Characterization of pHeBE7, an IncFII-type virulence-resistance plasmid carrying blaCTX-M-98b, blaTEM-1, and rmtB genes, detected in Escherichia coli from a chicken isolate in China

Plasmid 92 (2017) 37–42

Contents lists available at ScienceDirect

Plasmid journal homepage: www.elsevier.com/locate/yplas

Characterization of pHeBE7, an IncFII-type virulence-resistance plasmid carrying blaCTX-M-98b, blaTEM-1, and rmtB genes, detected in Escherichia coli from a chicken isolate in China

MARK

Yan-Xian Yanga,1, Yong-Qiang Yanga,1, Chang-Wei Leia, Bi-Hui Liua, Wei Jianga, Hong-Ning Wanga, Maria Consuelo Gazitúab, An-Yun Zhanga,b,⁎ a College of Life Science, Sichuan University, Animal Disease Prevention and Food Safety Key Laboratory of Sichuan Province, Key Laboratory of Bio-resources and Ecoenvironment, Ministry of Education, “985 project” Science Innovative Platform for Resource and Environment Protection of Southwestern China, Chengdu, Sichuan, PR China b Department of Microbiology, The Ohio State University, Columbus, OH, USA

A R T I C L E I N F O

A B S T R A C T

Keywords: Escherichia coli Plasmid Whole genome sequencing Virulence-resistance CTX-M-98

Recently, a novel variant of the CTX-M enzyme, CTX-M-98, was detected in Escherichia coli isolates from food animals. However, few plasmids carrying blaCTX-M-98 have been fully characterized. In this study, we sequenced the complete pHeBE7 plasmid, an 86,015-bp plasmid that contains the blaCTX-M-98b, blaTEM-1, rmtB, and traT genes, using whole-genome sequencing. The backbone of pHeBE7 shows a high similarity (> 99%) to pMCNDM, which carries the blaNDM-1 gene, however its mosaic regions remain relatively unique among sequenced plasmids. We discovered that a typical ISEcp1-blaCTX-M-IS903 element in the mosaic region harbors the blaCTX-M98b gene. Conjugation and growth competition assays indicate that pHeBE7 can be easily transmitted and that it confers a limited fitness cost to the recipient cell. The genetic characterization of pHeBE7 may improve our knowledge of how antibiotic resistance disseminates in enterobacteria.

1. Introduction The growing prevalence of antimicrobial resistance is a significant threat to public health, and multidrug resistance (MDR) is now widely found in human pathogens. Aminoglycosides and third-generation cephalosporin antibiotics are generally used to treat infections caused by Gram-negative bacteria in the clinic. However, there has been an alarming rise in the amount of MDR bacteria found both in human and veterinary clinical isolates that are resistant to these antibiotics, a trend that profoundly compromises the efficacy of these drugs (Fair and Tor, 2014). In recent years, the blaCTX-M gene, one of the most common genes encoding extended-spectrum β-lactamase (ESBL), has been detected frequently across the globe (the so-called “CTX-M pandemic”) (Canton and Coque, 2006; Zhao and Hu, 2013). The blaCTX-M genes are usually located within mobile genetic elements (i.e. plasmids and transposons), and often co-exist with other antibiotic resistance genes, such as the 16S rRNA methylase gene rmtB, which facilitates their transferability and preservation among various hosts (Hou et al., 2012). Recently, a novel variant of the CTX-M enzyme, CTX-M-98, was

detected in E. coli isolates from food animals (e.g. ducks, geese, and pigs) in China (Rao et al., 2014; Zheng et al., 2012). Importantly, the blaCTX-M-98 gene was also found in E. coli strains isolated from patients and healthy individuals in Shandong and Guangzhou in China, respectively (Liu et al., 2015; Zhou et al., 2015). This indicates that this gene may be capable of transmission between human and food animals, which may be directly relevant to public health. In a previous study of ours, we identified a blaCTX-M-98b gene, which differed by only one nucleotide from the blaCTX-M-98 gene (T/C in the + 537 bp position), in 4 out of 281 E. coli strains isolated from diseased chickens (Yang et al., 2015). Other plasmid-borne resistance genes, including blaTEM-1 and rmtB, as well as the virulence gene traT, were also observed in the blaCTX-M-98b gene-positive strain. Herein, we sequenced a blaCTX-M-98b, blaTEM-1, rmtB, and traT gene-positive strain, E. coli HeB7, to better understand the genetic environments via analyzing host plasmid.

