- Email: [email protected]
Characteristics of relapse after autologous stem-cell transplantation for follicular lymphoma: a long-term follow-up
original article
Annals of Oncology 20: 722–728, 2009 doi:10.1093/annonc/mdn691 Published online 29 January 2009
Characteristics of relapse after autologous stem-cell transplantation for follicular lymphoma: a long-term follow-up M. Kornacker1, J. Stumm1, C. Pott2, S. Dietrich1, S. Su¨ssmilch3, M. Hensel1, M. Nickelsen3, M. Witzens-Harig1, M. Kneba2, N. Schmitz3, A. D. Ho1 & P. Dreger1* 1
Department of Medicine V, University of Heidelberg, Heidelberg; 2Department of Medicine II, University of Schleswig-Holstein, Kiel and 3Department of Hematology and Stem Cell Transplantation, Asklepios Klinik St Georg, Hamburg, Germany
Received 7 August 2008; revised 29 September 2008; accepted 1 October 2008
follicular lymphoma (FL) is not well known.
original article
Patients and methods: Relapse cases were identified from 241 consecutive patients autografted for disseminated untransformed FL from 1990 to 2002 in three institutions. Prognostic factors for relapse and outcome after relapse were analyzed by log-rank comparisons and Cox regression analyses. Results: One hundred and three relapses occurred. The 10-year relapse probability was 47%. Median time from autoSCT to relapse was 20 (2–128) months. Only three relapses were observed later than 6 years posttransplant. Median survival after relapse was 8.3 years. Patients with disease recurrence within 1 year from transplant and those who had received autoSCT as second-line treatment had significantly reduced survival by multivariate analysis, whereas Follicular Lymphoma International Prognostic Index score, age, remission status at autoSCT, high-dose regimen, and ex vivo purging had no impact. Conclusions: FL recurrence after autoSCT follows a biphasic pattern with continuing relapse during the first 6 years and only few events thereafter. The prognosis after relapse is relatively good and appears to be comparable to that of disease recurrence after standard treatment. The situation is less favorable for patients who relapse within the first posttransplant year. Key words: autologous stem-cell transplantation, follicular lymphoma, MRD, prognosis, relapse
introduction Autologous stem-cell transplantation (autoSCT) for treatment of follicular lymphoma (FL) is under investigation for >20 years. Although autoSCT is an effective therapy which can achieve long-term remission in a significant proportion of patients, its role in the treatment algorithm remains controversial [1–10]. However, a considerable number of patients relapse after autoSCT. Although understanding of relapse and the factors determining its prognosis is the basis for rational salvage treatment strategies, studies addressing the fate of patients with disease recurrence post-autoSCT for FL in the rituximab era are lacking. Therefore, we sought to analyze the risk and outcome of relapse in patients with FL who had undergone autoSCT in three large referral centers from 1990 to 2002. Particular features of this series are its size, the length of follow-up, and the availability of results of minimal *Correspondence to: Dr P. Dreger, Department of Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg, Germany. Tel: +49-6221-56-8008; Fax: +49-6221-56-6824; E-mail: [email protected]
residual disease (MRD) assessment for patients in long-term remission. The results show that the prognosis of patients with FL relapse after autoSCT is remarkably good. Only those who have very early disease recurrence face a dismal outcome and might benefit from intensive treatment approaches, such as allogeneic SCT.
patients and methods patients Eligible for this study were all patients who had undergone high-dose therapy with autoSCT for disseminated FL from 1990 to 2002 on consecutive protocols active at the University of Heidelberg or at the University of Kiel/AK St Georg Hamburg consortium (considered as one center for the purposes of this study). Patients with high-grade transformation before SCT were excluded. Details of the eligibility criteria and the design of the original protocols have been published previously [3, 5,11–13]. In brief, at both institutions, consecutive patients with advanced-stage disease were included in first-line autoSCT protocols if they had a diagnosis of stage III/IV FL
ª The Author 2009. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: [email protected]
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
Background: Pattern and outcome of disease recurrence after autologous stem-cell transplantation (autoSCT) for
original article
Annals of Oncology
MRD analysis In follow-up blood samples of patients in long-term clinical remission, MRD was assessed in those patients who had a documented marker in diagnostic samples before transplant [16] by MBR PCR using a multiplex primer set according the BIOMED-2 Concerted Action [17] and a consensus JH reverse primer (5# CTTACCTGAGGAGACGGTGACC 3#). Quantitative MRD assessment was carried out by real-time PCR (RQPCR) using a chromosome 18 MBR forward primer together with a consensus probe complementary to germline JH1, JH4, and JH5 (JH1/4/ 5-probe) and a JH4 germline reverse primer. PCRs were carried out on an ABI PRISM 7700 thermal cycler (Applied Biosystems, Darmstadt, Germany) as previously described [18]. For determining the quantitative MRD levels, target copy numbers were related to the number of target copies of the lymphoma cell line K422 (DSMZ, Braunschweig, Germany) bearing a t(14;18) translocation with an involvement of IGH-JH4.
Volume 20 | No. 4 | April 2009
Table 1. Patient characteristics (n = 241) Variable
# Positive
Sample size
%
FLIPI at diagnosis high FLIPI at diagnosis intermediate Age at diagnosis (years) Age at autoSCT >48 Interval diagnosis—SCT (months) Rituximab before autoSCT No CR at autoSCT HD regimen TBI Ex vivo purging yes Salvage autoSCT Year of autoSCT 1997–2002 Follow-up (months)
31 85 45 47 12 34 126 159 50 86 67 96
168 168 241 241 241 241 237 241 241 241 241 241
18% 51%
(18–62) (22–65) (5–168)
(6–198)
14% 53% 66% 21% 36% 29%
FLIPI, Follicular Lymphoma International Prognostic Index; autoSCT, autologous stem-cell transplantation; CR, complete response; HD, highdose; TBI, total body irradiation. Experiments were done at least in triplicate for each sample. To equalize differences in amount and quality of the DNA, albumin copies were quantitated as internal reference in all samples and were used for subsequent normalization of MRD values. MRD levels were given as fraction of numbers of FL cells per total number of mononuclear blood cells analyzed per PCR assay. The sensitivity reached 1025 in polyclonal DNA.
statistical analysis For descriptive statistics, the calculation of median, minimum, maximum, range, and relative and absolute frequencies was done. Survival times were estimated using the Kaplan–Meier method, comparisons between survival curves in different strata were carried out using the log-rank test. End points were overall survival (OS), progression-free survival (PFS), and relapse incidence. OS was defined as time from autoSCT (or time from relapse) until death of any cause. PFS was defined as time from autoSCT until relapse, progression, or death from any cause. Relapse incidence (time to progression) was defined as time from autoSCT until relapse or progression. Relapse/progression was defined as appearance of new lesions and/or an increase of known lesions of >50%. Proportional hazards models (Cox regression) were set up to investigate the confounding effects of factors prognostic for relapse and survival. All explanatory variables with a P value of 0.1 or less in univariate analysis were included in the Cox models. Significance levels were set at 0.05. Calculations were done using GraphPad Prism software (release 3.02; San Diego, CA) and MedCalc (release 9.0, Mariakerke, Belgium). Data were analyzed as of 30 November 2007.
results relapse incidence With a median follow-up for the surviving patients of 8 years (0.5–16.5), 103 relapses occurred in 241 patients at risk. The 10-year relapse probability (Kaplan–Meier) was 47% [95% confidence interval (CI) 40% to 54%]. The 10-year OS and PFS were 75% (68%–81%) and 49% (42%–56%) (Figure 1). Histology was available in 90 cases and revealed high-grade transformation in 12 (13%) of them. Further characteristics of the relapse population are summarized in Table 2.
