- Email: [email protected]
Characterization of the consequence of a novel Glu-380 to Asp mutation by expression of functional P450c21 in Escherichia coli
Biochimica et Biophysica Acta 1430 (1999) 95^102
Characterization of the consequence of a novel Glu-380 to Asp mutation by expression of functional P450c21 in Escherichia coli Nai-Chi Hsu, Victor M. Guzov 1 , Li-Chung Hsu, Bon-chu Chung * Institute of Molecular Biology, Academia Sinica, Nankang, Taipei, Taiwan Received 11 September 1998; received in revised form 1 December 1998; accepted 2 December 1998
Abstract P450c21 catalyzes an important step in steroid synthesis. Its deficiency leads to symptoms of steroid imbalance. To obtain enough P450c21 for structure and function studies, we developed a method to express P450c21 in Escherichia coli. The 5Pregion of the human P450c21 cDNA was modified to ensure efficient translation and the C terminus of the protein was extended with four His residues for easy purification. Mutant proteins with substitutions at residues 172 and 281 exhibited decreased enzymatic activities similar to those found in mammalian cells. One new mutation changing Glu-380 to Asp (D380) caused 3-fold reduction in enzymatic activity. The amount of apoprotein production detected by immunoblotting and the affinity of the mutant protein towards substrate as measured by Km were normal. The defect lies in the decreased ability of the apoprotein to bind heme, which was measured by CO difference and substrate-binding spectra. The D380 mutant protein had 3-fold reduction in peak heights in both spectra. This reduced heme binding resulted in 3-fold lower enzymatic activity. ß 1999 Elsevier Science B.V. All rights reserved. Keywords: Steroidogenesis; Congenital adrenal hyperplasia; 21-Hydroxylase; Steroid secretion
1. Introduction Cytochromes P-450 (P-450s) are enzymes that catalyze steps in biosynthesis of physiologically signi¢cant substances (such as steroid hormones, fatty acids, prostaglandins, vitamin D) as well as steps in detoxi¢cation of xenobiotics. P450c21 catalyzes essential steps in biosynthesis of mineralocorticoids Abbreviations: 17-OHP, 17-hydroxyprogesterone; PCR, polymerase chain reaction * Corresponding author. Fax: +886 (2) 27826085; E-mail: [email protected] 1 Visiting postdoctoral fellow from the Institute of Bioorganic Chemistry, Academy of Sciences of Belarus, Minsk, Republic of Belarus.
(conversion of progesterone to deoxycorticosterone) and glucocorticoids (conversion of 17-hydroxyprogesterone to 11-deoxycortisol) in the endoplasmic reticulum of the adrenal cortex [1]. The inborn de¢ciency of P450c21 contributes to more than 90% cases of congenital adrenal hyperplasia, which is a common genetic disease occurring at a frequency of one in 15 000 [2]. The gene encoding P450c21 is termed CYP21A1. Besides it, there is a pseudogene called CYP21A1P. These two genes are more than 98% identical permitting frequent gene conversion events [3]. Ten major mutations in the coding region of the human CYP21A1 gene have been characterized [1,4]. These mutations are due to frequent gene conversion events changing the active CYP21A1 gene into its neighboring pseudogene CYP21A1P.
