine–NaOH buffer (pH 12.8) and incubated in the same buffer for the next 4.0 h at 50 °C. For visualization of protease activity, the gel was first stained with Coomassie Brilliant Blue R250 (CBB R 250) and then destained in 5.0% methanol plus 7.5% acetic acid solution. Gel was observed for the development of clear zone of gelatin hydrolysis against dark blue background. 2.10. Biochemical characterization of rBLAP Purified rBLAP was used for its characterization. The effect of pH on enzyme activity was studied by carrying out enzyme assay in buffers of different pH. Glycine–HCl buffer (pH 2.0, 3.0), sodium acetate buffer (pH 4.0, 5.0, 6.0) and sodium phosphate buffer (pH 7.0, 8.0) and glycin–NaOH buffer (pH 9.0–12.8) were used in determining the optimum pH. Similarly, optimum reaction temperature was determined by assaying rBLAP activity at various temperatures (30–90 °C). The stability of rBLAP at different pH and temperatures was also determined by pre-incubating the enzyme at desired pH/temperature. Aliquots were taken at different time intervals and the protease was assayed. Kinetic constants km and Vmax were determined at 50 °C by measuring rBLAP activity at different concentrations of casein and drawing Lineweaver–Burke plot. The effect of various metal ions on rBLAP activity was assessed by pre-incubating the reaction mixtures containing CaCl2, BaCl2, MgCl2, HgCl2, PbCl2, CoCl2, MnCl2, NiSO4, FeSO4, ZnCl2 for 30 min and then determining residual activities. The effect of inhibitors

[b-ME (b-Mercaptoethanol), dithiothreitol (DTT), ethylenediaminetetraacetic acid (EDTA), phenylmethylsulphyonyl fluoride (PMSF), N-bromosuccinimide (NBS), iodoacetate (IAA) and N-ethylmaleimide (NEM)] was studied by including them in the reaction mixtures. To study the effect of organic solvents, the enzyme was pre-incubated for 1 h at 5.0% and 10.0% of n-hexane, 1-butanol, isopropanol, ethanol, methanol, chloroform, glycerol, benzene and toluene, and then the residual activity was measured. The effect of commercial detergents available in the local market (Surf Excel, Safe wash, Rin, Tide, Ariel, Ezee, Condite) was studied by pre-incubating rBLAP at 0.5% and 1.0% of detergents for an hour, after which the residual enzyme activity was determined. Similarly the effect of SDS, CTAB, Tweens, PEGs and oxidizing agents (H2O2 and sodium perborate) was also studied. Glycine, sucrose, trehalose, mannitol, sorbitol, glycerol, PEG 8000, PEG 4000, dextran and Ca2+ ions were tested for their stabilizing effect on rBLAP at 60 °C. 2.11. Testing the applicability of rBLAP 2.11.1. Degelatinization of waste photographic films A piece of used photographic film (1  2 cm, Fuji, Japan) was treated with 5.0 U of rBLAP in glycin–NaOH buffer (pH 12.8) at 40 °C. Photographic film without rBLAP enzyme under same conditions served as the control. Removal of brown gelatinous layer was observed at regular time intervals. The liberated gelatin was run on 12% SDS–PAGE. 2.11.2. Silk degumming Raw silk threads were dried at 80 °C to constant weight and treated with 7 U of rBLAP at 30 °C in glycine–NaOH buffer (pH 10) for 2 h. The treated fibres were then washed with water and dried at 80 °C. Difference in the weight of rBLAP treated and untreated silk was measured. Structure of treated and non-treated fibres was observed under scanning electron microscope (SEM LEO-43S VP, Cambridge, UK) at All India Institute of Medical Sciences (AIIMS), New Delhi. 2.11.3. Biocontrol of M. incognita Egg masses of root infecting nematode M. incognita (approximately 200 eggs) were collected from the infected roots of Azuki beans (Vigna angularis) cultivated in the pots at Indian Agricultural Research Institute (IARI), New Delhi. The bioassay was performed in microtiter plates using one egg-mass per well. One egg-mass was suspended in 5.0 units of rBLAP in buffer (50 mM phosphate buffer, pH8). The egg mass suspension in water and buffer was used as the negative control. The whole set up was incubated at 28 °C in incubators. Microscopic observation was done at the desired intervals. 3. Results and discussion The primer pair (BLAP Int F0 and BLAP Int R0 ) designed using consensus sequences amplified 737 bp stretch of rBLAP. Using second primer pair (BLAP F0 and BLAP R0 ), full length ORF of 1140 bp length encoding B. lehensis protease was amplified. The complete ORF consisted of a start codon ATG and a stop codon TAA at the termini. The presence of secretion signal in 1140 bp ORF was identified using SignalP 4.0 server. An 81 bp sequence was found to encode a 27 aa long secretion signal. The deduced amino acid sequence of this peptide stretch is MNKKMGKIVAGTALIISVAFSSSIAQA. The 1059 bp ORF with 44.13% GC was PCR amplified with BALP NdeI F0 and BLAP XhoI R0 primers and cloned into pET28a (+) (Fig. 1). BLAST analysis of the cloned sequence revealed that rBLAP has 99% similarity with alkaline elastase YaB (P20724) and 98% similarity with protease AprN (AB005792.1). In addition,