doi:10.1093/annonc/mdn691 | 723
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
according to the REAL classification or centroblastic–centrocytic lymphoma according to the Kiel classification, respectively, age of 18–60 years and adequate performance status (Karnofsky ‡ 80%) and organ function. For salvage autoSCT protocols, patients had to fulfill the same criteria in addition to relapse or progression after one or more of previous treatment lines. The rationale in the original protocols for using autoSCT in this population was that this modality might be a curative approach for otherwise incurable advanced FL [3, 5]. More sophisticated high-risk selection criteria, in particular the Follicular Lymphoma International Prognostic Index (FLIPI) [14], were not used since they were not available at the time these patients were treated. If carried out as part of first-line treatment, in both institutions sequential treatment intensification comprised induction with a cyclophosphamide, doxorubicine, vincristine, and prednisolone (CHOP)like standard regimen until maximum response followed by stem-cell mobilization with HAM (high-dose cytarabine 2 g/m2 every 12 h on days 1 and 2, mitoxantrone cytarabine 10 mg/m2/day on days 2 and 3; Heidelberg) or Dexa-BEAM (dexamethasone 3 · 8 mg on days 1–10, carmustine 60 mg/m2 on day 2, etoposide 75 mg/m2 on days 4–7, cytarabine 100 mg/m2 every 12 h on days 4–7, and melphalan 20 mg/m2 on day 3; Kiel/Hamburg). CHOP-like induction was usually omitted if sequential treatment intensification was administered for salvage treatment. Myeloablative therapy consisted in total body irradiation (TBI) and high-dose cyclophosphamide. TBI was given in fractionated doses twice daily on four consecutive days for a total of 14.4 Gy (Heidelberg) or on three consecutive days for a total of 12 Gy (Kiel/Hamburg); cyclophosphamide was infused on the days after TBI at total a dose of 200 mg/kg (Heidelberg) or 120 mg/kg (Kiel/Hamburg). Patients with previous radiotherapy received BEAM (BCNU 300 mg/m2, etoposide 800 mg/m2, cytarabine 1600 mg/2, and melphalan 140 mg/m2; Heidelberg) or busulfan/cyclophosphamide (busulfan 1 mg/kg of body weight four times a day for 4 days followed by cyclophosphamide 60 mg/kg for 2 days; Kiel). Since July 1997, BEAM was used for preirradiated patients also in Kiel. Subsequently, both institutions replaced TBI/CY by BEAM as standard myeloablative regimen also in the first-line setting (Heidelberg, December 1999; Kiel/Hamburg, May 2000). Fifty patients (Heidelberg 36; Kiel/Hamburg 14) were treated on protocols employing reconstitution with grafts that had been depleted of B cells ex vivo using immunomagnetic devices (Isolex300 47; MaxSep 3; Baxter/Nexell, Irvine, CA) [12, 15]. Protocols had been approved by the responsible institutional review boards. Patients gave written informed consent. Two hundred and forty-one consecutive patients who fulfilled the eligibility criteria for this study were analyzed retrospectively, 151 from Heidelberg and 90 from Kiel/Hamburg. Patient characteristics are summarized in Table 1.
original article
Annals of Oncology
Table 2. Relapse population characteristics (n = 103)
Percent Survival
100
A
50
0 0
60
120
180
Months from SCT 100
Percent relapsed
Sample size
%
Histology transformed FLIPI at dx high FLIPI at dx intermediate Age at autoSCT >47 Rituximab before autoSCT No CR at autoSCT HD regimen TBI Salvage autoSCT Ex vivo purging yes REL year 1999–2006 Center Heidelberg
12 13 38 51 10 55 58 47 16 52 58
90 67 67 103 103 99 103 103 103 103 103
13% 19% 57% 50% 10% 56% 56% 46% 16% 50% 56%
FLIPI, Follicular Lymphoma International Prognostic Index; autoSCT, autologous stem-cell transplantation; CR, complete response; HD, highdose; REL, relapse; TBI, total body irradiation; REL, relapse.
relapse. Only the latter variable retained statistical significance in Cox analysis (Table 3). 50
0 0
60
120
180
Months from SCT 100
C Percent PFS
# Positive
50
0 0
60
120
180
Months from SCT Figure 1. Overall survival (A), time to progression (B), and progressionfree survival (C) of 241 patients after autologous stem-cell transplantation.
prognostic factors for relapse Log-rank comparisons considering FLIPI at diagnosis, age at autoSCT, remission status at autoSCT, treatment line of autoSCT, myeloablative regimen, ex vivo purging, year of transplantation, and center showed a favorable effect of TBIcontaining high-dose regimens and an unfavorable effect of autoSCT carried out in a salvage situation on the probability of
724 | Kornacker et al.
relapse kinetics and MRD Median time from autoSCT to relapse was 20 (2–128) months, with 33 relapses occurring within the first year posttransplant. Notably, only three relapses were observed later than 6 years posttransplant. Twenty-four patients who were in ongoing complete remission >8 years after transplant had a bcl-2/IgH PCR marker available for molecular MRD assessment. RQ-PCR demonstrated low-level MRD (0.9–6.0 · 1025) in peripheral blood samples obtained at or close to the last follow-up (median 132 months post-autoSCT, range 85–155) in 3 of 24 patients (13%), while the remainder showed no evidence of disease persistence at the molecular level. survival after relapse and risk factor analysis With a median follow-up of surviving patients of 55 (1–139) months, 39 deaths after relapse were observed, translating into a median survival after relapse of 100 months with a 5-year probability of 60% (50%–71%) (Figure 2A). Cause of death was progressive disease in 22 patients, infections in six patients, complications of alloSCT in three patients, miscellaneous in two patients, and unknown in six patients (Table 4). By univariate analysis, survival from relapse was not affected by histology, high-risk FLIPI, higher age, and absence of CR at autoSCT, TBI myeloablation, ex vivo purging, and center. However, patients with disease recurrence within 1 year from transplant had significantly reduced survival (median survival 28 months versus not reached) (Figure 2B). Additional significant adverse factors were salvage autoSCT (median survival 61 months versus not reached) (Figure 2C) and relapse before 1999 (median survival 61 months versus not reached). The adverse effect of short time to relapse on survival after relapse was particularly pronounced in those patients who underwent autoSCT as part of salvage treatment (median survival 9.5 months versus not reached) (Figure 2D). The significant impact of time to relapse and line of autoSCT were confirmed by Cox modeling including also the
Volume 20 | No. 4 | April 2009
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
B
Variable
original article
Annals of Oncology
Table 3. Prognostic factor analyses (Cox) End point (sample size)
Variable
P value
HR
LowerCL
UpperCL
Relapse after autoSCT (237)
No CR at autoSCT HD regimen without TBI Salvage autoSCT Ex vivo purging yes Center HD CR at autoSCT Salvage autoSCT Time to REL <12 months REL year 1999–2006
0.091 0.104 0.032 0.22 0.19 0.097 0.01 0.014 0.4
1.39 1.19 1.63 0.71 0.74 0.55 2.45 2.37 0.73
0.95 0.94 1.04 0.41 0.48 0.28 1.24 1.20 0.35
2.03 1.49 2.53 1.23 1.15 1.11 4.82 4.68 1.51
Survival after relapse (103)
50
C
100
Percent Survival
100
50
HR 2.02 (1.09, 3.93); p .026
Salvage (23/47) Upfront (16/56)
0
0 0
24
48
72
96
120
144
0
24
100
Percent Survival
50
HR 2.37 (1.35-5.47); p 0.0051
Tx_REL <=12 (19/33)
D
100
Percent Survival
B
48
72
96
120
144
Months from relapse
Months from relapse
50
HR 4.72 (2.89, 20.1); p < 0.0001
Tx_REL <= 12mo (14/16) Tx_REL > 12mo (9/31)
Tx_REL >12 (20/70) 0
0 0
24
48
72
96
120
144
Months from relapse
0
24
48
72
96
120
144
Months from relapse
Figure 2. Survival after relapse after autologous stem-cell transplantation (n = 103): all patients (A); by time interval from autoSCT to relapse (B; black line, >12 months; grey line, £12 months); by time of autoSCT (C; black line, upfront; grey line, salvage); patients with salvage autoSCT only by time interval from autoSCT to relapse (D; black line, >12 months; grey line, £12 months).
