- Email: [email protected]
Characterization of a specific interaction between IP-L, a tobacco protein localized in the thylakoid membranes, and Tomato mosaic virus coat protein
Biochemical and Biophysical Research Communications 374 (2008) 253–257
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Characterization of a specific interaction between IP-L, a tobacco protein localized in the thylakoid membranes, and Tomato mosaic virus coat protein Chaozheng Zhang a,1, Yueyong Liu a,1,2, Xianchao Sun b, Weidong Qian a, Dongdong Zhang c, Bingsheng Qiu a,* a
Center for Agricultural Biotechnology, Institute of Microbiology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing 100101, China Laboratory of Plant Virology, College of Plant Protection, Southwest University, Chongqing 400716, China c College of Life Science, Agricultural University of Hebei, Baoding 071001, China b
a r t i c l e
i n f o
Article history: Received 26 June 2008 Available online 14 July 2008
Keywords: Tomato mosaic virus Coat protein IP-L Thylakoid membrane Chlorosis
a b s t r a c t We previously demonstrated a specific interaction between Tomato mosaic virus (ToMV) coat protein (CP) and a tobacco protein designated IP-L that may be involved in the long-distance movement of ToMV. Here, using the yeast two-hybrid system and GST pull-down assay, we demonstrated that the N-terminal helical region (residues 3–18) of IP-L is required for the interaction, while two a-helical domains (residues 21–31 and 142–147) of ToMV CP are involved. Furthermore, using immunoblotting, we showed that both of the IP-L and the majority of ToMV CP are co-localized in the chloroplast thylakoid membranes. These results provide further evidence for the association between tobamovirus CPs and thylakoid membrane components, which has been shown to be involved in chlorosis formation during viral infection, and indicate that the interaction between ToMV CP and IP-L may affect chloroplast function and stability and thus leading to chlorosis. Ó 2008 Elsevier Inc. All rights reserved.
The ability of plant viruses to invade host plants and cause diseases is determined by molecular interactions between host and virus factors. These interactions directly affect virus replication, cell-to-cell movement, systemic movement, and symptom development, as well as the elicitation of host defense responses [1]. To date, many host factors have been identified to interact specifically with some viral gene products, including coat protein (CP), movement protein (MP) and replicase protein [2–6]. However, the explicit roles of these host factors and their interactions with virus factors in viral pathogenicity and host plant resistance remain to be investigated. Tomato mosaic virus (ToMV), a member of the Tobamovirus genus, has a positive-sense single-stranded RNA genome that encodes at least four proteins [7]. The 130- and 180-kDa replicase proteins are translated directly from the genomic RNA using the same first initiation codon, and the 180-kDa protein is synthesized by read-through of the amber termination codon of the 130-kDa protein gene. Although both the replicase proteins are involved in viral RNA replication, they exhibit different functions. The 180-kDa protein is necessary for viral RNA replication and performs the known functions associated with the replication,
whereas the 130-kDa protein appears to enhance the efficiency of the replication [8]. The 30-kDa MP and 17-kDa CP are translated from the respective subgenomic mRNAs, which are synthesized during the replication cycle. It has been shown that MP is essential for cell-to-cell movement [9], and CP mainly plays a role in longdistance movement of tobamoviruses in plants [10,11]. We previously identified a tobacco protein designated IP-L that interacts with ToMV CP using a Gal4-based yeast two-hybrid system [12]. The initial functional analysis of IP-L using virus-induced gene silencing (VIGS) showed that it may be involved in the longdistance movement of ToMV [12]. However, the molecular basis of the interaction between ToMV CP and IP-L, as well as the roles of the interaction in viral infection, is not well understood. In this study, we characterized the interaction between IP-L and ToMV CP, and identified the domains required for the interaction on both proteins using the yeast two-hybrid system and GST pull-down assay. Furthermore, we investigated the subcellular localization of IP-L using immunoblotting, and showed that IP-L is localized in the thylakoid membranes in tobacco leaf tissue, which suggests that its interaction with ToMV CP may be involved in chlorosis formation during viral infection. Materials and methods
* Corresponding author. Fax: +86 10 6480 7363. E-mail address: [email protected] (B. Qiu). 1 Both authors contributed equally to this work. 2 Present address: California Pacific Medical Center Research Institute, San Francisco, CA 94107, USA. 0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.07.010
Plants, virus source and cell lines. Nicotiana benthamiana was used as the host plant and grown on soil in growth chamber with 70% relative humidity and a 12-h light/12-h dark photoperiod at 22
254
C. Zhang et al. / Biochemical and Biophysical Research Communications 374 (2008) 253–257
to 26 °C. Leaves of 4-week-old plants were mechanically inoculated with ToMV and then harvested 7 days after inoculation. Escherichia coli strains DH5a and BL21 (DE3) (Novagen), kept in our laboratory, were used as a cloning strain and an expression strain, respectively. Saccharomyces cerevisiae strain AH109 (Clontech) was used in yeast two-hybrid assay to characterize the interaction between ToMV CP and IP-L. Chemicals. The polyclonal antisera against IP-L and ToMV CP were raised by injecting rabbits with IP-L and ToMV CP cleaved from purified GST-fusion proteins, respectively, according to the standard immunization protocol. HRP labeled goat anti-rabbit IgG was purchased from Amersham Biosciences. Other chemicals were purchased from either Sigma (St. Louis, MO) or TAKARA Shuzo (Otsu, Japan), unless otherwise noted. Plasmid constructs. The constructs used in the yeast two-hybrid assay were generated by inserting the deletion mutants derived from the IP-L or ToMV CP gene into vectors pGADT7 and pGBKT7 (Clontech). Polymerase chain reaction (PCR) was used to generate the deletion mutants that were flanked by appropriate restriction sites. Primers used for PCR are listed in Table 1. pGADT7-IP-L harboring the full-length IP-L gene and pGBKT7-ToCP harboring the entire ToMV CP gene were reported previously [12] and used as templates in PCR. DNA fragments encoding residues 1–52 (primers IP-L-F and IP-L-RDC103), 1-104 (primers IP-L-F and IP-L-RDC51), 20–155 (primers IP-L-FDN19 and IP-L-R), 36–155 (primers IP-LFDN35 and IP-L-R), 53–155 (primers IP-L-FDN52 and IP-L-R) and 105–155 (primers IP-L-FDN104 and IP-L-R) of IP-L, were amplified and cloned between the EcoRI and BamHI sites of pGADT7 to generate pGADT7-IP-LDC103, pGADT7-IP-LDC51, pGADT7-IP-LDN19, pGADT7-IP-LDN35, pGADT7-IP-LDN52, pGADT7-IP-LDN104. DNA fragments encoding residues 1–54 (primers CP-F and CPRDC105), 1–106 (primers CP-F and CP-RDC53), 1–137 (primers CP-F and CP-RDC22), 1–149 (primers CP-F and CP-RDC10), 16–54 (primers CP-FDN15 and CP-RDC105), 16–149 (primers CP-FDN15 and CP-RDC10), 16–159 (primers CP-FDN15 and CP-R), 32–54 (primers CP-FDN31 and CP-RDC105), 32–137 (primers CPFDN31and CP-RDC22), 32–159 (primers CP-FDN31 and CP-R), 55–106 (primers CP-FDN54 and CP-RDC53), 55–159 (primers CPFDN54 and CP-R), 107–137 (primers CP-FDN106 and CP-RDC22), 107–149 (primers CP-FDN106 and CP-RDC10) and 107–159 (primers CP-FDN106 and CP-R) of ToMV CP, were amplified and cloned into pGBKT7 to generate pGBKT7-CPDC105, pGBKT7-CPDC53, pGBKT7-CPDC22, pGBKT7-CPDC10, pGBKT7-CPDN15DC105, pGBKT7-CPDN15DC10, pGBKT7-CPDN15, pGBKT7-CPDN31D Table 1 Primers used for the construction of the IP-L and ToMV CP mutants a
Gene
Primer
Sequence (50 ? 30 )
IP-L
IP-L-F IP-L-FDN19 IP-L-FDN35 IP-L-FDN52 IP-L-FDN104 IP-L-RDC51 IP-L-RDC103 IP-L-R
GGCGAATTCATGGTTCTCCAAACTCAA GAGAATTCAACTACTATTCCGATAGTAGC GAGAATTCCCTTCGGGCTATTCCACCAT GCAGAATTCATGATGGGTCATGGTGGC GCCGAATTCGGCTATGGTAGTGGAATG AGCGGATCCACCATCACTATGGATCATAC GAAGGATCCCATGTGATTGTGAGTGGAC GTCGGATCCTTATTCCTCCAAATCCTTA
CP-F CP-FDN15 CP-FDN31 CP-FDN54 CP-FDN106 CP-RDC10 CP-RDC22 CP-RDC105 CP-RDC53 CP-R
GCGAATTCATGTCTTACTCAATCACTTCTCC GCGAATTCTCTGTATGGGCTGACCCTAT GCGAATTCTTAGGTAACCAGTTTCAA GCGAATTCCCTTTCCCTCAGAGCACC GCGAATTCGAAACGTTAGATGCTACCCG TCGGATCCAGACATACTTTCAAAAGTATT GCGGATCCAGTACCTCTTACTAGTTCATT GAGGATCCTTTCCACACCTCGCTGAAC GCGGATCCAGCTGTTGTCGGACTCTGC GCGGATCCTTAAGATGCAGGTGCAGAG
The CP gene
a Restriction enzyme sites (EcoRI and BamHI) used for cloning were underlined. Primers were synthesized by Invitrogen.