⁎ Corresponding author at: College of Life Science, Sichuan University, Animal Disease Prevention and Food Safety Key Laboratory of Sichuan Province, Key Laboratory of Bio-resources and Eco-environment, Ministry of Education, “985 project” Science Innovative Platform for Resource and Environment Protection of Southwestern China, Chengdu, Sichuan, PR China. E-mail address: [email protected] (A.-Y. Zhang). 1 These two authors contributed equally to this article.

http://dx.doi.org/10.1016/j.plasmid.2017.07.001 Received 10 April 2017; Received in revised form 2 July 2017; Accepted 5 July 2017 Available online 06 July 2017 0147-619X/ © 2017 Elsevier Inc. All rights reserved.

Plasmid 92 (2017) 37–42

Y.-X. Yang et al.

Table 1 Primers used to amplify the region of gaps. Primer

Nucleotide sequence (5′ → 3′)

Fragment size (bp)

Annealing temperature (°C)

Position (nt)

1-F 1-R 2-F 2-R 3-F 3-R 4-F 4-R

CGTGGCTCAAAGGCAATACG TTTTCAGGCAATACGCACGC ATTCCCTGGGACGAGTTCAC AGCAGCAACGTCCTGTCTTT GAGGAGCACTACACCGACAC TGAGCAAAATCCAGGCTGCT CGGCACGTTTGCTTATACCG GTTTGTCACGCCAGGTTTCC

1248

60

770

58

1107

60

1071

60

11,993–12,012 13,241–13,222 16,931–16,950 17,720–17,701 18,110–18,129 19,236–19,217 33,857–33,876 34,947–34,928

2. Materials and methods

MHB following the Clinical and Laboratory Standards Institute (CLSI) guidelines (CLSI. Clinical and Laboratory Standards Institute, 2013). Seven antibiotics were tested: cefotaxime, amikacin, gentamicin, ciprofloxacin, norfloxacin, florfenicol, and imipenem. E. coli ATCC25922 (purchased from ATCC) was used as a quality control strain to check antibiotic quality and accuracy of the testing procedure.

2.1. Bacterial strain and sequencing E. coli HeB7 was isolated from the liver of an unhealthy chicken with typical symptoms of colibacillosis in Hebei Province in 2014. This strain shows an MDR phenotype; it was resistant to most of the antimicrobial agents we tested, including ampicillin, ceftriaxone, ceftazidime, gentamicin, amikacin, neomycin, ciprofloxacin, levofloxacin, norfloxacin, florfenicol, and doxycycline. The blaCTX-M-98b, blaTEM-1, rmtB, and traT genes were found in this MDR isolate (Yang et al., 2015). Whole-genome sequencing was employed to obtain the complete genome sequence of this strain. Briefly, the genomic DNA of E. coli HeB7 was extracted using a Qiagen genome kit (Qiagen, Hilden, Germany) and sequencing was performed on Illumina MiSeq using a 300-bp paired-end library (Majorbio, Shanghai, China). Sequencing reads from the plasmid were assembled into four contigs using the GS de novo assembler and v2.8. Gaps were closed by crossover PCR (Table 1). The sequences were analyzed with the DNA Lasergene (DNASTAR, Madison, WI) and Basic Local Alignment Search Tool (BLAST:http://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.5. Genetic stability, growth curve, and growth competition experiments Genetic stability tests, growth curve measurements, and growth competition experiments were conducted according to previously described methods (San Millan et al., 2010; Xu et al., 2015). Growth curves of tested strains were explored by detecting the optical density at 600 nm (OD600) every two hours for 26 h. Growth rates were determined by mathematical regression of the natural logarithm of population density (N) versus time (t), using only those time points when the population density increased exponentially (between optical density values at 600 nm of 0.1 and 0.2): μ = [ln(Nt) − ln(N0)]/(t − t0). Relative growth rates were calculated as the ratio of the growth rate of the transconjugant E. coli J53 + pHeBE7 strain versus recipient E. coli J53 strain. Fitness cost was also determined in competition experiments between E. coli J53 and E. coli J53 + pHeBE7. Cultures were mixed at volumetric ratio of 1:1, and the mixed culture was transferred into fresh broth every 10 generations over 5 to 14 cycles. In every cycle, the total number of viable cells was determined by plating cell cultures onto nonselective MH medium plates. The plates containing cefotaxime (4 μg/ mL) and amikacin (32 μg/mL) were used for quantification of the resistant cells. Relative fitness was expressed as the competition index (CI), calculated as the ratio of the mean CFU in two independent competition experiments between the resistant and susceptible strains at t1 divided by the same ratio at t0. We also calculated the selection coefficient (S) from the competition experiment. The selection coefficient estimates the difference between the relative fitness of the two competitors over the entire competition experiment. S is calculated as the slope of the linear regression model, ln(CI)/ln(d), where d is the dilution factor.