explanatory variables relapse year and remission status at autoSCT (Table 3).
treatment of relapse Information on treatment was available for 89 patients. Of these, five (6%) had no FL-specific treatment until last followup, and six patients (7%) were treated with local radiotherapy only. Five (6%) and 12 patients (13%), respectively, had sufficient disease control with interferon and rituximab monotherapy. More intensive systemic treatment was administered to the remainder: maximum salvage intensity was combination chemotherapy in 17 patients (19%); rituximab–
Volume 20 | No. 4 | April 2009
chemotherapy combinations in 31 patients (35%); and allogeneic SCT in 13 patients (15%). The proportion of patients receiving salvage combination chemotherapy and/or allogeneic SCT was not different between individuals relapsing within 1-year posttransplant or those relapsing later (61% and 59%; P = 1.0, Fisher’s exact test). Survival of patients receiving combination therapy with rituximab was significantly superior to that of patients who were salvaged with combination chemotherapy only [hazard ratio 0.24 (95% CI 0.065–0.49); P = 0.0008]. Nine patients who underwent salvage allogeneic SCT with reduced-intensity conditioning had a 5-year survival probability of 89% (68%–100%).
doi:10.1093/annonc/mdn691 | 725
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
A Percent Survival
HR, hazard ratio; autoSCT, autologous stem-cell transplantation; CR, complete response; HD, high dose; TBI, total body irradiation.
original article
Annals of Oncology
secondary malignancies In the nonrelapse population, five secondary malignancies were observed, including three cases of treatment-related myelodysplasia. The outcome was fatal in all five patients (Table 4). No secondary malignancies occurred in the relapse population.
discussion
Table 4. Causes of death Population
Nonrelapse
Relapse
Details
Progressive disease Infections during HDT-related aplasia Other infections Nonengraftment Complications of salvage alloSCT Secondary neoplasm
– 5 3 2 – 5
22 (56%) – 6 (15%) – 3 (8%) –
Miscellaneous
–
2 (5%)
Unknown Total
– 15
6 (15%) 39
– Three sepsis; one endocarditis; one aspergillus pneumonia – – – Three myelodysplasia/AML +32, +45, and +68 months; one pancreas carcinoma +8 months; one mamma carcinoma +52 months One progressive multifocal leukencephalopathy; one myocardial infarction –
(33%) (20%) (13%) (33%)
alloSCT, allogeneic stem-cell proliferation; AML, acute myeloid leukemia; HDT, high-dose-therapy.
726 | Kornacker et al.
Volume 20 | No. 4 | April 2009
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
With 5-year PFS times ranging from 60% to 70% in first-line settings [5, 6, 9, 19, 20] and from 40% to 55% in salvage situations [4, 8, 9, 21], autoSCT is a highly effective treatment for disseminated FL. However, relapses are common, and their prognostic impact is obvious. Therefore, investigation of the kinetics of FL recurrence after autoSCT and parameters determining its outcome might not only provide a rationale basis for salvage treatment strategies but also help to reconsider individual indications for autoSCT. Although in most published series OS exceeds PFS substantially and thus it might be concluded that prognosis after relapse is not extraordinarily bad, comprehensive analyses of relapse after autoSCT for FL are highly desirable. Such an analysis was reported by Apostolidis et al. [22], who observed 33 relapses in 99 patients having undergone myeloablative therapy with reinfusion of ex vivo Bdepleted bone marrow grafts. Median time to relapse was 14 months, and 45% of the patients were alive 5 years after relapse. Similar to the work of Apostolidis et al., the present study has the limitations genuine to retrospective analyses. However, we report on a much larger population with considerably longer follow-up. Furthermore, our patients had been autografted with peripheral blood stem cells, and autoSCT had been carried out mainly as part of first-line treatment. Most importantly, our analysis considers patients who had access to more recent treatment modalities for FL, including rituximab. With a median survival of >8 years, outcome after failure of autoSCT was remarkably good. Moreover, survival appeared to improve over time, possibly reflecting the impact of rituximab and other novel salvage modalities. The latter assumption is supported by our finding that those patients who had been salvaged with a rituximab chemotherapy combination regimen at any time postrelapse survived significantly longer than those who received combination chemotherapy without rituximab
only. This comparison might be biased, however, by selection of favorable patients to the rituximab group simply because they lived long enough to reach the rituximab era and therefore must be interpreted with caution. In any case, the prognosis of FL relapse upon autoSCT appears to be comparable to that of FL recurrence after conventional first- or second-line therapy [23, 24]. This is in accordance with the findings of Apostolidis et al. and implies that first-line autoSCT with peripheral blood stem cells does not affect the ‘salvagability’ of patients with FL once they relapse after high-dose therapy. In contrast, prognosis was dismal in those patients whose disease recurred within the first posttransplant year. Although the negative prognostic impact of a short time interval to relapse is plausible and parallels observations made in aggressive B-cell lymphoma and chronic lymphocytic leukemia, this has never been formally documented for patients with FL relapsing after autoSCT or any other intensive therapy. Thus, time to relapse may help to identify a subset of patients who might benefit from aggressive salvage approaches, such nonmyeloablative allogeneic SCT [25–29]. This study did not primarily intend to evaluate the capacity of autoSCT for providing disease control. However, although modern rituximab-based treatments might have been very effective in the patient population analyzed here, too [30], the long-term results of autoSCT seem nevertheless remarkable. Particularly intriguing was the finding that relapse hardly occurred later than 6 years after transplant, resulting in a plateau of the relapse curve at 58% for patients transplanted in a salvage situation and 44% if autoSCT was part of first-line treatment. This observation is in line with a previous report on extended follow-up of FL after autologous bone marrow transplantation [8] and indicates that autoSCT might be capable of providing sustained control or even eradication of FL. To this end, our finding of absent or very low MRD in all patients in long-term complete remission available for molecular assessment is particularly encouraging. Similarly, though with considerably shorter follow-up, Corradini et al. [7] could show persistent absence of MRD in patients in long-term remission after high-dose therapy for FL. Similar to other studies addressing autoSCT [6], the patients analyzed here are not representative for an average FL population. This is best illustrated by looking at the FLIPI
original article
Annals of Oncology
references 1. Gribben JG, Freedman AS, Neuberg D et al. Immunologic purging of marrow assessed by PCR before autologous bone marrow transplantation for B-cell lymphoma. N Engl J Med 1991; 325: 1525–1533. 2. Rohatiner AZ, Johnson PW, Price CG et al. Myeloablative therapy with autologous bone marrow transplantation as consolidation therapy for recurrent follicular lymphoma. J Clin Oncol 1994; 12: 1177–1184. 3. Haas R, Moos M, Karcher A et al. Sequential high-dose therapy with peripheralblood progenitor-cell support in low-grade non-Hodgkin’s lymphoma. J Clin Oncol 1994; 12: 1685–1692. 4. Brice P, Simon D, Bouabdallah R et al. High-dose therapy with autologous stemcell transplantation (ASCT) after first progression prolonged survival of follicular lymphoma patients included in the prospective GELF 86 protocol. Ann Oncol 2000; 11: 1585–1590. 5. Lenz G, Dreyling M, Schiegnitz E et al. Myeloablative radiochemotherapy followed by autologous stem cell transplantation in first remission prolongs progression-free survival in follicular lymphoma—results of a prospective randomized trial of the German Low-Grade Lymphoma Study Group (GLSG). Blood 2004; 104: 2667–2674. 6. Deconinck E, Foussard C, Milpied N et al. High dose therapy followed by autologous purged stem cell transplantation and doxorubicin based chemotherapy in patients with advanced follicular lymphoma: a randomized multicenter study by the GOELAMS. Blood 2005; 105: 3817–3823. 7. Corradini P, Ladetto M, Zallio F et al. Long-term follow-up of indolent lymphoma patients treated with high-dose sequential chemotherapy and autografting:
Volume 20 | No. 4 | April 2009
8.