C105, pGBKT7-CPDN31DC22, pGBKT7-CPDN31, pGBKT7CPDN54DC53, pGBKT7-CPDN54, pGBKT7-CPDN106DC22, pGBKT7CPDN106DC10 and pGBKT7-CPDN106, respectively. To obtain sufficient amounts of recombinant proteins for in vitro binding assays, the full-length IP-L and ToMV CP gene, excised from the plasmids pGEX-IP-L and pGEX-CP [12], were cloned between the EcoRI and XhoI sites of pET30a (+) vector (Novagen) to generate pET-IP-L and pET-ToMV-CP, respectively. The deletion mutants of IP-L gene were cut from the yeast two-hybrid constructs described above, and cloned between the EcoRI and XhoI sites of pGEX-6P-1 vector (Amersham Biosciences) in frame with the glutathione-S-transferase (GST) gene. Similarly, the mutants of ToMV CP gene were cloned between the EcoRI and SalI sites of pGEX-6P-1 vector. The sequences of all constructs were confirmed by DNA sequencing. Yeast two-hybrid assay and b-galactosidase assays. Yeast two-hybrid assay was carried out using the Matchmaker GAL4 Two-Hybrid System 3 (Clontech) according to the manufacturer’s protocols. S. cerevisiae strain AH109 was transformed with the yeast two-hybrid constructs described above using the small-scale lithium acetate (LiAc) method (Clontech), and subsequently plated on SD minimal medium lacking adenine, histidine, leucine and tryptophan (SD/-Ade/-His/-Leu/-Trp). The b-galactosidase colonylift filter assay using 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-gal) as a substrate was then carried out to assess the interactions according to the manufacturer’s protocols (Clontech). GST pull-down assay. His-tagged ToMV CP and IP-L were expressed and then purified by Nickel-affinity chromatography according to the instructions of the manufacturer (Novagen), respectively. The deletion mutants of ToMV CP and IP-L, fused to GST, were expressed and purified using glutathione sepharose 4B affinity resin as described previously [12]. Concentrations of the purified proteins were determined using the BCA protein assay (Pierce Biochemicals). GST pull-down assay was performed as described previously [13]. Briefly, 1.5 lg of GST control and GST-fusion proteins were incubated with glutathione sepharose 4B beads for 1 h at 4 °C, respectively. The beads were washed to remove unbound proteins and then incubated with 1.5 lg of Histagged proteins for 3 h at 4 °C. After extensive washing, bound proteins were eluted by boiling in SDS sample buffer and analyzed by immunoblotting using rabbit anti-His-tag Polyclonal antibody and HRP labeled goat anti-rabbit IgG as the primary and secondary antibodies, respectively. Chloroplast isolation and fractionation, and immunoblotting. Chloroplasts, isolated from healthy and systemically infected tobacco leaves, were subfractionated as described previously [14]. Intact thylakoids were further fractionated by sonication on ice. The thylakoid membranes were separated from the lumen extract by ultracentrifugation and resuspended in 10 mM Hepes–KOH (pH 8.0). Proteins in each fraction were subsequently analyzed by immunoblotting using rabbit anti-serum against IP-L and ToMV CP, respectively. Results and discussion The N-terminal helical region of IP-L is required for its interaction with ToMV CP To identify the regions of IP-L that mediate its interaction with ToMV CP, four IP-L deletion mutants (IP-LDN52, IP-LDN104, IPLDC51 and IP-LDC103) were constructed and analyzed with the yeast two-hybrid system. In addition to the full-length IP-L, mutants IP-LDC51 and IP-LDC103 were able to interact with ToMV CP, whereas the other two mutants IP-LDN52 and IP-LDN104 lacking 52 and 104 amino acids (aa) from the N terminus, respectively, abolished their interaction (Fig. 1A). This indicated that the N-terminal 52 aa of IP-L are sufficient for the interaction.
C. Zhang et al. / Biochemical and Biophysical Research Communications 374 (2008) 253–257
Fig. 1. Mapping of IP-L domains involved in the interaction with Tomato mosaic virus (ToMV) coat protein (CP) with the yeast two-hybrid system (A) and GST pulldown assay (B). Saccharomyces cerevisiae strain AH109 was cotransformed with the yeast two-hybrid constructs encoding ToMV CP fused to GAL4BD and IP-L or IP-L deletion mutants fused to GAL4AD. The resulting transformants were tested for bgalactosidase activity by using the b-galactosidase colony-lift filter assay. The GST pull-down assay was performed to confirm the results of the yeast two-hybrid assay. Purified His-tagged ToMV CP was incubated with IP-L or IP-L deletion mutants fused to GST or with GST alone, immobilized on glutathione sepharose 4B beads. After washing bound proteins were detected by immunoblotting using rabbit anti-His-tag Polyclonal antibody.