S. Joshi, T. Satyanarayana / Bioresource Technology 131 (2013) 76–85

rBLAP exhibited 81% and 82% similarity with alkaline serine protease (YP-174261.1) of Bacillus clausii KSM-K16 and subtilisin savinase (P29600.1) from Bacillus sp., respectively. Despite the prosequence attached to rBLAP, it was fully active, which suggests that prosequence of rBLAP does not interfere with proper folding of rBLAP. Several extracellular proteases have been reported to get translated as full length proteases comprising pre-sequence that aids in secretion and plays a role in folding of the mature protein, and sometimes this gets cleaved off the mature protease by self cleavage (Li et al., 2007). Catalytic triad consisted of Asp 141, His 171and Ser 324 in rBLAP, which has is also found in other serine proteases (Kulakova et al., 1999). Upon Conserved Domain Database (CDD) analysis of rBLAP, another 3 residues Ile 214, Leu 233 and Asn 267 have been found to be crucial for catalysis. Proteases similar to rBLAP are mostly subtilisins from Bacillus spp. Phylogenetic analysis rBLAP protein sequence showed that rBLAP is closest to alkaline elastase YaB from Bacillus sp. YaB (Fig. 3). A comparison of rBLAP with YaB (P20724) and subtilisin Carlsberg (NC006322) confirmed that this is similar to YaB protease. The amino acid composition, pI value, grand average of hydropathicity (GRAVY) and aliphatic index values of rBLAP are close to those of YaB (Table 1). The full length alkaline protease gene sequence of B. lehensis MTCC 7633 (BLAP) has been submitted to GenBank (accession No. JQ798170).

79

The maximum enzyme production was attained at 30 °C, 200 rpm, 0.6 A600 and 0.5 mM IPTG in 16 h. The specific protease activity in the native host was 7.0 U mg1 as compared to that of the recombinant (29 U mg1), which corresponds to 4.1-fold increase in enzyme production in the latter over that of the former. Whole recombinant enzyme was located in the cytoplasmic fraction, and the periplasmic and extracellular fractions did not contain the recombinant enzyme as in AprX-SK37 protease from Virgibacillus sp. SK37 (Phrommao et al., 2011). The rBLAP was eluted from Ni2+-NTA matrix with 200 and 300 mM imidazole. The molecular mass of the enzyme was confirmed using denaturing molecular weight makers. The purified rBLAP resolves as a single band corresponding to 39.0 ± 1.0 kDa on 12% SDS–PAGE. The rBLAP was cloned with an 83 amino acid long pro-sequence attached to its N-terminal end that adds 9.1 kDa to its molecular weight. The recombinant rBLAP is monomeric protein of 40 kDa like that of Bacillus spp. (Shirai et al., 1997; Hadj-ali et al., 2007). In zymogram analysis, copolymerized gelatin was digested by the protease and the area of digestion appeared white against a dark blue background (Fig. 2). The rBLAP is optimally active at pH 12.8 and retains 80% activity at pH 8.0 (Fig. 4). Alkaline proteases show optimum activity in the alkaline range and one of the major aims of protein engineering has been to design proteins that are active in extreme conditions

Fig. 1. Pictorial presentation of cloning of rBLAP ORF in pGEM-T followed by double digested of rBLAP-pGEMT with NdeI and XhoI to take out the fallout, and subsequent cloning of fallout into pET28a (+) to obtain rBLAP- pET28a.

80

S. Joshi, T. Satyanarayana / Bioresource Technology 131 (2013) 76–85

Table 1 Comparison amino acid profile of rBLAP with amino acid profile of subtilisin Carlsberg and YaB protease. Enzyme

Ratio of different amino acids (aa) a

rBLAP (JQ798170.1) Subtilisin carlsberg (NC006322) YaB (P20724) a b c d e f

b

c

d

Theoritical pI

Gravy indexf

Aliphatic index

4.72 7.80 4.66

0.025 0.022 0.014

87.54 84.72 87.54

e

Charged aa

Acidic aa

Polar aa

Hydrophobic aa

Aromatic aa

61 66 60

35 29 35

99 90 100

105 99 104

28 33 27

Charged: glutamete, aspartate, arginine, lysin, histidine. Acidic: aspartate, glutamate. Polar: arginine, lysine, aspartate, glutamate; asparagine, glutamate; Hydrophobic: valine, isoleucine, metheonine, phenylalanine, tryptophan, cystein. Aromatic: tyrosine, tryptophan, histidine, phenylalanine. Gravy: grand average of hydropathicity.