9.
10. 11.
12.
13.
14. 15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
evidence that durable molecular and clinical remission frequently can be attained only in follicular subtypes. J Clin Oncol 2004; 22: 1460–1468. Rohatiner AZ, Nadler L, Davies AJ et al. Myeloablative therapy with autologous bone marrow transplantation for follicular lymphoma at the time of second or subsequent remission: long-term follow-up. J Clin Oncol 2007; 25: 2554–2559. Montoto S, Canals C, Rohatiner AZ et al. Long-term follow-up of high-dose treatment with autologous haematopoietic progenitor cell support in 693 patients with follicular lymphoma: an EBMT registry study. Leukemia 2007; 21: 2324–2331. Schmitz N, Buske C, Gisselbrecht C. Autologous stem cell transplantation in lymphoma. Semin Hematol 2007; 44: 234–245. Voso MT, Martin S, Hohaus S et al. Prognostic factors for the clinical outcome of patients with follicular lymphoma following high-dose therapy and peripheral blood stem cell transplantation (PBSCT). Bone Marrow Transplant 2000; 25: 957–964. Dreger P, Viehmann K, von Neuhoff N et al. Autografting of highly purified peripheral blood progenitor cells following myeloablative therapy in patients with lymphoma: a prospective study of the long-term effects on tumor eradication, reconstitution of hematopoiesis and immune recovery. Bone Marrow Transplant 1999; 24: 153–161. Seyfarth B, Kuse R, Sonnen R et al. Autologous stem cell transplantation for follicular lymphoma: no benefit for early transplant? Ann Hematol 2001; 80: 398–405. Solal-Celigny P, Roy P, Colombat P et al. Follicular lymphoma international prognostic index. Blood 2004; 104: 1258–1264. Dreger P, von Neuhoff N, Suttorp M, Schmitz N. Rapid engraftment of peripheral blood progenitor cell grafts purged with B cell-specific monoclonal antibodies and immunomagnetic beads. Bone Marrow Transplant 1995; 16: 627–629. Moos M, Schulz R, Martin S et al. The remission status before and the PCR status after high-dose therapy with peripheral blood stem cell support are prognostic factors for relapse-free survival in patients with follicular nonHodgkin’s lymphoma. Leukemia 1998; 12: 1971–1976. van Dongen JJ, Langerak AW, Bruggemann M et al. Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 Concerted Action BMH4-CT98-3936. Leukemia 2003; 17: 2257–2317. Pott C, Schrader C, Gesk S et al. Quantitative assessment of molecular remission following high-dose therapy with autologous stem cell transplantation predicts long term remission in mantle cell lymphoma. Blood 2006; 107: 2271–2278. Sebban C, Mounier N, Brousse N et al. Standard chemotherapy with interferon compared with CHOP followed by high-dose therapy with autologous stem cell transplantation in untreated patients with advanced follicular lymphoma: the GELF-94 randomized study from the Groupe d’Etude des Lymphomes de l’Adulte (GELA). Blood 2006; 108: 2540–2544. Ladetto M, De Marco F, Benedetti F et al. Prospective, multicenter randomized GITMO/IIL trial comparing intensive (R-HDS) versus conventional (CHOP-R) chemoimmunotherapy in high-risk follicular lymphoma at diagnosis: the superior disease control of R-HDS does not translate into an overall survival advantage. Blood 2008; 111: 4004–4013. Schouten HC, Qian W, Kvaloy S et al. High-dose therapy improves progressionfree survival and survival in relapsed follicular non-Hodgkin’s lymphoma: results from the randomized European CUP trial. J Clin Oncol 2003; 21: 3918–3927. Apostolidis J, Foran JM, Johnson PWM et al. Patterns of outcome following recurrence after myeloablative therapy with autologous bone marrow transplantation for follicular lymphoma. J Clin Oncol 1999; 17: 216–221. van Oers MH, Klasa R, Marcus RE et al. Rituximab maintenance improves clinical outcome of relapsed/resistant follicular non-Hodgkin lymphoma in patients both with and without rituximab during induction: results of a prospective randomized phase 3 intergroup trial. Blood 2006; 108: 3295–3301. Seyfarth B, Josting A, Dreyling M, Schmitz N. Relapse in common lymphoma subtypes: salvage treatment options for follicular lymphoma, diffuse large cell lymphoma and Hodgkin disease. Br J Haematol 2006; 133: 3–18. Bertz H, Illerhaus G, Veelken H, Finke J. Allogeneic hematopoetic stem-cell transplantation for patients with relapsed or refractory lymphomas: comparison
doi:10.1093/annonc/mdn691 | 727
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
distribution: since old patients and those with early stage were not eligible, very high (4) or very low (0) FLIPI scores were excluded by study design, resulting in a predominance of intermediate (2) FLIPI scores (here 51% versus 37% in the original FLIPI population [14]). Nevertheless, the FLIPI score at diagnosis had no prognostic impact, implying that autoSCT might be able to compensate for the adverse effects of high-risk FLIPI seen under conventional chemotherapy. This is in accordance with results reported from a prospective trial on first-line autoSCT [6]. Therefore, the FLIPI might be a useful tool to select high-risk patients for prospective trials on autoSCT in FL who may particularly benefit from this procedure. With this in mind, and considering that a large proportion of patients received autoSCT in first remission, it is clear that the population analyzed here has favorable features which might not be met by future patients relapsing after autoSCT carried out for more advanced disease. However, since the FLIPI had no effect on survival after relapse, and the time to relapse effect was even more pronounced in the salvage autoSCT fraction, our findings should apply for patients with more unfavorable disease as well. In summary, this study documents that FL relapse after autoSCT follows a biphasic pattern with continuing relapse during the first 6 years and only few events thereafter. As confirmed by the absence of MRD, this could mean sustained disease control or true eradication in a significant proportion of patients. Those patients who relapse still have a relatively good prognosis which does not appear to be different from that of disease recurrence after standard treatment even in the era of rituximab-based treatment. The situation seems less favorable for patients who relapse early after autoSCT, suggesting that aggressive salvage approaches might be justified in this subset.
original article of high-dose conventional conditioning versus fludarabine-based reducedintensity regimens. Ann Oncol 2002; 13: 135–139. 26. Corradini P, Dodero A, Farina L et al. Allogeneic stem cell transplantation following reduced-intensity conditioning can induce durable clinical and molecular remissions in relapsed lymphomas: pre-transplant disease status and histotype heavily influence outcome. Leukemia 2007; 21: 2316–2323. 27. Khouri IF, McLaughlin P, Saliba RM et al. Eight-year experience with allogeneic stem cell transplantation for relapsed follicular lymphoma after nonmyeloablative conditioning with fludarabine, cyclophosphamide, and rituximab. Blood 2008; 111: 5530–5536.
Annals of Oncology
28. Rezvani AR, Storer B, Maris M et al. Nonmyeloablative allogeneic hematopoietic cell transplantation in relapsed, refractory, and transformed indolent nonHodgkin’s lymphoma. J Clin Oncol 2008; 26: 211–217. 29. Schmitz N, Dreger P, Glass B, Sureda A. Allogeneic transplantation in lymphoma: current status. Haematologica 2007; 92: 1533–1548. 30. Buske C, Hoster E, Dreyling M et al. The Follicular Lymphoma International Prognostic Index (FLIPI) separates high-risk from intermediate- or low-risk patients with advanced-stage follicular lymphoma treated front-line with rituximab and the combination of cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) with respect to treatment outcome. Blood 2006; 108: 1504–1508.
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
728 | Kornacker et al.