2.2. Conjugation experiments The transferability of this plasmid was investigated through a mating assay. E. coli HeB7 was used as the donor and E. coli J53Azr as the recipient, according to a previously published protocol (Poirel et al., 2010). Transconjugants were selected on MH agar plates containing cefotaxime (4 μg/mL), amikacin (32 μg/mL), and sodium azide (100 μg/mL). Positive transconjugants were further confirmed by detection of antimicrobial resistance profiles and screening for the presence of the blaCTX-M-98b, blaTEM-1, and rmtB genes. 2.3. Pulsed-field gel electrophoresis We analyzed the plasmid DNA of E. coli HeB7 by performing pulsedfield gel electrophoresis with nuclease S1 (S1-PFGE) (TaKaRa, Otsu, Japan), as previously described (Barton et al., 1995). Salmonella Braenderup H9812 was originally purchased from ATCC, maintained in our laboratory, and used as a size marker in this study. Electrophoresis was performed with a CHEF-DR III System (Bio-Rad Laboratories, Hercules, CA) using 1% agarose in 0.5 × Tris-borate-EDTA (TBE) at 180 V. Running conditions were as below: temperature 14 °C; voltage 6 V/cm; pulse angle 120°; and pulse duration of 5–35 s for 20 h. The PFGE profiles were analyzed using BioNumerics version 7.6 (Applied Maths, Sint-Martens-Latem, Belgium).

3. Results and discussion 3.1. General features of plasmid pHeBE7 The complete sequence of the blaCTX-M-98b-containing plasmid, named pHeBE7, was characterized and assembled in this study. pHeBE7 is an 86,015-bp plasmid with 84 open reading frames (ORFs) (Fig. 1) and is a IncFII-type plasmid (Plasmid Finder 1.3). This plasmid can be divided into a ~67.2-kb backbone structure and a ~18.8-kb mosaic region. BLASTn searches revealed that the sequences of pHeBE7 showed the highest similarity to pMC-NDM, an 87,619-bp plasmid carrying the blaNDM-1 gene, which was identified from patients in Poland (GenBank accession no. HG003695) (Fiett et al., 2014).

2.4. Antimicrobial susceptibility testing The minimum inhibitory concentrations (MICs) of antimicrobials for E. coli HeB7, E. coli J53Azr and the positive transconjugant E. coli J53 + pHeBE7 were carried out in 96-well microtiter plates using a standard two-fold broth micro-dilution of the antibacterial agents in 38

Plasmid 92 (2017) 37–42

Y.-X. Yang et al.

Fig. 1. Circular genetic map of pHeBE7. The innermost circle represents the three regions of pHeBE7: the olive section represents the mosaic region that includes antimicrobial resistance genes on mobile elements, the purple section indicates the coding region involved in plasmid stability, and the yellow section indicates the coding region involved in plasmid transfer. Sequence comparisons of pHeBE7 with other complete plasmids: pMC-NDM, HG003695; pGUE-NDM, Q364967; pKP96, EU195449; pC15-1a, AY458016; pXZ, JF927996. The map was drawn using BRIG (http://sourceforge.net/projects/brig/). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

backbone regions of pHeBE7 and pMC-NDM share the highest similarity (> 99%).