Fig. 2. (A) Purification of rBLAP after expression in E. coli BL21 (DE3), M: molecular weight standard; L1: induced E. coli BL21 (DE3) harboring pET28a (+); L2: uninduced E. coli BL21 (DE3) harboring rBLAP-pET28a; L3: induced E. coli BL21 (DE3) harboring recombinant rBLAP-pET28a; L4: purified rBLAP, (B): zymogram (C) plate diffusion assay performed with crude protein samples and purified rBLAP showing halo due to rBLAP activity.

(Jaenicke, 1991). Alkaline protease from Bacillus sp. RGR-14 had been reported to be optimally active at pH 11.0 (Oberoi et al., 2001), and that of Vibrio metschnikovii DL 33–51 at 12.0 (Mei and Jiang, 2005). rBLAP is quite stable at high pH as its activity did not decrease at all even after 24 h incubation at pH 12.8 (Fig. 4). rBLAP was optimally active at 50 °C, and retained 90% of activity at 40 °C, but quickly lost activity within 5 min when incubated at 60 °C, suggesting that the enzyme functions well at 40–50 °C. The protease from B. subtilis strain DM-04 was active in the temperature range between 37 and 45 °C (Rai and Mukherjee, 2009). Glycine (amino acid), sucrose and trehalose (sugars), mannitol, sorbitol, glycerol (sugar alcohols), PEG 8000, PEG 4000 (polyethylene glycols of different molecular weights), dextran (polysaccharide), and Ca2+ ions (metal ion) improved thermostability of rBLAP at 60 °C. Upon treatment with these agents, the stability of rBLAP increased significantly at 60 °C. Among thermo-stabilizing agents, glycine and Ca2+ exerted maximum thermo-stabilizing effect on rBLAP. The T1/2 of rBLAP increased to 30 min in the presence of 5 mM Ca2+ at 60 °C. At higher temperatures, Ca2+ ions have been reported to play a critical role in stabilizing the alkaline proteases

(Hadj-Ali et al., 2007). After heat treatment at 60 °C for 60 min, residual activities of Ca2+ treated and untreated serine proteases were 62% and 100%, respectively. Thermo-stabilizing effect of polyhydric alcohols, PEG and casein had also been reported for protease from Cucurbita ficifolia at 65 °C (Gonzalez et al., 1992). The rBLAP is quite active between 30 and 50 °C, which makes it suitable for different applications such as detergent additive and silk degumming as well as degelatinization of X-ray films. The Vmax of the rBLAP is 25.0 nmol mg1 sec1 and Km is 0.2 mg mL1 for casein, and those of the enzyme from the native host are 7.0 nmol mg1 sec1 and 0.35 mg mL1, respectively (Table 5). Thus rBLAP has higher affinity and rate of reaction than the native as reported for the alkaline protease of Lactobacillus brevis (FemiOla and Olayinka, 2012). Among metal ions tested, Co2+ and Ca2+ exerted stimulatory effect on rBLAP, while Hg2+ completely inhibited rBLAP at 5 mM concentration (Table 2). The inhibitory effect of Hg2+ indicated that carboxyl groups and aromatic rings are perturbed by interaction with Hg2+ ions (Dey et al., 2002). Hg2+ interacts with aromatic ring of tryptophan and oxidizes indole ring of this amino acid (Liu et al.,

S. Joshi, T. Satyanarayana / Bioresource Technology 131 (2013) 76–85

81

Fig. 3. (A) Phylogenetic Neighbour Joining (NJ) Tree, constructed using rBLAP amino acid sequence along with other protease sequences retrieved from NCBI database. The digit at each branch point represents percentage bootstrap support calculated from 1000 replicates. Deduced amino acid sequence of rBLAP exhibited maximum homology with alkaline protease from Bacillus sp. YAB, (B) multiple sequence alignment (MSA) of BLAP with YaB and AprN proteases, drawn using ESPript 2.2. Solid blue and green bars indicate the secretion signal sequence and prosequence, respectively, aligned with YaB and ApeN proteases. Here symbols a and b indicate alpha helix and beta sheets, respectively. TT denotes sharp turn in the structure. Positions shown in orange boxes are residues comprising catalytic triad (Asp 141, His 171and Ser 324). Blue boxes enclose active site residues Ile 214, Leu 233 and Asn 267. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