Volume 20 | No. 4 | April 2009
Annals of Oncology 20: 722–728, 2009 doi:10.1093/annonc/mdn691 Published online 29 January 2009
Characteristics of relapse after autologous stem-cell transplantation for follicular lymphoma: a long-term follow-up M. Kornacker1, J. Stumm1, C. Pott2, S. Dietrich1, S. Su¨ssmilch3, M. Hensel1, M. Nickelsen3, M. Witzens-Harig1, M. Kneba2, N. Schmitz3, A. D. Ho1 & P. Dreger1* 1
Department of Medicine V, University of Heidelberg, Heidelberg; 2Department of Medicine II, University of Schleswig-Holstein, Kiel and 3Department of Hematology and Stem Cell Transplantation, Asklepios Klinik St Georg, Hamburg, Germany
Received 7 August 2008; revised 29 September 2008; accepted 1 October 2008
follicular lymphoma (FL) is not well known.
original article
Patients and methods: Relapse cases were identified from 241 consecutive patients autografted for disseminated untransformed FL from 1990 to 2002 in three institutions. Prognostic factors for relapse and outcome after relapse were analyzed by log-rank comparisons and Cox regression analyses. Results: One hundred and three relapses occurred. The 10-year relapse probability was 47%. Median time from autoSCT to relapse was 20 (2–128) months. Only three relapses were observed later than 6 years posttransplant. Median survival after relapse was 8.3 years. Patients with disease recurrence within 1 year from transplant and those who had received autoSCT as second-line treatment had significantly reduced survival by multivariate analysis, whereas Follicular Lymphoma International Prognostic Index score, age, remission status at autoSCT, high-dose regimen, and ex vivo purging had no impact. Conclusions: FL recurrence after autoSCT follows a biphasic pattern with continuing relapse during the first 6 years and only few events thereafter. The prognosis after relapse is relatively good and appears to be comparable to that of disease recurrence after standard treatment. The situation is less favorable for patients who relapse within the first posttransplant year. Key words: autologous stem-cell transplantation, follicular lymphoma, MRD, prognosis, relapse
introduction Autologous stem-cell transplantation (autoSCT) for treatment of follicular lymphoma (FL) is under investigation for >20 years. Although autoSCT is an effective therapy which can achieve long-term remission in a significant proportion of patients, its role in the treatment algorithm remains controversial [1–10]. However, a considerable number of patients relapse after autoSCT. Although understanding of relapse and the factors determining its prognosis is the basis for rational salvage treatment strategies, studies addressing the fate of patients with disease recurrence post-autoSCT for FL in the rituximab era are lacking. Therefore, we sought to analyze the risk and outcome of relapse in patients with FL who had undergone autoSCT in three large referral centers from 1990 to 2002. Particular features of this series are its size, the length of follow-up, and the availability of results of minimal *Correspondence to: Dr P. Dreger, Department of Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg, Germany. Tel: +49-6221-56-8008; Fax: +49-6221-56-6824; E-mail: [email protected]
residual disease (MRD) assessment for patients in long-term remission. The results show that the prognosis of patients with FL relapse after autoSCT is remarkably good. Only those who have very early disease recurrence face a dismal outcome and might benefit from intensive treatment approaches, such as allogeneic SCT.
patients and methods patients Eligible for this study were all patients who had undergone high-dose therapy with autoSCT for disseminated FL from 1990 to 2002 on consecutive protocols active at the University of Heidelberg or at the University of Kiel/AK St Georg Hamburg consortium (considered as one center for the purposes of this study). Patients with high-grade transformation before SCT were excluded. Details of the eligibility criteria and the design of the original protocols have been published previously [3, 5,11–13]. In brief, at both institutions, consecutive patients with advanced-stage disease were included in first-line autoSCT protocols if they had a diagnosis of stage III/IV FL
ª The Author 2009. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: [email protected]
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
Background: Pattern and outcome of disease recurrence after autologous stem-cell transplantation (autoSCT) for
original article
Annals of Oncology
MRD analysis In follow-up blood samples of patients in long-term clinical remission, MRD was assessed in those patients who had a documented marker in diagnostic samples before transplant [16] by MBR PCR using a multiplex primer set according the BIOMED-2 Concerted Action [17] and a consensus JH reverse primer (5# CTTACCTGAGGAGACGGTGACC 3#). Quantitative MRD assessment was carried out by real-time PCR (RQPCR) using a chromosome 18 MBR forward primer together with a consensus probe complementary to germline JH1, JH4, and JH5 (JH1/4/ 5-probe) and a JH4 germline reverse primer. PCRs were carried out on an ABI PRISM 7700 thermal cycler (Applied Biosystems, Darmstadt, Germany) as previously described [18]. For determining the quantitative MRD levels, target copy numbers were related to the number of target copies of the lymphoma cell line K422 (DSMZ, Braunschweig, Germany) bearing a t(14;18) translocation with an involvement of IGH-JH4.
Volume 20 | No. 4 | April 2009
Table 1. Patient characteristics (n = 241) Variable
# Positive
Sample size
%
FLIPI at diagnosis high FLIPI at diagnosis intermediate Age at diagnosis (years) Age at autoSCT >48 Interval diagnosis—SCT (months) Rituximab before autoSCT No CR at autoSCT HD regimen TBI Ex vivo purging yes Salvage autoSCT Year of autoSCT 1997–2002 Follow-up (months)
31 85 45 47 12 34 126 159 50 86 67 96
168 168 241 241 241 241 237 241 241 241 241 241
18% 51%
(18–62) (22–65) (5–168)
(6–198)
14% 53% 66% 21% 36% 29%
FLIPI, Follicular Lymphoma International Prognostic Index; autoSCT, autologous stem-cell transplantation; CR, complete response; HD, highdose; TBI, total body irradiation. Experiments were done at least in triplicate for each sample. To equalize differences in amount and quality of the DNA, albumin copies were quantitated as internal reference in all samples and were used for subsequent normalization of MRD values. MRD levels were given as fraction of numbers of FL cells per total number of mononuclear blood cells analyzed per PCR assay. The sensitivity reached 1025 in polyclonal DNA.
statistical analysis For descriptive statistics, the calculation of median, minimum, maximum, range, and relative and absolute frequencies was done. Survival times were estimated using the Kaplan–Meier method, comparisons between survival curves in different strata were carried out using the log-rank test. End points were overall survival (OS), progression-free survival (PFS), and relapse incidence. OS was defined as time from autoSCT (or time from relapse) until death of any cause. PFS was defined as time from autoSCT until relapse, progression, or death from any cause. Relapse incidence (time to progression) was defined as time from autoSCT until relapse or progression. Relapse/progression was defined as appearance of new lesions and/or an increase of known lesions of >50%. Proportional hazards models (Cox regression) were set up to investigate the confounding effects of factors prognostic for relapse and survival. All explanatory variables with a P value of 0.1 or less in univariate analysis were included in the Cox models. Significance levels were set at 0.05. Calculations were done using GraphPad Prism software (release 3.02; San Diego, CA) and MedCalc (release 9.0, Mariakerke, Belgium). Data were analyzed as of 30 November 2007.
results relapse incidence With a median follow-up for the surviving patients of 8 years (0.5–16.5), 103 relapses occurred in 241 patients at risk. The 10-year relapse probability (Kaplan–Meier) was 47% [95% confidence interval (CI) 40% to 54%]. The 10-year OS and PFS were 75% (68%–81%) and 49% (42%–56%) (Figure 1). Histology was available in 90 cases and revealed high-grade transformation in 12 (13%) of them. Further characteristics of the relapse population are summarized in Table 2.