3.2. Characterization of the backbone region of pHeBE7 The backbone region of pHeBE7 contains replication origins (four ORFs of repA2, repA3, repA1, and repA4, totaling 2168 bp) and coding regions that are implicated in plasmid stability (17 ORFs; 13,869 bp) and plasmid transfer (33 ORFs; 31,961 bp). The pHeBE7 backbone region was most similar (99.9% nucleotide similarity) to the multidrugresistant plasmid pMC-NDM, with 16 single-nucleotide polymorphisms (SNPs), including a 9-bp deletion between 68,223 bp and 68,224 bp (Fiett et al., 2014) (Fig. 1). The backbone region of pHeBE7 was similar to some other multidrug-resistant plasmids, such as the blaNDM-1 genecarrying plasmid pGUE-NDM (99% identity) (GenBank accession no. Q364967) (Bonnin et al., 2012), the E. coli pC15-1a plasmid (95% identity) isolated from a patient in Canada (GenBank accession no. AY458016) (Boyd et al., 2004), and the E. coli pXZ plasmid (95% identity) isolated from a duck in China (GenBank accession no. JF927996) (Sun et al., 2012) (Fig. 1). All of these plasmids contain the tra-trb gene clusters, which are involved in plasmid transfer, and the parM-hok gene clusters, which are involved in plasmid stability. This indicates that these pHeBE7-like plasmids may have evolved from a common ancestor, which may have facilitated the dissemination of antibiotic resistance. Interestingly, we found a different number of tandem repeat rates of the sequence AACAGCCGC in the traD gene in pHeBE7 (9 repeats) compared to pMC-NDM (10 repeats), although the

3.3. Genes related to virulence The traT gene, which is associated with pathogenicity (Johnson and Stell, 2000; Shin and Ko, 2014), was found in the tra-trb gene clusters of pHeBE7. The TraT protein, which is an external outer membrane lipoprotein associated with plasmid conjugation, is also involved in bacterial virulence mechanisms, including serum resistance, phagocytosis, and biofilm formation (Beceiro et al., 2013). However, the traT gene was absent in some other plasmids carrying similar tra-trb gene clusters, such as the IncFII-type plasmid pKp11–42 in Klebsiella pneumoniae isolated from patients in Canada (GenBank accession no. KF295829) (Mataseje et al., 2014) and the E. coli IncA/C-type pSCEC2 plasmid isolated from swine in China (GenBank accession no. KF152885) (Zhang et al., 2014). Virulence-associated genes are located in mobile genetic elements, and therefore could easily facilitate the spread of virulence factors within bacterial communities. More detailed studies of the pHeBE7-like plasmids that contain antimicrobial resistance and virulence genes are needed in the future.

39

Plasmid 92 (2017) 37–42

Y.-X. Yang et al.

Fig. 2. Comparison of the mosaic regions of plasmids pHeBE7, pMC-NDM, and pKP96. Sections of plasmids showing similar structures and high sequence homology (> 99% identity) are indicated by frames shaded light gray. Antibiotic resistance genes and mobile elements are labeled in red and yellow, respectively. White arrows indicate the backbone regions of plasmids. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

blaCTX-M-IS903 element is flanked by truncated Tn1721. A right-inverted repeat (IRR) with a 5-bp direct duplication (CCTGG) is located upstream of ΔTn1721, and another IRR is present downstream. These events may indicate the occurrence of insertion and transposition in the region. pHeBE7 is similar to pMC-NDM, with the region of greatest homology covering almost the entire plasmid backbone, but with modification in several mosaic regions that contain antimicrobial resistance genes or mobile genetic elements. IS26-, ISEcp1-, and IS903associated transposition elements are linked to integration or recombination in mosaic regions. Therefore, pHeBE7 and pMC-NDM may have an ancestor in common and, over time, may have differentiated from each other by multiple mutation events. It is notable that various mobile elements harboring different resistance genes could assemble into the mosaic regions of pHeBE7-like plasmids, which may accelerate the spread of resistance between strains with different geographic origins.