2010). Protease from Virgibacillus pantothenticus had also been stimulated by Ca2+ ions (Gupta et al., 2008). Ni2+, Zn2+, Fe2+ and Mn2+ had no significant observable effect at lower concentration but were inhibitory at 5 mM. Among inhibitors tested, only phen-

ylmethylsulfonyl fluoride (PMSF), which is a well known serine protease inhibitor, inhibited the rBLAP completely at 5.0 mM indicating rBLAP is a serine protease. rBLAP has been inhibited to the extent of 70% at 5 mM concentration of EDTA, which is a potent

82

S. Joshi, T. Satyanarayana / Bioresource Technology 131 (2013) 76–85

30

(B) 30

25

25

Activity (n mol mL-1 sec-1)

-1

-1

Activity (n mol mL sec )

(A)

20 15 10 5

20 15 10 5 0

0 0

10

20

30

40

50

60

70

80

0

90

2

4

6

(C) 100

90 80

% Residual Activity

% Residual activity

14

pH 12.8

70

50 ºC

50 40 30 20 10

60 ºC

0

12

100

80 60

10

(D)

40 ºC

90

8

pH

Temperature (ºC)

pH 10

70 60

pH 8

50 40

pH 7

30 20 10 0

0

4

8

0

12 16 20 24 28 32 36 40 44

4

6

8

10

12

14

16

18

20

22

24

26

Time of incubation (hours)

Time (hours)

(E)

2

350

(F) 100 5mM Ca2+

250

80

% Residual Activity

% Residual Activity

300

200 150 100 50

1mM Ca2+

60 0.5% 1.0%

40

20

0

0 10

20

30

40

50

60

70

Time (min.)

l ash xce f E afe w S Sur

Rin

e l Tid Arie

l e e Eze condit ontro C

Detergents

Fig. 4. Effect of temperature and pH on the activity (A and B) and stability (C and D) of rBLAP respectively. The effect of Ca2+ on the activity of rBLAP at 60 °C (E), and the activity of rBLAP in the presence of commercial detergents (F).

metalloprotease inhibitor. Partial inhibitory effect of EDTA indicates the requirement of some metal ion for optimal activity of rBLAP. Iodoacetate (IAA) and N-ethylmaleimide (NEM), which are cystein protease inhibitors, did not affect rBLAP activity as in B. subtilis DM-04 (Rai and Mukherjee, 2009). N-BS did not affect rBLAP neither at 1 mM nor 5 mM concentration, suggesting lack of the role of tryptophan residues in proteolysis. b-ME and DTT exerted slight stimulatory effect on rBLAP, suggesting the role of thiol groups in the proteolysis (Table 1). Higher concentration of isopropanol, ethanol, methanol and ethylene glycol stimulated rBLAP activity. Aromatic solvents such as benzene and toluene adversely affected rBLAP activity, while aliphatic solvent n-hexane slightly inhibited rBLAP activity (Table 2). Organic solvent stable alkaline proteases are in great demand as they can catalyze useful product synthesis in presence of organic environment (Gupta and Khare, 2007). The rBLAP

exhibited enhanced activity in the presence of 10% organic solvents. Thus rBLAP is a promising candidate which can be used for catalysing various organic synthesis reactions (e.g. peptide synthesis) in systems with low water content. Alteration in the enzyme catalysis by organic solvents can be attributed to hydrogen bond disruption, hydrophobic interactions, compaction of the enzyme and changes in the conformation of the protein (Barberis et al., 2006). Jain et al. (2012) reported a serine protease from Bacillus sp. SM2014 which could withstand various organic solvents up to 50% of concentration. Similarly Rai and Mukherjee (2009) reported another alkaline serine protease from B. subtilis DM-04 to be stable in the presence of organic solvents. Urea, Gn-HCl and KI disturb protein structure by their intrinsic mechanisms. The activity of rBLAP was enhanced by these chaotropic agents (Table 3) as reported in the protease of Thermoanaerobacter tengcongensis (Koma et al., 2007).

S. Joshi, T. Satyanarayana / Bioresource Technology 131 (2013) 76–85 Table 2 Effect of various metal ions, solvents and inhibitors on rBLAP activity. Metal ions

Residual activity (%) 1 mM

5 mM

Control Ca2+ Ba2+ Mg2+ Hg2 Pb2+ Co2+ Mn2+ Ni2+ Zn2+ Fe2+

100 ± 0.94 100.11.±1.10 91.09 ± 0.86 84.40 ± 0.69 26.33 ± 0.74 74.08 ± 0.85 118.01 ± 1.0 80.59 ± 0.82 100.40 ± 0.89 89.46 ± 0.97 96.50 ± 1.31

100 ± 0.90 110.33 ± 0.89 75.95 ± 0.76 78.10 ± 0.80 0.0 ± 0.76 67.10 ± 0.84 108.01 ± 0.69 71.92 ± 0.87 46.65 ± 0.59 69.70 ± 0.97 64.78 ± 0.83