doi:10.1093/annonc/mdn691 | 723
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
according to the REAL classification or centroblastic–centrocytic lymphoma according to the Kiel classification, respectively, age of 18–60 years and adequate performance status (Karnofsky ‡ 80%) and organ function. For salvage autoSCT protocols, patients had to fulfill the same criteria in addition to relapse or progression after one or more of previous treatment lines. The rationale in the original protocols for using autoSCT in this population was that this modality might be a curative approach for otherwise incurable advanced FL [3, 5]. More sophisticated high-risk selection criteria, in particular the Follicular Lymphoma International Prognostic Index (FLIPI) [14], were not used since they were not available at the time these patients were treated. If carried out as part of first-line treatment, in both institutions sequential treatment intensification comprised induction with a cyclophosphamide, doxorubicine, vincristine, and prednisolone (CHOP)like standard regimen until maximum response followed by stem-cell mobilization with HAM (high-dose cytarabine 2 g/m2 every 12 h on days 1 and 2, mitoxantrone cytarabine 10 mg/m2/day on days 2 and 3; Heidelberg) or Dexa-BEAM (dexamethasone 3 · 8 mg on days 1–10, carmustine 60 mg/m2 on day 2, etoposide 75 mg/m2 on days 4–7, cytarabine 100 mg/m2 every 12 h on days 4–7, and melphalan 20 mg/m2 on day 3; Kiel/Hamburg). CHOP-like induction was usually omitted if sequential treatment intensification was administered for salvage treatment. Myeloablative therapy consisted in total body irradiation (TBI) and high-dose cyclophosphamide. TBI was given in fractionated doses twice daily on four consecutive days for a total of 14.4 Gy (Heidelberg) or on three consecutive days for a total of 12 Gy (Kiel/Hamburg); cyclophosphamide was infused on the days after TBI at total a dose of 200 mg/kg (Heidelberg) or 120 mg/kg (Kiel/Hamburg). Patients with previous radiotherapy received BEAM (BCNU 300 mg/m2, etoposide 800 mg/m2, cytarabine 1600 mg/2, and melphalan 140 mg/m2; Heidelberg) or busulfan/cyclophosphamide (busulfan 1 mg/kg of body weight four times a day for 4 days followed by cyclophosphamide 60 mg/kg for 2 days; Kiel). Since July 1997, BEAM was used for preirradiated patients also in Kiel. Subsequently, both institutions replaced TBI/CY by BEAM as standard myeloablative regimen also in the first-line setting (Heidelberg, December 1999; Kiel/Hamburg, May 2000). Fifty patients (Heidelberg 36; Kiel/Hamburg 14) were treated on protocols employing reconstitution with grafts that had been depleted of B cells ex vivo using immunomagnetic devices (Isolex300 47; MaxSep 3; Baxter/Nexell, Irvine, CA) [12, 15]. Protocols had been approved by the responsible institutional review boards. Patients gave written informed consent. Two hundred and forty-one consecutive patients who fulfilled the eligibility criteria for this study were analyzed retrospectively, 151 from Heidelberg and 90 from Kiel/Hamburg. Patient characteristics are summarized in Table 1.
original article
Annals of Oncology
Table 2. Relapse population characteristics (n = 103)
Percent Survival
100
A
50
0 0
60
120
180
Months from SCT 100
Percent relapsed
Sample size
%
Histology transformed FLIPI at dx high FLIPI at dx intermediate Age at autoSCT >47 Rituximab before autoSCT No CR at autoSCT HD regimen TBI Salvage autoSCT Ex vivo purging yes REL year 1999–2006 Center Heidelberg
12 13 38 51 10 55 58 47 16 52 58
90 67 67 103 103 99 103 103 103 103 103
13% 19% 57% 50% 10% 56% 56% 46% 16% 50% 56%
FLIPI, Follicular Lymphoma International Prognostic Index; autoSCT, autologous stem-cell transplantation; CR, complete response; HD, highdose; REL, relapse; TBI, total body irradiation; REL, relapse.
relapse. Only the latter variable retained statistical significance in Cox analysis (Table 3). 50
0 0
60
120
180
Months from SCT 100
C Percent PFS
# Positive
50
0 0
60
120
180
Months from SCT Figure 1. Overall survival (A), time to progression (B), and progressionfree survival (C) of 241 patients after autologous stem-cell transplantation.
prognostic factors for relapse Log-rank comparisons considering FLIPI at diagnosis, age at autoSCT, remission status at autoSCT, treatment line of autoSCT, myeloablative regimen, ex vivo purging, year of transplantation, and center showed a favorable effect of TBIcontaining high-dose regimens and an unfavorable effect of autoSCT carried out in a salvage situation on the probability of
724 | Kornacker et al.
relapse kinetics and MRD Median time from autoSCT to relapse was 20 (2–128) months, with 33 relapses occurring within the first year posttransplant. Notably, only three relapses were observed later than 6 years posttransplant. Twenty-four patients who were in ongoing complete remission >8 years after transplant had a bcl-2/IgH PCR marker available for molecular MRD assessment. RQ-PCR demonstrated low-level MRD (0.9–6.0 · 1025) in peripheral blood samples obtained at or close to the last follow-up (median 132 months post-autoSCT, range 85–155) in 3 of 24 patients (13%), while the remainder showed no evidence of disease persistence at the molecular level. survival after relapse and risk factor analysis With a median follow-up of surviving patients of 55 (1–139) months, 39 deaths after relapse were observed, translating into a median survival after relapse of 100 months with a 5-year probability of 60% (50%–71%) (Figure 2A). Cause of death was progressive disease in 22 patients, infections in six patients, complications of alloSCT in three patients, miscellaneous in two patients, and unknown in six patients (Table 4). By univariate analysis, survival from relapse was not affected by histology, high-risk FLIPI, higher age, and absence of CR at autoSCT, TBI myeloablation, ex vivo purging, and center. However, patients with disease recurrence within 1 year from transplant had significantly reduced survival (median survival 28 months versus not reached) (Figure 2B). Additional significant adverse factors were salvage autoSCT (median survival 61 months versus not reached) (Figure 2C) and relapse before 1999 (median survival 61 months versus not reached). The adverse effect of short time to relapse on survival after relapse was particularly pronounced in those patients who underwent autoSCT as part of salvage treatment (median survival 9.5 months versus not reached) (Figure 2D). The significant impact of time to relapse and line of autoSCT were confirmed by Cox modeling including also the
Volume 20 | No. 4 | April 2009
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
B
Variable
original article
Annals of Oncology
Table 3. Prognostic factor analyses (Cox) End point (sample size)
Variable
P value
HR
LowerCL
UpperCL
Relapse after autoSCT (237)
No CR at autoSCT HD regimen without TBI Salvage autoSCT Ex vivo purging yes Center HD CR at autoSCT Salvage autoSCT Time to REL <12 months REL year 1999–2006
0.091 0.104 0.032 0.22 0.19 0.097 0.01 0.014 0.4
1.39 1.19 1.63 0.71 0.74 0.55 2.45 2.37 0.73
0.95 0.94 1.04 0.41 0.48 0.28 1.24 1.20 0.35
2.03 1.49 2.53 1.23 1.15 1.11 4.82 4.68 1.51
Survival after relapse (103)
50
C
100
Percent Survival
100
50
HR 2.02 (1.09, 3.93); p .026
Salvage (23/47) Upfront (16/56)
0
0 0
24
48
72
96
120
144
0
24
100
Percent Survival
50
HR 2.37 (1.35-5.47); p 0.0051
Tx_REL <=12 (19/33)
D
100
Percent Survival
B
48
72
96
120
144
Months from relapse
Months from relapse
50
HR 4.72 (2.89, 20.1); p < 0.0001
Tx_REL <= 12mo (14/16) Tx_REL > 12mo (9/31)
Tx_REL >12 (20/70) 0
0 0
24
48
72
96
120
144
Months from relapse
0
24
48
72
96
120
144
Months from relapse
Figure 2. Survival after relapse after autologous stem-cell transplantation (n = 103): all patients (A); by time interval from autoSCT to relapse (B; black line, >12 months; grey line, £12 months); by time of autoSCT (C; black line, upfront; grey line, salvage); patients with salvage autoSCT only by time interval from autoSCT to relapse (D; black line, >12 months; grey line, £12 months).