3.4. Genetic structure of antimicrobial resistance genes The mosaic regions of pHeBE7, which shows new features compared to several other previously sequenced plasmids, consists of two specific transposon units that are associated with antimicrobial resistance. The first unit (1–7699 bp) consists of the blaTEM-1 and 16S rRNA methylase gene rmtB, and is encompassed by a Tn3 transposon and an IS26 element. BLASTn searches revealed that a similar structure was found in two other IncFII-type plasmids, pMC-NDM and pXZ (Fiett et al., 2014; Sun et al., 2012). Furthermore, this first unit in pHeBE7 is completely identical to pMC-NDM (100% nucleotide similarity) (Fig. 2), but differs from the pXZ plasmid in that the blaTEM-1 and rmtB genes are flanked by IS1294 and IS26. However, the remaining parts of the mosaic region (9662–18,870 bp) are similar to the pKP96 plasmid from Klebsiella pneumoniae (GenBank accession no. EU195449) (Shen et al., 2008) (Fig. 2). Unlike pMC-NDM, which has a ~ 13.6-kb fragment that contains the genes blaNDM, bleMBL, and sul1, pHeBE7 and pKP96 carry a ~ 9.2-kb-long segment containing an ISEcp1-blaCTX-M-IS903 element. In pHeBE7, the typical ISEcp1-blaCTX-M-IS903 transposition unit harbors the blaCTX-M-98b gene (Fig. 2), and shows great genetic diversity compared to other plasmids, due to the presence of different resistance genes, such as blaCTX-M-14, blaCTX-M-16, blaCTX-M-24, blaCTX-M-27, blaCTX-M54, and blaCTX-M-65 (Shen et al., 2008; Zhao and Hu, 2013). The blaCTX-M98b gene was lately identified in chicken-derived E. coli isolated from duck and goose in China (Rao et al., 2014). In pHeBE7, the ISEcp1-

3.5. Characterization of the transferability of pHeBE7 Transconjugants were obtained with high transfer rates (~ 2 × 10− 4 events per donor cell). Only one plasmid was found in E. coli HeB7 by S1-PFGE. The size of the plasmid found in the positive transconjugants corresponded to the sequencing results of pHeBE7. Compared to E. coli J53Azr, the transconjugant E. coli J53 + pHeBE7 exhibited a MIC for cefotaxime (> 256 μg/mL) that was at least 512-

Table 2 Susceptibility of the E. coli HeB7 isolate, E. coli J53 + pHeBE7 and E. coli J53Azr strains to antibiotics. Strain

E. coli HeB7 E. coli J53 + pHeBE7 E. coli J53Azr

MIC (μg/mL) CTX

AMK

GEN

CIP

NOR

FFC

IPM

> 256 > 256 < 0.5

> 256 > 256 < 0.5

> 512 > 512 0.5

> 128 < 0.25 < 0.25

> 128 < 0.25 < 0.25

> 128 0.5 0.5

< 0.25 < 0.25 < 0.25

Abbreviations: CTX, cefotaxime; AMK, amikacin; GEN, gentamicin; CIP, ciprofloxacin; NOR, norfloxacin; FFC, florfenicol; IPM, imipenem.

40

Plasmid 92 (2017) 37–42

Y.-X. Yang et al.

Fig. 3. Fitness cost of plasmid pHeBE7 in E. coli. (A) Comparison of the growth kinetics between strain E. coli J53 + pHeBE7 and E. coli J53 after 24 h of incubation. Growth curves represent as the mean ± SEM of three independent experiments. (B) Growth competition profile between E. coli J53 + pHeBE7 and E. coli J53. The initial ratio of bacteria was 1:1. The relative percentages of each strain are shown at different time points. Values are expressed as the mean ± SEM for three independent experiments. (C) The selection coefficient (S) was calculated from the competition experiment. S is the slope of the linear regression model, ln(CI)/ln(d), where CI is the ratio between the CFU counts of the resistant and susceptible populations at t1 divided by the same ratio at t0, and d is the dilution factor.

fold higher and 512-fold higher MIC for amikacin (> 256 μg/mL) (Table 2).