Secondary structure prediction of IP-L by the hidden Markov model revealed the presence of an a-helical region (residues 3– 18) and a short b-sheet (residues 29–33) in its N-terminal 52-aa region (data not shown). To further identify the minimal region in the N-terminal domain of IP-L required for the interaction, two IP-L deletion mutants (IP-LDN35 and IP-LDN19) were constructed and analyzed. Neither of the two mutants could interact with ToMV CP (Fig. 1A), clearly indicating that the N-terminal helical region of IP-L is indispensable. These results were further confirmed in vitro using the GST pulldown assay. As shown in Fig. 1B, ToMV CP was able to interact with the full-length IP-L and two IP-L deletion mutants (GST-IP-LDC51 and GST-IP-LDC103) but not with other IP-L fragments or GST alone. IP-L is a newly identified tobacco protein interacting with ToMV CP. Sequence analysis revealed that the amino acid sequence of IPL is identical to that of a putative elicitor responsible protein (GenBank Accession No. BAB13710) of tobacco (Nicotiana tabacum) and has 67.6% identity with the deduced amino acid sequence from the open reading frame (ORF) of a senescence-related cDNA (SENU1) (GenBank Accession No. Z75523) from tomato (Solanum lycopersicum) [12]. However, IP-L was shown to have no known functional domains based upon the bioinformatical analysis. Secondary structure prediction showed that IP-L contains two a-helical regions and a short b-sheet (data not shown). The N-terminal helical region (residues 3–18), required for the interaction with ToMV CP, is highly homologous to some domains within other proteins in GenBank according to the BLAST analysis (data not shown). Therefore, we propose that the N-terminal helical region probably represents a novel functional domain for IP-L, playing an important role in ToMV infection cycle as well as host plant resistance. Two a-helical domains of ToMV CP are involved in its interaction with IP-L To map the ToMV CP domains involved in the interaction with IP-L, five deletion mutants (CPDN54, CPDN54DC53, CPDN106,
255
CPDC53 and CPDC105) were constructed and analyzed. All mutants except CPDN54DC53 were able to bind to IP-L (Fig. 2A), suggesting that both the N-terminal 54 aa and the C-terminal 53 aa of ToMV CP contain domains involved in the interaction, while its middle region (residues 55–106) is dispensable for the interaction. Structural analysis showed that three a-helices, Helix N (residues 7–13), Helix LS (residues 20–31) and Helix RS (residues 37– 50), were present in the N-terminal 54-aa region of tobacco mosaic virus (TMV) CP, whereas two a-helices, Helix LR (residues 107– 134) and Helix C (residues 141–146), were found in the C-terminal 53-aa region [15]. Considering the structural similarity between TMV CP and ToMV CP, we further constructed 10 deletion mutants (CPDN15, CPDN15DC10, CPDN15DC105, CPDN31, CPDN31DC22, CPDN31DC105, CPDC10, CPDN106DC10, CPDC22 and CPDN106DC22) to determine whether these a-helical domains of ToMV CP are responsible for its interaction with IP-L. As shown in Fig. 2A, CPDN15, CPDN15DC10, CPDN15DC105, CPDC10 and CPDN106DC10 were able to bind to IP-L, suggesting that the deletions of both the N-terminal 15 aa and C-terminal 10 aa of ToMV CP do not abolish their interactions. In addition, two mutants (CPDN31 and CPDC22) lacking the N-terminal 31 aa and C-terminal 22 aa of ToMV CP respectively, retained the binding ability, while three other mutants (CPDN31DC105, CPDN106DC22 and CPDN31DC22) lost the ability (Fig. 2A). These results clearly indicate that the two a-helical domains (residues 21–31 and 142– 147) of ToMV CP are involved in the interaction with IP-L. The conclusion was also supported by the in vitro GST pulldown assay, in which all of the ToMV CP deletion mutants, except GST-CPDN54DC53, GST-CPDN31DC105, GST-CPDN106DC22 and GST-CPDN31DC22, retained their ability to interact with IP-L (Fig. 2B). The tertiary structure of the tobamovirus CP consists of an antiparallel four-helix-bundle (Helix LS, RS, RR and LR) at central radius and two peripheral helices (Helix N and C) at higher radius connected via a short anti-parallel b-sheet [15]. Interactions at central radius are known to stabilize the packing between adjacent subunits and facilitate virion assembly [15,16]. The two a-helical domains (residues 21–31 and 142–147) of ToMV CP involved in the interaction with IP-L correspond to the central Helix LS and the peripheral Helix C in this study. The interaction between IP-L and ToMV CP, therefore, may alter the three-dimensional structure and even the assembly of ToMV CP by affecting the interaction between the adjacent CP subunits. A previous study showed that both the structure and the assembly of tobamovirus CP function as the determinants in the induction of disease and resistance responses [17]. Similarly, it is reasonable that the interaction between ToMV CP and IP-L may be one of the determinants in virus–host interactions. IP-L is localized in the thylakoid membranes in tobacco leaf tissue To explore the potential function of IP-L, its subcellular localization was investigated by immunoblotting using rabbit anti-serum against IP-L. Since the expression of IP-L was increased remarkably in the leaves of N. benthamiana infected with ToMV at 7 days post infection (dpi) as shown by previous study [12], systemically infected leaves were collected at 7 dpi and used for chloroplast isolation. Initially, using immunogold labeling (IGL), we demonstrated that IP-L is localized in the chloroplasts of both healthy and systemically infected tobacco plants, and the expression of IP-L in healthy plants is lower than that in infected plants, as shown by obviously lower number of gold particles observed in healthy plants compared to in infected plants (data not shown). To further determine the subcellular localization of IP-L, chloroplasts isolated from both healthy and systemically infected plants were fraction-
256
C. Zhang et al. / Biochemical and Biophysical Research Communications 374 (2008) 253–257
Fig. 2. Mapping of the IP-L-interacting domains of Tomato mosaic virus (ToMV) coat protein (CP) with the yeast two-hybrid system (A) and GST pull-down assay (B). Saccharomyces cerevisiae strain AH109 was cotransformed with the yeast two-hybrid constructs encoding IP-L fused to GAL4AD and ToMV CP or ToMV CP deletion mutants fused to GAL4BD. The resulting transformants were tested for b-galactosidase activity by using the b-galactosidase colony-lift filter assay. The GST pull-down assay was performed to confirm the results of the yeast two-hybrid assay. Purified His-tagged IP-L was incubated with ToMV CP or ToMV CP deletion mutants fused to GST or with GST alone, immobilized on glutathione sepharose 4B beads. After washing bound proteins were detected by immunoblotting using rabbit anti-His-tag Polyclonal antibody.
ated, and proteins of the stroma, thylakoid membrane and thylakoid lumen fractions were then analyzed by immunoblotting. As shown in Fig. 3A, in both healthy and infected plants, IP-L was exclusively localized in the thylakoid membranes, with no traces detectable in the stroma and thylakoid lumen. Also, we found that the concentration of IP-L in healthy plants is much lower than that in infected plants (Fig. 3), which is consistent with the IGL result and confirms the previous conclusion that expression of IP-L can
Fig. 3. Subcellular localization of IP-L and ToMV CP in tobacco chloroplast. Intact tobacco chloroplasts, isolated from healthy and systemically infected plants, were separated into stroma, thylakoid membrane and thylakoid lumen fractions. Proteins in each fraction were then analyzed by immunoblotting using rabbit anti-serum against IP-L and ToMV CP, respectively. S, stroma fraction; M, thylakoid membrane fraction; L, thylakoid lumen fraction.