Solvents

5%

10%

n-Hexane 1-Butanol Isopropanol Ethanol Methanol Chloroform Glycerol Benzene Toluene Ethylene Glycol

97.42 ± 0.87 21.27 ± 0.97 91.42 ± 0.85 98.72 ± 0.65 115.43 ± 0.79 77.33 ± 0.69 91.26 ± 0.91 87.98 ± 0.93 84.69 ± 1.09 101.50 ± 1.06

90.21 ± 0.65 30.97 ± 0.91 193.51 ± 1.06 187.03 ± 0.83 144.80 ± 0.74 47.50 ± 0.76 104.53 ± 0.82 35.01 ± 0.56 37.33 ± 0.97 120.81 ± 0.58

Inhibitors

1 mM

5 mM

b-ME DTT PMSF EDTA NBS Iodoacetate N-Ethylmaleimide

110.28 ± 0.69 105.44 ± 0.97 35.11 ± 0.87 82.25 ± 0.58 108.99 ± 0.76 100.98 ± 1.31 98.44 ± 0.76

105.45 ± 1.09 101.94 ± 0.67 0.54 ± 0.93 70.92 ± 0.89 101.16 ± 0.59 100.38 ± 0.79 96.49 ± 0.65

The rBLAP retained varied levels of activity in the presence of commercially available washing detergents (Fig. 4) as observed earlier (Venugopal and Saramma, 2006; Hadj-Ali et al., 2007). Anionic detergent SDS stimulated rBLAP activity, while cationic detergent CTAB inhibited. SDS had been shown to stimulate the activity of protease from T. tengcongensis (Koma et al., 2007). SDS is an amphiphilic organosulphate with a 12-carbon tail attached to the sulphate group. The amphiphilic nature of SDS allows interactions between SDS and amino acid residues that lead to unfolding of the protein and loss of enzyme activity. In rBLAP, interactions with SDS may not unfold the protein, and on the contrary, may assist in Table 3 Effect of various modulators on rBLAP activity. Additive

Control SDS CTAB Tween 40 Tween 60 Tween 80 PEG 4000 PEG 6000 PEG 8000 H2O2 Sodium Perborate Chaotropic agents Urea KI GnHCl

Residual activity (%) 1%

2%

100 ± 1.0 99.00 ± 0.67 42.35 ± 0.98 114.69 ± 0.89 108.98 ± 0.76 120.60 ± 0.65 104.26 ± 0.69 100.67 ± 0.86 100.23 ± 0.85 98.58 ± 0.74 100.10 ± 0.39

100 ± 0.90 159.82 ± 1.0 42.35 ± 1.2 119.97 ± 0.98 122.56 ± 1.10 120.90 ± 0.92 103.66 ± 0.83 103.14 ± 1.10 104.10 ± 0.95 95.40 ± 0.76 94.80 ± 0.71