References Barton, B.M., Harding, G.P., Zuccarelli, A.J., 1995. A general method for detecting and sizing large plasmids. Anal. Biochem. 226, 235–240. Beceiro, A., Tomas, M., Bou, G., 2013. Antimicrobial resistance and virulence: a successful or deleterious association in the bacterial world? Clin. Microbiol. Rev. 26, 185–230. Bonnin, R.A., Poirel, L., Carattoli, A., Nordmann, P., 2012. Characterization of an IncFII plasmid encoding NDM-1 from Escherichia coli ST131. PLoS One 7, e34752. Boyd, D.A., Tyler, S., Christianson, S., McGeer, A., Muller, M.P., Willey, B.M., Bryce, E., Gardam, M., Nordmann, P., Mulvey, M.R., 2004. Complete nucleotide sequence of a 92-kilobase plasmid harboring the CTX-M-15 extended-spectrum beta-lactamase involved in an outbreak in long-term-care facilities in Toronto, Canada. Antimicrob. Agents Chemother. 48, 3758–3764. Canton, R., Coque, T.M., 2006. The CTX-M beta-lactamase pandemic. Curr. Opin. Microbiol. 9, 466–475. CLSI. Clinical and Laboratory Standards Institute, 2013. Performance Standards for Antimicrobial Susceptibility Testing; 23rd Informational Supplement. M100-S23. CLSI, Wayne, PA. Fair, R.J., Tor, Y., 2014. Antibiotics and bacterial resistance in the 21st century. Perspectives in Medicinal Chemistry 6, 25–64. Fiett, J., Baraniak, A., Izdebski, R., Sitkiewicz, I., Zabicka, D., Meler, A., Filczak, K., Hryniewicz, W., Gniadkowski, M., 2014. The first NDM metallo-beta-lactamaseproducing Enterobacteriaceae isolate in Poland: evolution of IncFII-type plasmids carrying the blaNDM-1 gene. Antimicrob. Agents Chemother. 58, 1203–1207. Hou, J., Huang, X., Deng, Y., He, L., Yang, T., Zeng, Z., Chen, Z., Liu, J.H., 2012. Dissemination of the fosfomycin resistance gene fosA3 with CTX-M beta-lactamase genes and rmtB carried on IncFII plasmids among Escherichia coli isolates from pets in China. Antimicrob. Agents Chemother. 56, 2135–2138. Johnson, J.R., Stell, A.L., 2000. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J. Infect. Dis. 181, 261–272. Liu, H., Wang, Y., Wang, G., Xing, Q., Shao, L., Dong, X., Sai, L., Liu, Y., Ma, L., 2015. The prevalence of Escherichia coli strains with extended spectrum beta-lactamases isolated in China. Front. Microbiol. 6, 335. Mataseje, L.F., Boyd, D.A., Lefebvre, B., Bryce, E., Embree, J., Gravel, D., Katz, K., Kibsey, P., Kuhn, M., Langley, J., Mitchell, R., Roscoe, D., Simor, A., Taylor, G., Thomas, E., Turgeon, N., Mulvey, M.R., 2014. Canadian Nosocomial infeCtion Surveillance P. complete sequences of a novel blaNDM-1-harbouring plasmid from Providenciarettgeri and an FII-type plasmid from Klebsiella pneumoniae identified in Canada. J. Antimicrob. Chemother. 69, 637–642. Poirel, L., Lagrutta, E., Taylor, P., Pham, J., Nordmann, P., 2010. Emergence of metallobeta-lactamase NDM-1-producing multidrug-resistant Escherichia coli in Australia. Antimicrob. Agents Chemother. 54, 4914–4916. Rao, L., Lv, L., Zeng, Z., Chen, S., He, D., Chen, X., Wu, C., Wang, Y., Yang, T., Wu, P., Liu, Y., Liu, J.H., 2014. Increasing prevalence of extended-spectrum cephalosporin-resistant Escherichia coli in food animals and the diversity of CTX-M genotypes during 2003–2012. Vet. Microbiol. 172, 534–541. San Millan, A., Garcia-Cobos, S., Escudero, J.A., Hidalgo, L., Gutierrez, B., Carrilero, L., Campos, J., Gonzalez-Zorn, B., 2010. Haemophilusinfluenzae clinical isolates with plasmid pB1000 bearing blaROB-1: fitness cost and interspecies dissemination. Antimicrob. Agents Chemother. 54, 1506–1511. Shen, P., Jiang, Y., Zhou, Z., Zhang, J., Yu, Y., Li, L., 2008. Complete nucleotide sequence of pKP96, a 67,850 bp multiresistance plasmid encoding qnrA1, aac(6′)-Ib-cr and blaCTX-M-24 from Klebsiella pneumoniae. J. Antimicrob. Chemother. 62, 1252–1256. Shin, J., Ko, K.S., 2014. Comparative study of genotype and virulence in CTX-M-producing and non-extended-spectrum-beta-lactamase-producing Klebsiella pneumoniae isolates. Antimicrob. Agents Chemother. 58, 2463–2467. Sun, H., Li, S., Xie, Z., Yang, F., Sun, Y., Zhu, Y., Zhao, X., Jiang, S., 2012. A novel multidrug resistance plasmid isolated from an Escherichia coli strain resistant to aminoglycosides. J. Antimicrob. Chemother. 67, 1635–1638. Xu, C.W., Zhang, A.Y., Yang, C.M., Pan, Y., Guan, Z.B., Lei, C.W., Peng, L.Y., Li, Q.Z., Wang, H.N., 2015. First report of macrolide resistance gene erm(T) harbored by a novel small plasmid from Erysipelothrix rhusiopathiae. Antimicrob. Agents Chemother.