be enhanced by ToMV infection [12]. These results also suggest that IP-L may be involved in some functions of thylakoid such as photosynthesis, electron transport and ATP synthesis. A previous study has revealed the presence of two pools of TMV CP in chloroplasts isolated from systemically infected leaves. The aggregated CP molecules were located in the stroma and the free CP molecules were associated with the thylakoid membranes [18]. To determine whether ToMV CP is associated with the thylakoid membranes, different fractions of chloroplasts isolated from systemically infected tobacco plants were analyzed by immunoblotting. Results showed that large amounts of ToMV CP were associated with the thylakoid membranes, while little CP was present in the stroma and thylakoid lumen (Fig. 3). Chlorosis in plants is a common symptom caused by many plant viruses upon systemic infection. The induction of chlorosis is mediated by a variety of different virus-induced physiological disturbances and virus–host interactions [19]. The chlorotic symptoms caused by different TMV strains or mutants are shown to be associated with the accumulation of the CP in the chloroplasts and the disruption of the photosystem II (PSII) complexes in the chloroplast thylakoid membranes [17,20–22]. There is also a positive correlation between the concentration of CP in chloroplasts and the severity of chlorosis, namely, chlorosis-inducing CPs have a greater propensity to accumulate in chloroplasts and thus have a greater ability to cause chlorosis [17,18,20–23]. These findings suggest that tobamovirus CPs can accumulate in chloroplasts of virus-infected leaves and cause chlorosis through their interactions with some cellular components, especially PSII complexes, in chloroplast thylakoid membranes. We have previously reported the
C. Zhang et al. / Biochemical and Biophysical Research Communications 374 (2008) 253–257
interaction between ToMV CP and IP-L [12]. We demonstrated here that both the IP-L and the majority of ToMV CP are co-localized in the chloroplast thylakoid membranes, providing further evidence for the association between tobamovirus CPs and thylakoid membranes during viral infection. Considering the relationship between the accumulation of CP and the inhibition of PSII activity together with the essential roles of the thylakoid membrane proteins in chloroplasts, IP-L probably plays a role in chloroplast function and stability, and the interaction between ToMV CP and IP-L may affect the chloroplast function and stability, and thus leading to chlorosis. Acknowledgments The authors thank Dr. Jian Liu (CPMC Research Institute) and Dr. Yaowei Huang (Virginia Polytechnic Institute and State University) for their critical reading of the manuscript. This work was supported by the National Natural Science Foundation of China (30570078). References [1] J.C. Carrington, S.A. Whitham, Viral invasion and host defense: strategies and counter-strategies, Curr. Opin. Plant Biol. 1 (1998) 336–341. [2] T.E. Abbink, J.R. Peart, T.N. Mos, D.C. Baulcombe, J.F. Bol, H.J. Linthorst, Silencing of a gene encoding a protein component of the oxygen-evolving complex of photosystem II enhances virus replication in plants, Virology 295 (2002) 307– 319. [3] Y. Hagiwara, K. Komoda, T. Yamanaka, A. Tamai, T. Meshi, R. Funada, T. Tsuchiya, S. Naito, M. Ishikawa, Subcellular localization of host and viral proteins associated with tobamovirus RNA replication, EMBO J. 22 (2003) 344– 353. [4] M. Heinlein, B.L. Epel, H.S. Padgett, R.N. Beachy, Interaction of tobamovirus movement proteins with the plant cytoskeleton, Science 270 (1995) 1983– 1985. [5] Y. Okinaka, K. Mise, T. Okuno, I. Furusawa, Characterization of a novel barley protein, HCP1, that interacts with the Brome mosaic virus coat protein, Mol. Plant Microbe Interact. 16 (2003) 352–359. [6] Y. Tsujimoto, T. Numaga, K. Ohshima, M.A. Yano, R. Ohsawa, D.B. Goto, S. Naito, M. Ishikawa, Arabidopsis TOBAMOVIRUS MULTIPLICATION (TOM) 2 locus encodes a transmembrane protein that interacts with TOM1, EMBO J. 22 (2003) 335–343.
257
[7] P. Goelet, G.P. Lomonossoff, P.J. Butler, M.E. Akam, M.J. Gait, J. Karn, Nucleotide sequence of Tobacco mosaic virus RNA, Proc. Natl. Acad. Sci. USA 79 (1982) 5818–5822. [8] D.J. Lewandowski, W.O. Dawson, Functions of the 126- and 183-kDa proteins of Tobacco mosaic virus, Virology 271 (2000) 90–98. [9] C.M. Deom, M.J. Oliver, R.N. Beachy, The 30-kilodalton gene product of tobacco mosaic virus potentiates virus movement, Science 237 (1987) 389–394. [10] T. Saito, K. Yamanaka, Y. Okada, Long-distance movement and viral assembly of Tobacco mosaic virus mutants, Virology 176 (1990) 329–336. [11] M.E. Hilf, W.O. Dawson, The tobamovirus capsid protein functions as a hostspecific determinant of long-distance movement, Virology 193 (1993) 106– 114. [12] Y. Li, M.Y. Wu, H.H. Song, X. Hu, B.S. Qiu, Identification of a tobacco protein interacting with Tomato mosaic virus coat protein and facilitating longdistance movement of virus, Arch. Virol. 150 (2005) 1993–2008. [13] H. Murdoch, G.J. Feng, D. Bächner, L. Ormiston, J.H. White, D. Richter, G. Milligan, Periplakin interferes with G protein activation by the melaninconcentrating hormone receptor-1 by binding to the proximal segment of the receptor C-terminal tail, J. Biol. Chem. 280 (2005) 8208–8220. [14] A. Di Cola, C. Robinson, Large-scale translocation reversal within the thylakoid Tat system in vivo, J. Cell Biol. 171 (2005) 281–289. [15] C. Sachse, J.Z. Chen, P.D. Coureux, M.E. Stroupe, M. Fändrich, N. Grigorieff, High-resolution electron microscopy of helical specimens: a fresh look at Tobacco mosaic virus, J. Mol. Biol. 371 (2007) 812–835. [16] B. Lu, F. Taraporewala, G. Stubbs, J.N. Culver, Intersubunit interactions allowing a carboxylate mutant coat protein to inhibit tobamovirus disassembly, Virology 244 (1998) 13–19. [17] J.N. Culver, Tobacco mosaic virus assembly and disassembly: determinants in pathogenicity and resistance, Annu. Rev. Phytopathol. 40 (2002) 287– 308. [18] A. Reinero, R.N. Beachy, Association of TMV coat protein with chloroplast membranes in virus-infected leaves, Plant Mol. Biol. 6 (1986) 291–301. [19] S. Balachandran, V.M. Hurry, S.E. Kelley, C.B. Osmond, S.A. Robinson, J. Rohozinski, G.G.R. Seaton, D.A. Sims, Concepts of plant biotic stress. Some insights into the stress physiology of virus-infected plants, from the perspective of photosynthesis, Physiol. Plant 100 (1997) 203–213. [20] R.A. Hodgson, R.N. Beachy, H.B. Pakrasi, Selective inhibition of photosystem II in spinach by Tobacco mosaic virus: an effect of the viral coat protein, FEBS Lett. 245 (1989) 267–270. [21] K. Lehto, M. Tikkanen, J.B. Hiriart, V. Paakkarinen, E.M. Aro, Depletion of the photosystem II core complex in mature tobacco leaves infected by the flavum strain of Tobacco mosaic virus, Mol. Plant Microbe Interact. 16 (2003) 1135– 1144. [22] A. Reinero, R.N. Beachy, Reduced photosystem II activity and accumulation of viral coat protein in chloroplasts of leaves infected with Tobacco mosaic virus, Plant Physiol. 89 (1989) 111–116. [23] N. Banerjee, J.Y. Wang, M. Zaitlin, A single nucleotide change in the coat protein gene of Tobacco mosaic virus is involved in the induction of severe chlorosis, Virology 207 (1995) 234–239.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Characterization of a specific interaction between IP-L, a tobacco protein localized in the thylakoid membranes, and Tomato mosaic virus coat protein Chaozheng Zhang a,1, Yueyong Liu a,1,2, Xianchao Sun b, Weidong Qian a, Dongdong Zhang c, Bingsheng Qiu a,* a
Center for Agricultural Biotechnology, Institute of Microbiology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing 100101, China Laboratory of Plant Virology, College of Plant Protection, Southwest University, Chongqing 400716, China c College of Life Science, Agricultural University of Hebei, Baoding 071001, China b
a r t i c l e
i n f o
Article history: Received 26 June 2008 Available online 14 July 2008
Keywords: Tomato mosaic virus Coat protein IP-L Thylakoid membrane Chlorosis
a b s t r a c t We previously demonstrated a specific interaction between Tomato mosaic virus (ToMV) coat protein (CP) and a tobacco protein designated IP-L that may be involved in the long-distance movement of ToMV. Here, using the yeast two-hybrid system and GST pull-down assay, we demonstrated that the N-terminal helical region (residues 3–18) of IP-L is required for the interaction, while two a-helical domains (residues 21–31 and 142–147) of ToMV CP are involved. Furthermore, using immunoblotting, we showed that both of the IP-L and the majority of ToMV CP are co-localized in the chloroplast thylakoid membranes. These results provide further evidence for the association between tobamovirus CPs and thylakoid membrane components, which has been shown to be involved in chlorosis formation during viral infection, and indicate that the interaction between ToMV CP and IP-L may affect chloroplast function and stability and thus leading to chlorosis. Ó 2008 Elsevier Inc. All rights reserved.