1M 106.89 ± 0.98 1 mM 101.71 ± 0.89 1 mM 103.10 ± 1.20

2M 136.83 ± 1.10 5 mM 112.37 ± 0.95 5 mM 98.13 ± 0.98

83

attaining favourable conformation, and thus, stimulation in the activity. Surfactants including Tweens and PEGs of varied molecular weights stimulated rBLAP activity. The enzyme exhibited stability in the presence of oxidizing agents such as H2O2 and sodium perborate. Generally subtilases get inactivated by oxidizing effect of hydrogen peroxide. This effect is related to oxidization of methionine residue present next to catalytic serine, preventing a critical step in formation of tetrahedral intermediate during proteolysis (Phrommao et al., 2011). Although rBLAP also has a methionine residue just after catalytic serine, it exhibited considerable resistance to H2O2. Mechanism of rBLAP resistance to H2O2 has not been understood. In general any protease, which exhibits alkali stability and resistance to oxidizing agents, is considered to be compatible as detergent additive. Thus rBLAP can be a promising additive in detergent formulations for removal of proteinaceous stains on the clothes. During template search at SWISS-MODEL workspace, rBLAP exhibited 90% similarity with 1wsdA protein (available as a monomeric M-protease at http://www.rcsb.org/pdb/explore/explore.do/structureId=1WSD). Three dimensional model of rBLAP revealed the presence of one a-helix and six b-sheets in prosequence region, six a-helices and ten b-sheets in the rest of rBLAP structure. Loops and random coils are present in between helices and sheets. 3D model explained that amino acid moieties which form catalytic triad are closely spaced in tertiary structure but present far from each other in primary structure of the enzyme. Thus proper folding brings the catalytically essential amino acids together in the tertiary structure (Fig. 3). Homology modelling revealed that rBLAP matches with the template 1wsdA the most. In addition, rBLAP exhibits 89% similarity to 1st3A, 82% to 1c9 mA and 81% to 1nduA. Shirai et al. (1997) reported that 1wsdA is also optimally active at pH 12.3. 1wsdA possesses two Ca2+ binding sites and Ca2+ has stabilizing effect on 1wsdA (M-protease) activity. Similarly Ca2+ ions also contribute to thermal stabilization of rBLAP. Upon crystallization, rBLAP can be studied in more detail as it will be industrially useful protease. The rBLAP is effective in the removal of coated gelatin layer from the used photographic and X-ray films efficiently at 40 °C because the treatment of waste photographic films led to complete hydrolysis of gelatin layer in an hour (Fig. 5). SDS–PAGE analysis of the liberated end product showed a smeary pattern of the released protein. Fujiwara et al. (1989) had reported the use of alkaline protease from B. subtilis and Bacillus sp. B21-2 in silver recovery from the used X-ray films. After the removal of unwanted sericin layer, the silk fibre appeared smoother in SEM micrographs (Fig. 5). SDS–PAGE analysis of the released sericin gave a band of higher molecular weight besides a smeary pattern. The weight of the treated silk was reduced from 2.5 to 2.2 g (12% weight loss) as a result of sericin hydrolysis by rBLAP. Silk degumming is a very essential step for the removal of sericin protein from silk fibres for giving it shine and softness. The use of proteases for this purpose is cheaper and eco-friendly. Arami et al. (2007) has reported 22.43% loss in the weight of Persian silk on treatment with alcalase, savinase, and mixtures of these enzymes in different ratios.rBLAP is effective in controlling the hatching of eggs of M. incognita. This resulted in reduced number of infectious juveniles and increased the mortality to 93–97% (Table 4). Thus upon treatment with rBLAP, the development of nematode eggs was significantly reduced. According to Kalaiarasan et al. (2006), the nematode egg shell is composed of outer lipoprotein layer, middle chitin and inner lipid layer. Different enzymes that can degrade the layers can be used as biocontrol agents against harmful nematode pests. Interestingly it was observed that the development of maximum number of nematode eggs got arrested at 2 or 3 celled stage (Fig. 5). These stages, even after a week, failed to hatch into mature juveniles.

84

S. Joshi, T. Satyanarayana / Bioresource Technology 131 (2013) 76–85

(1)

(2)

(3)

(5)

(4)

(6a)

(6b)

(6c)

(6d)

Fig. 5. Applications of rBLAP. (1) Degelatinization of photographic film, (2) SDS–PAGE profile of protein released after degelatinization of the photographic films, (3 and 4) scanning electron micrographs (SEM) of untreated silk and rBLAP treated silk fibre; (5) SDS–PAGE profile of liberated sericin protein, (6) Effect of rBLAP on Meloidogyne incognita eggs: (6a) untreated egg at zero hour, (6b and c) egg arrested at two celled stage during the treatment, and (6d) egg arrested at three celled stage.

Table 4 Effect of rBLAP on the development of nematode M. incognita eggs. Incubation (days)

Number of juveniles Control

Buffer Control

Sample treated with rBLAP

3 6 9 12

67 ± 4 160 ± 6 346 ± 13 404 ± 16

69 ± 7 167 ± 9 330 ± 10 405 ± 12

4±2 11 ± 2 10 ± 2 10 ± 1

Table 5 Comparision of characteristics of native and recombinant BLAPs.

% Average mortalitya (in rBLAP treated sample)

97.00% 93.50% 94.00% 94.50%

Treatment of M. incognita egg masses with rBLAP resulted in reduced number of juveniles formed. Mortality of M. incognita eggs was significantly increased as compared to the controls. of eggs died due to cell arrest a Average mortality ¼ Number  100. Total number of treated eggs

4. Conclusions When the versatile alkaline protease of B. lehensis (BLAP) was expressed in E. coli, a fourfold enhancement in the production

a

Characteristics

Native BLAP

Recombinant BLAP

Optimum pH Optimum temperature Specific enzyme activity T1/2 at 50 °C T1/2 at 60 °C T1/2 at 60 °C (with 5 mM Ca2+) Molecular mass Km Vmax Kcat

12.8 50 °C 7.0 U mg1 44 h 1 min – 30 ± 1 kDa 0.35 mg mL1 7 n mol mg1 sec1 213 s1

12.8 50 °C 29 U mg1 48 h 1 min 30 min a 39 ± 1 kDa 0.2 mg mL1 25 n mol mg1 sec1 289 s1

Around 9.1 kDa portion of the recombinant BLAP comes from the pro-sequence.