explanatory variables relapse year and remission status at autoSCT (Table 3).
treatment of relapse Information on treatment was available for 89 patients. Of these, five (6%) had no FL-specific treatment until last followup, and six patients (7%) were treated with local radiotherapy only. Five (6%) and 12 patients (13%), respectively, had sufficient disease control with interferon and rituximab monotherapy. More intensive systemic treatment was administered to the remainder: maximum salvage intensity was combination chemotherapy in 17 patients (19%); rituximab–
Volume 20 | No. 4 | April 2009
chemotherapy combinations in 31 patients (35%); and allogeneic SCT in 13 patients (15%). The proportion of patients receiving salvage combination chemotherapy and/or allogeneic SCT was not different between individuals relapsing within 1-year posttransplant or those relapsing later (61% and 59%; P = 1.0, Fisher’s exact test). Survival of patients receiving combination therapy with rituximab was significantly superior to that of patients who were salvaged with combination chemotherapy only [hazard ratio 0.24 (95% CI 0.065–0.49); P = 0.0008]. Nine patients who underwent salvage allogeneic SCT with reduced-intensity conditioning had a 5-year survival probability of 89% (68%–100%).
doi:10.1093/annonc/mdn691 | 725
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
A Percent Survival
HR, hazard ratio; autoSCT, autologous stem-cell transplantation; CR, complete response; HD, high dose; TBI, total body irradiation.
original article
Annals of Oncology
secondary malignancies In the nonrelapse population, five secondary malignancies were observed, including three cases of treatment-related myelodysplasia. The outcome was fatal in all five patients (Table 4). No secondary malignancies occurred in the relapse population.
discussion
Table 4. Causes of death Population
Nonrelapse
Relapse
Details
Progressive disease Infections during HDT-related aplasia Other infections Nonengraftment Complications of salvage alloSCT Secondary neoplasm
– 5 3 2 – 5
22 (56%) – 6 (15%) – 3 (8%) –
Miscellaneous
–
2 (5%)
Unknown Total
– 15
6 (15%) 39
– Three sepsis; one endocarditis; one aspergillus pneumonia – – – Three myelodysplasia/AML +32, +45, and +68 months; one pancreas carcinoma +8 months; one mamma carcinoma +52 months One progressive multifocal leukencephalopathy; one myocardial infarction –
(33%) (20%) (13%) (33%)
alloSCT, allogeneic stem-cell proliferation; AML, acute myeloid leukemia; HDT, high-dose-therapy.
726 | Kornacker et al.
Volume 20 | No. 4 | April 2009
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
With 5-year PFS times ranging from 60% to 70% in first-line settings [5, 6, 9, 19, 20] and from 40% to 55% in salvage situations [4, 8, 9, 21], autoSCT is a highly effective treatment for disseminated FL. However, relapses are common, and their prognostic impact is obvious. Therefore, investigation of the kinetics of FL recurrence after autoSCT and parameters determining its outcome might not only provide a rationale basis for salvage treatment strategies but also help to reconsider individual indications for autoSCT. Although in most published series OS exceeds PFS substantially and thus it might be concluded that prognosis after relapse is not extraordinarily bad, comprehensive analyses of relapse after autoSCT for FL are highly desirable. Such an analysis was reported by Apostolidis et al. [22], who observed 33 relapses in 99 patients having undergone myeloablative therapy with reinfusion of ex vivo Bdepleted bone marrow grafts. Median time to relapse was 14 months, and 45% of the patients were alive 5 years after relapse. Similar to the work of Apostolidis et al., the present study has the limitations genuine to retrospective analyses. However, we report on a much larger population with considerably longer follow-up. Furthermore, our patients had been autografted with peripheral blood stem cells, and autoSCT had been carried out mainly as part of first-line treatment. Most importantly, our analysis considers patients who had access to more recent treatment modalities for FL, including rituximab. With a median survival of >8 years, outcome after failure of autoSCT was remarkably good. Moreover, survival appeared to improve over time, possibly reflecting the impact of rituximab and other novel salvage modalities. The latter assumption is supported by our finding that those patients who had been salvaged with a rituximab chemotherapy combination regimen at any time postrelapse survived significantly longer than those who received combination chemotherapy without rituximab
only. This comparison might be biased, however, by selection of favorable patients to the rituximab group simply because they lived long enough to reach the rituximab era and therefore must be interpreted with caution. In any case, the prognosis of FL relapse upon autoSCT appears to be comparable to that of FL recurrence after conventional first- or second-line therapy [23, 24]. This is in accordance with the findings of Apostolidis et al. and implies that first-line autoSCT with peripheral blood stem cells does not affect the ‘salvagability’ of patients with FL once they relapse after high-dose therapy. In contrast, prognosis was dismal in those patients whose disease recurred within the first posttransplant year. Although the negative prognostic impact of a short time interval to relapse is plausible and parallels observations made in aggressive B-cell lymphoma and chronic lymphocytic leukemia, this has never been formally documented for patients with FL relapsing after autoSCT or any other intensive therapy. Thus, time to relapse may help to identify a subset of patients who might benefit from aggressive salvage approaches, such nonmyeloablative allogeneic SCT [25–29]. This study did not primarily intend to evaluate the capacity of autoSCT for providing disease control. However, although modern rituximab-based treatments might have been very effective in the patient population analyzed here, too [30], the long-term results of autoSCT seem nevertheless remarkable. Particularly intriguing was the finding that relapse hardly occurred later than 6 years after transplant, resulting in a plateau of the relapse curve at 58% for patients transplanted in a salvage situation and 44% if autoSCT was part of first-line treatment. This observation is in line with a previous report on extended follow-up of FL after autologous bone marrow transplantation [8] and indicates that autoSCT might be capable of providing sustained control or even eradication of FL. To this end, our finding of absent or very low MRD in all patients in long-term complete remission available for molecular assessment is particularly encouraging. Similarly, though with considerably shorter follow-up, Corradini et al. [7] could show persistent absence of MRD in patients in long-term remission after high-dose therapy for FL. Similar to other studies addressing autoSCT [6], the patients analyzed here are not representative for an average FL population. This is best illustrated by looking at the FLIPI
original article
Annals of Oncology
references 1. Gribben JG, Freedman AS, Neuberg D et al. Immunologic purging of marrow assessed by PCR before autologous bone marrow transplantation for B-cell lymphoma. N Engl J Med 1991; 325: 1525–1533. 2. Rohatiner AZ, Johnson PW, Price CG et al. Myeloablative therapy with autologous bone marrow transplantation as consolidation therapy for recurrent follicular lymphoma. J Clin Oncol 1994; 12: 1177–1184. 3. Haas R, Moos M, Karcher A et al. Sequential high-dose therapy with peripheralblood progenitor-cell support in low-grade non-Hodgkin’s lymphoma. J Clin Oncol 1994; 12: 1685–1692. 4. Brice P, Simon D, Bouabdallah R et al. High-dose therapy with autologous stemcell transplantation (ASCT) after first progression prolonged survival of follicular lymphoma patients included in the prospective GELF 86 protocol. Ann Oncol 2000; 11: 1585–1590. 5. Lenz G, Dreyling M, Schiegnitz E et al. Myeloablative radiochemotherapy followed by autologous stem cell transplantation in first remission prolongs progression-free survival in follicular lymphoma—results of a prospective randomized trial of the German Low-Grade Lymphoma Study Group (GLSG). Blood 2004; 104: 2667–2674. 6. Deconinck E, Foussard C, Milpied N et al. High dose therapy followed by autologous purged stem cell transplantation and doxorubicin based chemotherapy in patients with advanced follicular lymphoma: a randomized multicenter study by the GOELAMS. Blood 2005; 105: 3817–3823. 7. Corradini P, Ladetto M, Zallio F et al. Long-term follow-up of indolent lymphoma patients treated with high-dose sequential chemotherapy and autografting:
Volume 20 | No. 4 | April 2009
8.