The ability of plant viruses to invade host plants and cause diseases is determined by molecular interactions between host and virus factors. These interactions directly affect virus replication, cell-to-cell movement, systemic movement, and symptom development, as well as the elicitation of host defense responses [1]. To date, many host factors have been identified to interact specifically with some viral gene products, including coat protein (CP), movement protein (MP) and replicase protein [2–6]. However, the explicit roles of these host factors and their interactions with virus factors in viral pathogenicity and host plant resistance remain to be investigated. Tomato mosaic virus (ToMV), a member of the Tobamovirus genus, has a positive-sense single-stranded RNA genome that encodes at least four proteins [7]. The 130- and 180-kDa replicase proteins are translated directly from the genomic RNA using the same first initiation codon, and the 180-kDa protein is synthesized by read-through of the amber termination codon of the 130-kDa protein gene. Although both the replicase proteins are involved in viral RNA replication, they exhibit different functions. The 180-kDa protein is necessary for viral RNA replication and performs the known functions associated with the replication,
whereas the 130-kDa protein appears to enhance the efficiency of the replication [8]. The 30-kDa MP and 17-kDa CP are translated from the respective subgenomic mRNAs, which are synthesized during the replication cycle. It has been shown that MP is essential for cell-to-cell movement [9], and CP mainly plays a role in longdistance movement of tobamoviruses in plants [10,11]. We previously identified a tobacco protein designated IP-L that interacts with ToMV CP using a Gal4-based yeast two-hybrid system [12]. The initial functional analysis of IP-L using virus-induced gene silencing (VIGS) showed that it may be involved in the longdistance movement of ToMV [12]. However, the molecular basis of the interaction between ToMV CP and IP-L, as well as the roles of the interaction in viral infection, is not well understood. In this study, we characterized the interaction between IP-L and ToMV CP, and identified the domains required for the interaction on both proteins using the yeast two-hybrid system and GST pull-down assay. Furthermore, we investigated the subcellular localization of IP-L using immunoblotting, and showed that IP-L is localized in the thylakoid membranes in tobacco leaf tissue, which suggests that its interaction with ToMV CP may be involved in chlorosis formation during viral infection. Materials and methods
* Corresponding author. Fax: +86 10 6480 7363. E-mail address: [email protected] (B. Qiu). 1 Both authors contributed equally to this work. 2 Present address: California Pacific Medical Center Research Institute, San Francisco, CA 94107, USA. 0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.07.010
Plants, virus source and cell lines. Nicotiana benthamiana was used as the host plant and grown on soil in growth chamber with 70% relative humidity and a 12-h light/12-h dark photoperiod at 22
254
C. Zhang et al. / Biochemical and Biophysical Research Communications 374 (2008) 253–257
to 26 °C. Leaves of 4-week-old plants were mechanically inoculated with ToMV and then harvested 7 days after inoculation. Escherichia coli strains DH5a and BL21 (DE3) (Novagen), kept in our laboratory, were used as a cloning strain and an expression strain, respectively. Saccharomyces cerevisiae strain AH109 (Clontech) was used in yeast two-hybrid assay to characterize the interaction between ToMV CP and IP-L. Chemicals. The polyclonal antisera against IP-L and ToMV CP were raised by injecting rabbits with IP-L and ToMV CP cleaved from purified GST-fusion proteins, respectively, according to the standard immunization protocol. HRP labeled goat anti-rabbit IgG was purchased from Amersham Biosciences. Other chemicals were purchased from either Sigma (St. Louis, MO) or TAKARA Shuzo (Otsu, Japan), unless otherwise noted. Plasmid constructs. The constructs used in the yeast two-hybrid assay were generated by inserting the deletion mutants derived from the IP-L or ToMV CP gene into vectors pGADT7 and pGBKT7 (Clontech). Polymerase chain reaction (PCR) was used to generate the deletion mutants that were flanked by appropriate restriction sites. Primers used for PCR are listed in Table 1. pGADT7-IP-L harboring the full-length IP-L gene and pGBKT7-ToCP harboring the entire ToMV CP gene were reported previously [12] and used as templates in PCR. DNA fragments encoding residues 1–52 (primers IP-L-F and IP-L-RDC103), 1-104 (primers IP-L-F and IP-L-RDC51), 20–155 (primers IP-L-FDN19 and IP-L-R), 36–155 (primers IP-LFDN35 and IP-L-R), 53–155 (primers IP-L-FDN52 and IP-L-R) and 105–155 (primers IP-L-FDN104 and IP-L-R) of IP-L, were amplified and cloned between the EcoRI and BamHI sites of pGADT7 to generate pGADT7-IP-LDC103, pGADT7-IP-LDC51, pGADT7-IP-LDN19, pGADT7-IP-LDN35, pGADT7-IP-LDN52, pGADT7-IP-LDN104. DNA fragments encoding residues 1–54 (primers CP-F and CPRDC105), 1–106 (primers CP-F and CP-RDC53), 1–137 (primers CP-F and CP-RDC22), 1–149 (primers CP-F and CP-RDC10), 16–54 (primers CP-FDN15 and CP-RDC105), 16–149 (primers CP-FDN15 and CP-RDC10), 16–159 (primers CP-FDN15 and CP-R), 32–54 (primers CP-FDN31 and CP-RDC105), 32–137 (primers CPFDN31and CP-RDC22), 32–159 (primers CP-FDN31 and CP-R), 55–106 (primers CP-FDN54 and CP-RDC53), 55–159 (primers CPFDN54 and CP-R), 107–137 (primers CP-FDN106 and CP-RDC22), 107–149 (primers CP-FDN106 and CP-RDC10) and 107–159 (primers CP-FDN106 and CP-R) of ToMV CP, were amplified and cloned into pGBKT7 to generate pGBKT7-CPDC105, pGBKT7-CPDC53, pGBKT7-CPDC22, pGBKT7-CPDC10, pGBKT7-CPDN15DC105, pGBKT7-CPDN15DC10, pGBKT7-CPDN15, pGBKT7-CPDN31D Table 1 Primers used for the construction of the IP-L and ToMV CP mutants a
Gene
Primer
Sequence (50 ? 30 )
IP-L
IP-L-F IP-L-FDN19 IP-L-FDN35 IP-L-FDN52 IP-L-FDN104 IP-L-RDC51 IP-L-RDC103 IP-L-R
GGCGAATTCATGGTTCTCCAAACTCAA GAGAATTCAACTACTATTCCGATAGTAGC GAGAATTCCCTTCGGGCTATTCCACCAT GCAGAATTCATGATGGGTCATGGTGGC GCCGAATTCGGCTATGGTAGTGGAATG AGCGGATCCACCATCACTATGGATCATAC GAAGGATCCCATGTGATTGTGAGTGGAC GTCGGATCCTTATTCCTCCAAATCCTTA
CP-F CP-FDN15 CP-FDN31 CP-FDN54 CP-FDN106 CP-RDC10 CP-RDC22 CP-RDC105 CP-RDC53 CP-R
GCGAATTCATGTCTTACTCAATCACTTCTCC GCGAATTCTCTGTATGGGCTGACCCTAT GCGAATTCTTAGGTAACCAGTTTCAA GCGAATTCCCTTTCCCTCAGAGCACC GCGAATTCGAAACGTTAGATGCTACCCG TCGGATCCAGACATACTTTCAAAAGTATT GCGGATCCAGTACCTCTTACTAGTTCATT GAGGATCCTTTCCACACCTCGCTGAAC GCGGATCCAGCTGTTGTCGGACTCTGC GCGGATCCTTAAGATGCAGGTGCAGAG
The CP gene
a Restriction enzyme sites (EcoRI and BamHI) used for cloning were underlined. Primers were synthesized by Invitrogen.