was achieved. The rare property of stimulation by SDS and tolerance to oxidizing agents make rBLAP suitable as a detergent additive. It is applicable in environment-friendly degumming of silk and degelatinization of photographic films for recovering silver

S. Joshi, T. Satyanarayana / Bioresource Technology 131 (2013) 76–85

from the used X-ray/photographic films. The rBLAP causes mortality of a plant pathogenic nematode M. incognita eggs, and therefore, can be used as a biocontrol agent. Further efforts are underway to express BLAP in Pichia pastoris extracellularly in order to simplify its recovery. Acknowledgements We wish to thank Dr. Usha Rao (Division of Nematology, Indian Agricultural Research Institute, New Delhi) for kindly allowing us to use the laboratory facilities for testing the anti-nematode activity of the enzyme. S.J. is grateful to the Council of Scientific & Industrial Research, Govt. of India, New Delhi for the award of fellowship while carrying out the work. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2012. 12.124. References Arami, M., Rahimi, S., Mivehie, L., Mazaheri, F., Mahmoodi, N.M., 2007. Degumming of Persian silk with mixed proteolytic enzymes. J. Appl. Polym. Sci. 106, 267– 275. Barberis, S., Quiroga, E., Morcelle, S., Priolo, N., Luco, J.M., 2006. Study of phytoproteases stability in aqueous-organic biphasic systems using linear free energy relationships. J. Mol. Catal. B: Enzym. 38, 95–103. Dey, G., Palit, S., Banerjee, R., Maiti, B.R., 2002. Purification and characterization of maltooligosaccharide-forming amylase from Bacillus circulans GRS 313. J. Ind. Microbiol. Biotechnol. 28, 193–200. Dulmau, O., 1982. Genetic transformation in Bacillus subtilis. In: Dubnau, D. (Ed.), The Molecular Biology of the Bacilli. Academic Press, New York, pp. 147–178. Femi-Ola, T.O., Olayinka, D., 2012. Partial purification and characterization of a thermostable alkaline protease from Lactobacillus brevis. Malays. J. Microbiol. 8, 2231–7538. Fu, Z., Hamid, S.B., Razak, C.N., Basri, M., Salleh, A.B., Rahman, R.N., 2003. Secretory expression in Escherichia coli and single-step purification of a heat-stable alkaline protease. Protein Expression Purif. 28, 63–68. Fujiwara, N., Tsumiya, T., Katada, T., Hosobuchi, T., Yamamoto, K., 1989. Continuous recovery of silver from used X-ray films using a proteolytic enzyme. Process Biochem. 24, 155–156. Ghosh, A., Bhardwaj, M., Satyanarayana, T., Khurana, M., Mayilraj, S., Jain, R.K., 2007. Bacillus lehensis sp. nov., an alkalitolerant bacterium isolated from soil. Int. J. Syst. Evol. Microbiol. 57, 238–242. Gonzalez, G., Gonzalez, C., Merino, P., 1992. Thermo-stabilization of Cucurbita ficifolia protease in the presence of additives. Biotechnol. Lett. 14, 919–924. Gupta, A., Joseph, B., Mani, A., Thomas, G., 2008. Purification and properties of an extracellular thermostable serine alkaline protease from Virgibacillus pantotheticus. World J. Microbiol. Biotechnol. 24, 237–243. Gupta, A., Khare, S.K., 2007. Enhanced production and characterization of a solvent stable protease from solvent tolerant Pseudomonas aeruginosa PseA. Enzyme Microb. Technol. 42, 11–16. Hadj-Ali, N.E., Agrebi, R., Ghorbel-Frikha, B., Sellami-Kamoun, A., Kanoun, S., Nasri, M., 2007. Biochemical and molecular characterization of a detergent stable alkaline serine-protease from a newly isolated Bacillus licheniformis NH1. Enzyme Microb. Technol. 40, 515–523. Haki, G.D., Rakshit, S.K., 2003. Developments in industrially important thermostable enzymes: a review. Bioresour. Technol. 89, 17–34.