9.
10. 11.
12.
13.
14. 15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
evidence that durable molecular and clinical remission frequently can be attained only in follicular subtypes. J Clin Oncol 2004; 22: 1460–1468. Rohatiner AZ, Nadler L, Davies AJ et al. Myeloablative therapy with autologous bone marrow transplantation for follicular lymphoma at the time of second or subsequent remission: long-term follow-up. J Clin Oncol 2007; 25: 2554–2559. Montoto S, Canals C, Rohatiner AZ et al. Long-term follow-up of high-dose treatment with autologous haematopoietic progenitor cell support in 693 patients with follicular lymphoma: an EBMT registry study. Leukemia 2007; 21: 2324–2331. Schmitz N, Buske C, Gisselbrecht C. Autologous stem cell transplantation in lymphoma. Semin Hematol 2007; 44: 234–245. Voso MT, Martin S, Hohaus S et al. Prognostic factors for the clinical outcome of patients with follicular lymphoma following high-dose therapy and peripheral blood stem cell transplantation (PBSCT). Bone Marrow Transplant 2000; 25: 957–964. Dreger P, Viehmann K, von Neuhoff N et al. Autografting of highly purified peripheral blood progenitor cells following myeloablative therapy in patients with lymphoma: a prospective study of the long-term effects on tumor eradication, reconstitution of hematopoiesis and immune recovery. Bone Marrow Transplant 1999; 24: 153–161. Seyfarth B, Kuse R, Sonnen R et al. Autologous stem cell transplantation for follicular lymphoma: no benefit for early transplant? Ann Hematol 2001; 80: 398–405. Solal-Celigny P, Roy P, Colombat P et al. Follicular lymphoma international prognostic index. Blood 2004; 104: 1258–1264. Dreger P, von Neuhoff N, Suttorp M, Schmitz N. Rapid engraftment of peripheral blood progenitor cell grafts purged with B cell-specific monoclonal antibodies and immunomagnetic beads. Bone Marrow Transplant 1995; 16: 627–629. Moos M, Schulz R, Martin S et al. The remission status before and the PCR status after high-dose therapy with peripheral blood stem cell support are prognostic factors for relapse-free survival in patients with follicular nonHodgkin’s lymphoma. Leukemia 1998; 12: 1971–1976. van Dongen JJ, Langerak AW, Bruggemann M et al. Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 Concerted Action BMH4-CT98-3936. Leukemia 2003; 17: 2257–2317. Pott C, Schrader C, Gesk S et al. Quantitative assessment of molecular remission following high-dose therapy with autologous stem cell transplantation predicts long term remission in mantle cell lymphoma. Blood 2006; 107: 2271–2278. Sebban C, Mounier N, Brousse N et al. Standard chemotherapy with interferon compared with CHOP followed by high-dose therapy with autologous stem cell transplantation in untreated patients with advanced follicular lymphoma: the GELF-94 randomized study from the Groupe d’Etude des Lymphomes de l’Adulte (GELA). Blood 2006; 108: 2540–2544. Ladetto M, De Marco F, Benedetti F et al. Prospective, multicenter randomized GITMO/IIL trial comparing intensive (R-HDS) versus conventional (CHOP-R) chemoimmunotherapy in high-risk follicular lymphoma at diagnosis: the superior disease control of R-HDS does not translate into an overall survival advantage. Blood 2008; 111: 4004–4013. Schouten HC, Qian W, Kvaloy S et al. High-dose therapy improves progressionfree survival and survival in relapsed follicular non-Hodgkin’s lymphoma: results from the randomized European CUP trial. J Clin Oncol 2003; 21: 3918–3927. Apostolidis J, Foran JM, Johnson PWM et al. Patterns of outcome following recurrence after myeloablative therapy with autologous bone marrow transplantation for follicular lymphoma. J Clin Oncol 1999; 17: 216–221. van Oers MH, Klasa R, Marcus RE et al. Rituximab maintenance improves clinical outcome of relapsed/resistant follicular non-Hodgkin lymphoma in patients both with and without rituximab during induction: results of a prospective randomized phase 3 intergroup trial. Blood 2006; 108: 3295–3301. Seyfarth B, Josting A, Dreyling M, Schmitz N. Relapse in common lymphoma subtypes: salvage treatment options for follicular lymphoma, diffuse large cell lymphoma and Hodgkin disease. Br J Haematol 2006; 133: 3–18. Bertz H, Illerhaus G, Veelken H, Finke J. Allogeneic hematopoetic stem-cell transplantation for patients with relapsed or refractory lymphomas: comparison
doi:10.1093/annonc/mdn691 | 727
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
distribution: since old patients and those with early stage were not eligible, very high (4) or very low (0) FLIPI scores were excluded by study design, resulting in a predominance of intermediate (2) FLIPI scores (here 51% versus 37% in the original FLIPI population [14]). Nevertheless, the FLIPI score at diagnosis had no prognostic impact, implying that autoSCT might be able to compensate for the adverse effects of high-risk FLIPI seen under conventional chemotherapy. This is in accordance with results reported from a prospective trial on first-line autoSCT [6]. Therefore, the FLIPI might be a useful tool to select high-risk patients for prospective trials on autoSCT in FL who may particularly benefit from this procedure. With this in mind, and considering that a large proportion of patients received autoSCT in first remission, it is clear that the population analyzed here has favorable features which might not be met by future patients relapsing after autoSCT carried out for more advanced disease. However, since the FLIPI had no effect on survival after relapse, and the time to relapse effect was even more pronounced in the salvage autoSCT fraction, our findings should apply for patients with more unfavorable disease as well. In summary, this study documents that FL relapse after autoSCT follows a biphasic pattern with continuing relapse during the first 6 years and only few events thereafter. As confirmed by the absence of MRD, this could mean sustained disease control or true eradication in a significant proportion of patients. Those patients who relapse still have a relatively good prognosis which does not appear to be different from that of disease recurrence after standard treatment even in the era of rituximab-based treatment. The situation seems less favorable for patients who relapse early after autoSCT, suggesting that aggressive salvage approaches might be justified in this subset.
original article of high-dose conventional conditioning versus fludarabine-based reducedintensity regimens. Ann Oncol 2002; 13: 135–139. 26. Corradini P, Dodero A, Farina L et al. Allogeneic stem cell transplantation following reduced-intensity conditioning can induce durable clinical and molecular remissions in relapsed lymphomas: pre-transplant disease status and histotype heavily influence outcome. Leukemia 2007; 21: 2316–2323. 27. Khouri IF, McLaughlin P, Saliba RM et al. Eight-year experience with allogeneic stem cell transplantation for relapsed follicular lymphoma after nonmyeloablative conditioning with fludarabine, cyclophosphamide, and rituximab. Blood 2008; 111: 5530–5536.
Annals of Oncology
28. Rezvani AR, Storer B, Maris M et al. Nonmyeloablative allogeneic hematopoietic cell transplantation in relapsed, refractory, and transformed indolent nonHodgkin’s lymphoma. J Clin Oncol 2008; 26: 211–217. 29. Schmitz N, Dreger P, Glass B, Sureda A. Allogeneic transplantation in lymphoma: current status. Haematologica 2007; 92: 1533–1548. 30. Buske C, Hoster E, Dreyling M et al. The Follicular Lymphoma International Prognostic Index (FLIPI) separates high-risk from intermediate- or low-risk patients with advanced-stage follicular lymphoma treated front-line with rituximab and the combination of cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) with respect to treatment outcome. Blood 2006; 108: 1504–1508.
Downloaded from http://annonc.oxfordjournals.org/ at Kainan University on April 26, 2015
728 | Kornacker et al.
Volume 20 | No. 4 | April 2009