C105, pGBKT7-CPDN31DC22, pGBKT7-CPDN31, pGBKT7CPDN54DC53, pGBKT7-CPDN54, pGBKT7-CPDN106DC22, pGBKT7CPDN106DC10 and pGBKT7-CPDN106, respectively. To obtain sufficient amounts of recombinant proteins for in vitro binding assays, the full-length IP-L and ToMV CP gene, excised from the plasmids pGEX-IP-L and pGEX-CP [12], were cloned between the EcoRI and XhoI sites of pET30a (+) vector (Novagen) to generate pET-IP-L and pET-ToMV-CP, respectively. The deletion mutants of IP-L gene were cut from the yeast two-hybrid constructs described above, and cloned between the EcoRI and XhoI sites of pGEX-6P-1 vector (Amersham Biosciences) in frame with the glutathione-S-transferase (GST) gene. Similarly, the mutants of ToMV CP gene were cloned between the EcoRI and SalI sites of pGEX-6P-1 vector. The sequences of all constructs were confirmed by DNA sequencing. Yeast two-hybrid assay and b-galactosidase assays. Yeast two-hybrid assay was carried out using the Matchmaker GAL4 Two-Hybrid System 3 (Clontech) according to the manufacturer’s protocols. S. cerevisiae strain AH109 was transformed with the yeast two-hybrid constructs described above using the small-scale lithium acetate (LiAc) method (Clontech), and subsequently plated on SD minimal medium lacking adenine, histidine, leucine and tryptophan (SD/-Ade/-His/-Leu/-Trp). The b-galactosidase colonylift filter assay using 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-gal) as a substrate was then carried out to assess the interactions according to the manufacturer’s protocols (Clontech). GST pull-down assay. His-tagged ToMV CP and IP-L were expressed and then purified by Nickel-affinity chromatography according to the instructions of the manufacturer (Novagen), respectively. The deletion mutants of ToMV CP and IP-L, fused to GST, were expressed and purified using glutathione sepharose 4B affinity resin as described previously [12]. Concentrations of the purified proteins were determined using the BCA protein assay (Pierce Biochemicals). GST pull-down assay was performed as described previously [13]. Briefly, 1.5 lg of GST control and GST-fusion proteins were incubated with glutathione sepharose 4B beads for 1 h at 4 °C, respectively. The beads were washed to remove unbound proteins and then incubated with 1.5 lg of Histagged proteins for 3 h at 4 °C. After extensive washing, bound proteins were eluted by boiling in SDS sample buffer and analyzed by immunoblotting using rabbit anti-His-tag Polyclonal antibody and HRP labeled goat anti-rabbit IgG as the primary and secondary antibodies, respectively. Chloroplast isolation and fractionation, and immunoblotting. Chloroplasts, isolated from healthy and systemically infected tobacco leaves, were subfractionated as described previously [14]. Intact thylakoids were further fractionated by sonication on ice. The thylakoid membranes were separated from the lumen extract by ultracentrifugation and resuspended in 10 mM Hepes–KOH (pH 8.0). Proteins in each fraction were subsequently analyzed by immunoblotting using rabbit anti-serum against IP-L and ToMV CP, respectively. Results and discussion The N-terminal helical region of IP-L is required for its interaction with ToMV CP To identify the regions of IP-L that mediate its interaction with ToMV CP, four IP-L deletion mutants (IP-LDN52, IP-LDN104, IPLDC51 and IP-LDC103) were constructed and analyzed with the yeast two-hybrid system. In addition to the full-length IP-L, mutants IP-LDC51 and IP-LDC103 were able to interact with ToMV CP, whereas the other two mutants IP-LDN52 and IP-LDN104 lacking 52 and 104 amino acids (aa) from the N terminus, respectively, abolished their interaction (Fig. 1A). This indicated that the N-terminal 52 aa of IP-L are sufficient for the interaction.
C. Zhang et al. / Biochemical and Biophysical Research Communications 374 (2008) 253–257
Fig. 1. Mapping of IP-L domains involved in the interaction with Tomato mosaic virus (ToMV) coat protein (CP) with the yeast two-hybrid system (A) and GST pulldown assay (B). Saccharomyces cerevisiae strain AH109 was cotransformed with the yeast two-hybrid constructs encoding ToMV CP fused to GAL4BD and IP-L or IP-L deletion mutants fused to GAL4AD. The resulting transformants were tested for bgalactosidase activity by using the b-galactosidase colony-lift filter assay. The GST pull-down assay was performed to confirm the results of the yeast two-hybrid assay. Purified His-tagged ToMV CP was incubated with IP-L or IP-L deletion mutants fused to GST or with GST alone, immobilized on glutathione sepharose 4B beads. After washing bound proteins were detected by immunoblotting using rabbit anti-His-tag Polyclonal antibody.