85

Jaenicke, R., 1991. Protein stability and molecular adaptation to extreme conditions. Eur. J. Biochem. 202, 715–728. Jain, D., Pancha, I., Mishra, S.K., Shrivastav, A., Mishra, S., 2012. Purification and characterization of haloalkaline, thermoactive, solvent stable and SDS-induced protease from Bacillus sp.: a potential additive for laundry detergents. Bioresour. Technol. 115, 228–236. Kalaiarasan, P., Lakshmanan, P.L., Rajendran, G., Samiyappan, R., 2006. Chitin and chitinolytic bio-control agents for the management of root knot nematode, Meloidogyne arenaria in groundnut (Arachis hypogaea L.) cv. Co3. Indian J. Nematol. 36, 181–186. Karbalaei-Heidari, H.R., Ziaee, A.A., Amoozegar, M.A., Cheburkin, Y., Budisa, N., 2008. Molecular cloning and sequence analysis of a novel zinc-metalloprotease gene from the Salinivibrio sp. strain AF-2004 and its extracellular expression in E. coli. Gene 408, 1–2. Koma, D., Yamanaka, H., Moriyoshi, K., Ohmoto, T., Sakai, K., 2007. Overexpression and characterization of thermostable serine protease in Escherichia coli encoded by the ORF TTE0824 from Thermoanaerobacter tengcongensis. Extremophiles 11, 769–779. Kulakova, L., Galkin, A., Kurihara, T., Yoshimura, T., Esaki, N., 1999. Cold-active serine alkaline protease from the psychrotrophic bacterium Shewanella strain ac10: gene cloning and enzyme purification and characterization. Appl. Environ. Microbiol. 65, 611–617. Li, J., Shi, P.J., Han, X.Y., Meng, K., Yang, P.L., Wang, Y.R., Luo, H.Y., Wu, N.F., Yao, B., Fan, Y.L., 2007. Functional expression of the keratinolytic serine protease gene sfp2 from Streptomyces fradiae var. k11 in Pichia pastoris. Protein Expression Purif. 54, 79–86. Liu, W., Shi, P., Chen, Q., Yang, P., Wang, G., Wang, Y., Luo, H., Yao, B., 2010. Gene cloning, overexpression, and characterization of a xylanase from Penicillium sp. CGMCC 1699. Appl. Biochem. Biotechnol. 162, 1–12. Manachini, P.L., Fortina, M.G., 1998. Production in sea-water of thermostable alkaline proteases by a halotolerant strain of Bacillus licheniformis. Biotechnol. Lett. 20, 565–568. Maurer, K.H., 2004. Detergent proteases. Curr. Opin. Biotechnol. 15, 330–334. Mehrotra, S., Pandey, P.K., Gaur, R., Darmwal, N.S., 1999. The production of alkaline protease by a Bacillus species isolate. Bioresour. Technol. 67, 201–203. Mei, C., Jiang, X., 2005. A novel surfactant- and oxidation-stable alkaline protease from Vibrio metschnikovii DL-33-51. Process Biochem. 40, 2167–2172. Meyers, S.P., Ahearn, D.G., 1977. Extracellular proteolysis by Candida lipolytica. Mycologia 69, 646–651. Nakiboglu, N., Toscali, D., Nisli, G., 2003. A novel silver recovery method from waste photographic films with NaOH stripping. Turk. J. Chem. 27, 127–133. Oberoi, R., Beg, Q.K., Puri, S., Saxena, R.K., Gupta, R., 2001. Characterization and wash performance analysis of an SDS-stable alkaline protease from a Bacillus sp. World J. Microbiol. Biotechnol. 17, 493–497. Phrommao, E., Yongsawatdigul, J., Rodtong, S., Yamabhai, M., 2011. A novel subtilase with NaCl-activated and oxidant-stable activity from Virgibacillus sp. SK37. BMC Biotech. 11, 65. Rai, S.K., Mukherjee, A.K., 2009. Ecological significance and some biotechnological application of an organic solvent stable alkaline serine protease from Bacillus subtilis strain DM-04. Bioresour. Technol. 100, 2642–2645. Shirai, T., Suzuki, A., Yamane, T., Ashida, T., Kobayashi, T., Hitomi, J., Ito, S., 1997. High-resolution crystal structure of M-protease: phylogeny aided analysis of the high-alkaline adaptation mechanism. Protein Eng. 10, 627–634. Siddiqui, I.A., Haas, D., Heeb, S., 2005. Extracellular protease of Pseudomonas fluorescens CHA0, a bio-control factor with activity against the root-knot nematode Meloidogyne incognita. Appl. Environ. Microbiol. 171, 5646–5649. Venugopal, M., Saramma, A.V., 2006. Characterization of alkaline protease from Vibrio fluvialis strain VM10 isolated from a mangrove sediment sample and its application as a laundry detergent additive. Process Biochem. 41, 1239–1243. Verma, D., Satyanarayana, T., 2012. Cloning, expression and applicability of thermoalkali-stable xylanase of Geobacillus thermoleovorans in generating xylooligosaccharides from agro-residues. Bioresour. Technol. 107, 333–338. Ward, E., Kerry, B.R., Manzanilla-Lopez, R.H., Mutua, G., Devonshire, J., Kimenju, J., Hirsch, P.R., 2012. The Pochonia chlamydosporia serine protease gene vcp1 is subject to regulation by carbon, nitrogen and pH: implications for nematode bio-control. PLoS One 7 (4), e35657. http://dx.doi.org/10.1371/journal.pone. 0035657.