3.6. Fitness cost of pHeBE7 The results of genetic stability tests showed that plasmid pHeBE7 remained in the host strain after 30 continuous passages across 15 days in the absence of selective pressure. The pHeBE7-transconjugants showed no significant difference in growth rate compared to E. coli J53Azr, indicating that this plasmid had no adverse effects on the growth of transconjugants. However, competition experiments revealed a low level of fitness cost for the transconjugants when grown together with E. coli J53Azr (Fig. 3), with a competitive disadvantage of ca. 5.5% per 10 generations relative to E. coli J53Azr. The genetic stability and transmission ability of pHeBE7 may increase the dissemination and persistence of resistance and virulence genes in enterobacteria. 4. Conclusions To our knowledge, this is the first fully sequenced plasmid carrying blaCTX-M-98. The pHeBE7-like plasmid has the potential to recombine and carry different resistance and virulence genes in its mosaic region. This might contribute to the dissemination of resistance and pathogenicity under various antimicrobial selection pressures. More importantly, pHeBE7-like plasmids shows ability to spread to geographically separated regions through human or food animal vectors, which will further exacerbate bacterial infections in clinics. Further studies to explore the transmission of pHeBE7-like plasmids to bacteria that infect humans and animals, and the environmental factors that impact transmission, are needed. Nucleotide sequence accession number The complete nucleotide sequence of pHeBE7 has been deposited to NCBI database (accession number KT00254). Acknowledgments This work was supported by the National Key Research and Development Program of China (2016YFD0501608), “973” National Basic Research Program of China (2013CB127200), Earmarked Fund for Modern Agro-industry Technology Research System (CARS-41-K09), the General Program of National Natural Science Foundation of China (31572547 and 31572548), and the outstanding young scholars of Sichuan University (GN2015SCU04A24). We are grateful to Minggui Wang, PhD, Huashan Hospital, Fudan University, for kindly providing the E. coli strain J53Azr. 41

Plasmid 92 (2017) 37–42

Y.-X. Yang et al.

beta-lactamases in gram-negative bacteria. Crit. Rev. Microbiol. 39, 79–101. Zheng, H., Zeng, Z., Chen, S., Liu, Y., Yao, Q., Deng, Y., Chen, X., Lv, L., Zhuo, C., Chen, Z., Liu, J.H., 2012. Prevalence and characterisation of CTX-M beta-lactamases amongst Escherichia coli isolates from healthy food animals in China. Int. J. Antimicrob. Agents 39, 305–310. Zhou, Y., Wu, X., Zhang, J., Tao, X., Deng, Z., Hu, Y., Li, M., Yang, X., Wang, M., Yang, Z., 2015. High prevalence of CTX-M beta-lactamases in Enterobacteriaceae from healthy individuals in Guangzhou, China. Microb. Drug Resist. 21, 398–403.

59, 2462–2465. Yang, Y., Zhang, A., Lei, C., Wang, H., Guan, Z., Xu, C., Liu, B., Zhang, D., Li, Q., Jiang, W., Pan, Y., Yang, C., 2015. Characteristics of plasmids coharboring 16S rRNA methylases, CTX-M, and virulence factors in Escherichia coli and Klebsiella pneumoniae isolates from chickens in China. Foodborne Pathog. Dis. 12, 873–880. Zhang, W.J., Xu, X.R., Schwarz, S., Wang, X.M., Dai, L., Zheng, H.J., Liu, S., 2014. Characterization of the IncA/C plasmid pSCEC2 from Escherichia coli of swine origin that harbours the multiresistance gene cfr. J. Antimicrob. Chemother. 69, 385–389. Zhao, W.H., Hu, Z.Q., 2013. Epidemiology and genetics of CTX-M extended-spectrum

42