Secondary structure prediction of IP-L by the hidden Markov model revealed the presence of an a-helical region (residues 3– 18) and a short b-sheet (residues 29–33) in its N-terminal 52-aa region (data not shown). To further identify the minimal region in the N-terminal domain of IP-L required for the interaction, two IP-L deletion mutants (IP-LDN35 and IP-LDN19) were constructed and analyzed. Neither of the two mutants could interact with ToMV CP (Fig. 1A), clearly indicating that the N-terminal helical region of IP-L is indispensable. These results were further confirmed in vitro using the GST pulldown assay. As shown in Fig. 1B, ToMV CP was able to interact with the full-length IP-L and two IP-L deletion mutants (GST-IP-LDC51 and GST-IP-LDC103) but not with other IP-L fragments or GST alone. IP-L is a newly identified tobacco protein interacting with ToMV CP. Sequence analysis revealed that the amino acid sequence of IPL is identical to that of a putative elicitor responsible protein (GenBank Accession No. BAB13710) of tobacco (Nicotiana tabacum) and has 67.6% identity with the deduced amino acid sequence from the open reading frame (ORF) of a senescence-related cDNA (SENU1) (GenBank Accession No. Z75523) from tomato (Solanum lycopersicum) [12]. However, IP-L was shown to have no known functional domains based upon the bioinformatical analysis. Secondary structure prediction showed that IP-L contains two a-helical regions and a short b-sheet (data not shown). The N-terminal helical region (residues 3–18), required for the interaction with ToMV CP, is highly homologous to some domains within other proteins in GenBank according to the BLAST analysis (data not shown). Therefore, we propose that the N-terminal helical region probably represents a novel functional domain for IP-L, playing an important role in ToMV infection cycle as well as host plant resistance. Two a-helical domains of ToMV CP are involved in its interaction with IP-L To map the ToMV CP domains involved in the interaction with IP-L, five deletion mutants (CPDN54, CPDN54DC53, CPDN106,
255
CPDC53 and CPDC105) were constructed and analyzed. All mutants except CPDN54DC53 were able to bind to IP-L (Fig. 2A), suggesting that both the N-terminal 54 aa and the C-terminal 53 aa of ToMV CP contain domains involved in the interaction, while its middle region (residues 55–106) is dispensable for the interaction. Structural analysis showed that three a-helices, Helix N (residues 7–13), Helix LS (residues 20–31) and Helix RS (residues 37– 50), were present in the N-terminal 54-aa region of tobacco mosaic virus (TMV) CP, whereas two a-helices, Helix LR (residues 107– 134) and Helix C (residues 141–146), were found in the C-terminal 53-aa region [15]. Considering the structural similarity between TMV CP and ToMV CP, we further constructed 10 deletion mutants (CPDN15, CPDN15DC10, CPDN15DC105, CPDN31, CPDN31DC22, CPDN31DC105, CPDC10, CPDN106DC10, CPDC22 and CPDN106DC22) to determine whether these a-helical domains of ToMV CP are responsible for its interaction with IP-L. As shown in Fig. 2A, CPDN15, CPDN15DC10, CPDN15DC105, CPDC10 and CPDN106DC10 were able to bind to IP-L, suggesting that the deletions of both the N-terminal 15 aa and C-terminal 10 aa of ToMV CP do not abolish their interactions. In addition, two mutants (CPDN31 and CPDC22) lacking the N-terminal 31 aa and C-terminal 22 aa of ToMV CP respectively, retained the binding ability, while three other mutants (CPDN31DC105, CPDN106DC22 and CPDN31DC22) lost the ability (Fig. 2A). These results clearly indicate that the two a-helical domains (residues 21–31 and 142– 147) of ToMV CP are involved in the interaction with IP-L. The conclusion was also supported by the in vitro GST pulldown assay, in which all of the ToMV CP deletion mutants, except GST-CPDN54DC53, GST-CPDN31DC105, GST-CPDN106DC22 and GST-CPDN31DC22, retained their ability to interact with IP-L (Fig. 2B). The tertiary structure of the tobamovirus CP consists of an antiparallel four-helix-bundle (Helix LS, RS, RR and LR) at central radius and two peripheral helices (Helix N and C) at higher radius connected via a short anti-parallel b-sheet [15]. Interactions at central radius are known to stabilize the packing between adjacent subunits and facilitate virion assembly [15,16]. The two a-helical domains (residues 21–31 and 142–147) of ToMV CP involved in the interaction with IP-L correspond to the central Helix LS and the peripheral Helix C in this study. The interaction between IP-L and ToMV CP, therefore, may alter the three-dimensional structure and even the assembly of ToMV CP by affecting the interaction between the adjacent CP subunits. A previous study showed that both the structure and the assembly of tobamovirus CP function as the determinants in the induction of disease and resistance responses [17]. Similarly, it is reasonable that the interaction between ToMV CP and IP-L may be one of the determinants in virus–host interactions. IP-L is localized in the thylakoid membranes in tobacco leaf tissue To explore the potential function of IP-L, its subcellular localization was investigated by immunoblotting using rabbit anti-serum against IP-L. Since the expression of IP-L was increased remarkably in the leaves of N. benthamiana infected with ToMV at 7 days post infection (dpi) as shown by previous study [12], systemically infected leaves were collected at 7 dpi and used for chloroplast isolation. Initially, using immunogold labeling (IGL), we demonstrated that IP-L is localized in the chloroplasts of both healthy and systemically infected tobacco plants, and the expression of IP-L in healthy plants is lower than that in infected plants, as shown by obviously lower number of gold particles observed in healthy plants compared to in infected plants (data not shown). To further determine the subcellular localization of IP-L, chloroplasts isolated from both healthy and systemically infected plants were fraction-
256
C. Zhang et al. / Biochemical and Biophysical Research Communications 374 (2008) 253–257
Fig. 2. Mapping of the IP-L-interacting domains of Tomato mosaic virus (ToMV) coat protein (CP) with the yeast two-hybrid system (A) and GST pull-down assay (B). Saccharomyces cerevisiae strain AH109 was cotransformed with the yeast two-hybrid constructs encoding IP-L fused to GAL4AD and ToMV CP or ToMV CP deletion mutants fused to GAL4BD. The resulting transformants were tested for b-galactosidase activity by using the b-galactosidase colony-lift filter assay. The GST pull-down assay was performed to confirm the results of the yeast two-hybrid assay. Purified His-tagged IP-L was incubated with ToMV CP or ToMV CP deletion mutants fused to GST or with GST alone, immobilized on glutathione sepharose 4B beads. After washing bound proteins were detected by immunoblotting using rabbit anti-His-tag Polyclonal antibody.
ated, and proteins of the stroma, thylakoid membrane and thylakoid lumen fractions were then analyzed by immunoblotting. As shown in Fig. 3A, in both healthy and infected plants, IP-L was exclusively localized in the thylakoid membranes, with no traces detectable in the stroma and thylakoid lumen. Also, we found that the concentration of IP-L in healthy plants is much lower than that in infected plants (Fig. 3), which is consistent with the IGL result and confirms the previous conclusion that expression of IP-L can
Fig. 3. Subcellular localization of IP-L and ToMV CP in tobacco chloroplast. Intact tobacco chloroplasts, isolated from healthy and systemically infected plants, were separated into stroma, thylakoid membrane and thylakoid lumen fractions. Proteins in each fraction were then analyzed by immunoblotting using rabbit anti-serum against IP-L and ToMV CP, respectively. S, stroma fraction; M, thylakoid membrane fraction; L, thylakoid lumen fraction.
be enhanced by ToMV infection [12]. These results also suggest that IP-L may be involved in some functions of thylakoid such as photosynthesis, electron transport and ATP synthesis. A previous study has revealed the presence of two pools of TMV CP in chloroplasts isolated from systemically infected leaves. The aggregated CP molecules were located in the stroma and the free CP molecules were associated with the thylakoid membranes [18]. To determine whether ToMV CP is associated with the thylakoid membranes, different fractions of chloroplasts isolated from systemically infected tobacco plants were analyzed by immunoblotting. Results showed that large amounts of ToMV CP were associated with the thylakoid membranes, while little CP was present in the stroma and thylakoid lumen (Fig. 3). Chlorosis in plants is a common symptom caused by many plant viruses upon systemic infection. The induction of chlorosis is mediated by a variety of different virus-induced physiological disturbances and virus–host interactions [19]. The chlorotic symptoms caused by different TMV strains or mutants are shown to be associated with the accumulation of the CP in the chloroplasts and the disruption of the photosystem II (PSII) complexes in the chloroplast thylakoid membranes [17,20–22]. There is also a positive correlation between the concentration of CP in chloroplasts and the severity of chlorosis, namely, chlorosis-inducing CPs have a greater propensity to accumulate in chloroplasts and thus have a greater ability to cause chlorosis [17,18,20–23]. These findings suggest that tobamovirus CPs can accumulate in chloroplasts of virus-infected leaves and cause chlorosis through their interactions with some cellular components, especially PSII complexes, in chloroplast thylakoid membranes. We have previously reported the
C. Zhang et al. / Biochemical and Biophysical Research Communications 374 (2008) 253–257
interaction between ToMV CP and IP-L [12]. We demonstrated here that both the IP-L and the majority of ToMV CP are co-localized in the chloroplast thylakoid membranes, providing further evidence for the association between tobamovirus CPs and thylakoid membranes during viral infection. Considering the relationship between the accumulation of CP and the inhibition of PSII activity together with the essential roles of the thylakoid membrane proteins in chloroplasts, IP-L probably plays a role in chloroplast function and stability, and the interaction between ToMV CP and IP-L may affect the chloroplast function and stability, and thus leading to chlorosis. Acknowledgments The authors thank Dr. Jian Liu (CPMC Research Institute) and Dr. Yaowei Huang (Virginia Polytechnic Institute and State University) for their critical reading of the manuscript. This work was supported by the National Natural Science Foundation of China (30570078). References [1] J.C. Carrington, S.A. Whitham, Viral invasion and host defense: strategies and counter-strategies, Curr. Opin. Plant Biol. 1 (1998) 336–341. [2] T.E. Abbink, J.R. Peart, T.N. Mos, D.C. Baulcombe, J.F. Bol, H.J. Linthorst, Silencing of a gene encoding a protein component of the oxygen-evolving complex of photosystem II enhances virus replication in plants, Virology 295 (2002) 307– 319. [3] Y. Hagiwara, K. Komoda, T. Yamanaka, A. Tamai, T. Meshi, R. Funada, T. Tsuchiya, S. Naito, M. Ishikawa, Subcellular localization of host and viral proteins associated with tobamovirus RNA replication, EMBO J. 22 (2003) 344– 353. [4] M. Heinlein, B.L. Epel, H.S. Padgett, R.N. Beachy, Interaction of tobamovirus movement proteins with the plant cytoskeleton, Science 270 (1995) 1983– 1985. [5] Y. Okinaka, K. Mise, T. Okuno, I. Furusawa, Characterization of a novel barley protein, HCP1, that interacts with the Brome mosaic virus coat protein, Mol. Plant Microbe Interact. 16 (2003) 352–359. [6] Y. Tsujimoto, T. Numaga, K. Ohshima, M.A. Yano, R. Ohsawa, D.B. Goto, S. Naito, M. Ishikawa, Arabidopsis TOBAMOVIRUS MULTIPLICATION (TOM) 2 locus encodes a transmembrane protein that interacts with TOM1, EMBO J. 22 (2003) 335–343.
257
[7] P. Goelet, G.P. Lomonossoff, P.J. Butler, M.E. Akam, M.J. Gait, J. Karn, Nucleotide sequence of Tobacco mosaic virus RNA, Proc. Natl. Acad. Sci. USA 79 (1982) 5818–5822. [8] D.J. Lewandowski, W.O. Dawson, Functions of the 126- and 183-kDa proteins of Tobacco mosaic virus, Virology 271 (2000) 90–98. [9] C.M. Deom, M.J. Oliver, R.N. Beachy, The 30-kilodalton gene product of tobacco mosaic virus potentiates virus movement, Science 237 (1987) 389–394. [10] T. Saito, K. Yamanaka, Y. Okada, Long-distance movement and viral assembly of Tobacco mosaic virus mutants, Virology 176 (1990) 329–336. [11] M.E. Hilf, W.O. Dawson, The tobamovirus capsid protein functions as a hostspecific determinant of long-distance movement, Virology 193 (1993) 106– 114. [12] Y. Li, M.Y. Wu, H.H. Song, X. Hu, B.S. Qiu, Identification of a tobacco protein interacting with Tomato mosaic virus coat protein and facilitating longdistance movement of virus, Arch. Virol. 150 (2005) 1993–2008. [13] H. Murdoch, G.J. Feng, D. Bächner, L. Ormiston, J.H. White, D. Richter, G. Milligan, Periplakin interferes with G protein activation by the melaninconcentrating hormone receptor-1 by binding to the proximal segment of the receptor C-terminal tail, J. Biol. Chem. 280 (2005) 8208–8220. [14] A. Di Cola, C. Robinson, Large-scale translocation reversal within the thylakoid Tat system in vivo, J. Cell Biol. 171 (2005) 281–289. [15] C. Sachse, J.Z. Chen, P.D. Coureux, M.E. Stroupe, M. Fändrich, N. Grigorieff, High-resolution electron microscopy of helical specimens: a fresh look at Tobacco mosaic virus, J. Mol. Biol. 371 (2007) 812–835. [16] B. Lu, F. Taraporewala, G. Stubbs, J.N. Culver, Intersubunit interactions allowing a carboxylate mutant coat protein to inhibit tobamovirus disassembly, Virology 244 (1998) 13–19. [17] J.N. Culver, Tobacco mosaic virus assembly and disassembly: determinants in pathogenicity and resistance, Annu. Rev. Phytopathol. 40 (2002) 287– 308. [18] A. Reinero, R.N. Beachy, Association of TMV coat protein with chloroplast membranes in virus-infected leaves, Plant Mol. Biol. 6 (1986) 291–301. [19] S. Balachandran, V.M. Hurry, S.E. Kelley, C.B. Osmond, S.A. Robinson, J. Rohozinski, G.G.R. Seaton, D.A. Sims, Concepts of plant biotic stress. Some insights into the stress physiology of virus-infected plants, from the perspective of photosynthesis, Physiol. Plant 100 (1997) 203–213. [20] R.A. Hodgson, R.N. Beachy, H.B. Pakrasi, Selective inhibition of photosystem II in spinach by Tobacco mosaic virus: an effect of the viral coat protein, FEBS Lett. 245 (1989) 267–270. [21] K. Lehto, M. Tikkanen, J.B. Hiriart, V. Paakkarinen, E.M. Aro, Depletion of the photosystem II core complex in mature tobacco leaves infected by the flavum strain of Tobacco mosaic virus, Mol. Plant Microbe Interact. 16 (2003) 1135– 1144. [22] A. Reinero, R.N. Beachy, Reduced photosystem II activity and accumulation of viral coat protein in chloroplasts of leaves infected with Tobacco mosaic virus, Plant Physiol. 89 (1989) 111–116. [23] N. Banerjee, J.Y. Wang, M. Zaitlin, A single nucleotide change in the coat protein gene of Tobacco mosaic virus is involved in the induction of severe chlorosis, Virology 207 (1995) 234–239.