0167-4838 / 99 / $ ^ see front matter ß 1999 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 8 3 8 ( 9 8 ) 0 0 2 7 1 - 4
BBAPRO 35828 5-2-99
96
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
Gene conversion could account for about 95% of the mutations identi¢ed so far [5]. There are, however, other infrequent mutations which are not caused by apparent gene conversion [6]. A mutation changing Gly-380 into Asp, found in a patient su¡ering from the severe salt-wasting form of the disease, represents such a situation [7]. The naturally occurring missense mutations a¡ecting the function of P450c21 are convenient probes to study the structural requirements for P-450 functions. Among them, mutation at Ile-172 has been shown to result in a protein with altered conformation and lower catalytic activity [8], Val-281 mutation to lead to decreased heme-binding of the mutant protein [9], and mutation at Pro-30 to lead to reduced production of the protein [10]. A structural basis for the reactions carried out by these P-450s has not been established since the threedimensional structure of mammalian P-450s is unknown due to the di¤culties in obtaining large amounts of protein and the even more di¤cult task of membrane protein crystallization. To study the mutants an e¤cient heterologous expression system is needed. So far, P450c21 has been expressed in mammalian cells [11^13], yeast [14,15] and bacteria [16]. In yeast and mammalian cells P450c21 protein has been expressed as an active enzyme but at quantities not su¤cient for enzyme puri¢cation. In bacteria it was easily overexpressed but as an inactive protein in inclusion bodies [12]. We have developed a bacterial expression system which expressed active P450c21 [16]. In this report, we showed our attempt to purify P450c21 using a one-step procedure. This simple procedure enables further characterization of P450c21. We showed that the E380D mutant protein was produced at normal levels but had a slight structural change surrounding the heme-binding domain. This resulted in a change in its spectroscopic property and the reduced enzymatic activity. 2. Materials and methods 2.1. Plasmid construction The construction of plasmids expressing P450c21 with slight 5P-modi¢cation was described before [16]. Four His codons were introduced into the C termi-
nus of P450c21 by PCR ampli¢cation of the region between the stop codon and upstream StuI unique restriction site, while introducing an XbaI site at the 3P-end using a 3P-end mutant oligo (CGGCTGGCATCGGTCTAGATCAATGATGATGATGCTGGCTCTGGCCCGG). The PCR product was digested with StuI-XbaI before replacing the corresponding 3P-fragment of pBC21-21mod. After sequence veri¢cation, the resulting plasmid pBC2121modHis was transformed into a Dam-de¢cient Escherichia coli strain GM119 because the XbaI site was Dam-methylated. The EcoRI-XbaI fragment of pBC21-21modHis was then cloned into the expression plasmid by replacing the corresponding fragment of the P450c21 cDNA to form pTacTacC2121modHis in a JM109 host. 2.2. Expression of P450c21 The procedure of P450c21 expression was described before [16]. Brie£y, 0.5 mM N-aminolevulinic acid was added to the cell culture at OD600 0.3^0.4 in TBS medium (24 g yeast extract, 12 g tryptone, 2 g peptone, 4 ml glycerol per liter), plus 0.017 M KH2 PO4 , 0.072 M K2 HPO4 , pH 7.4, 1 mM thiamine and 0.25 ml stock trace elements per liter medium (27 g FeCl3 6H2 O, 2 g ZnCl2 4H2 O, 2 g CoCl2 6 H2 O, 2 g Na2 MoO4 2 H2 O, 1 g CaCl2 2H2 O, 1 g CuCl2 , 0.5 g H3 BO3 and 100 ml concentrated HCl per liter) [17] growing at 37³C. When OD600 reached 0.6^0.8, expression of P450c21 was induced by 1 mM isopropyl-L-D-thiogalactoside at 20³C. N-Aminolevulinic acid (2 mM) was added again 45 min later and the cultures were further shaken at 20³C for 2 days. 2.3. Isolation of membranes from E. coli Cell pellets were resuspended (15 ml/g wet weight of cells) in cold TES bu¡er (100 mM Tris-acetate, pH 7.6, 500 mM sucrose, 0.5 mM EDTA, 0.1 mM dithiothreitol) before the sequential gradual addition of lysozyme to 0.5 mg/ml and an equal volume of cold 0.1 mM EDTA, pH 8.0, 0.1 mM dithiothreitol. Spheroplasts which formed by stirring for 30 min at 4³C were pelleted (8000Ug, 15 min) and resuspended (2 ml/g wet weight of cells) in cold KG bu¡er (50 mM K-phosphate, pH 7.4, 20% glycerol) containing 0.5 mM PMSF, 0.04 U/ml aprotinin and 0.1 Wg/ml
BBAPRO 35828 5-2-99
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
leupeptin. Upon sonication at an output of about 100 W using six 10 s pulses separated by 30 s breaks on ice, cell debris was removed at 8000Ug for 15 min and membranes were pelleted at 42 000 rpm in a 60 Ti rotor for 1.5 h. Final membrane preparation was resuspended (1:100 volume of the initial culture) in NG bu¡er (50 mM Na-phosphate bu¡er, pH 7.4, 20% glycerol) containing 0.1 mM PMSF and stored frozen at 370³C. 2.4. Puri¢cation of P450c21 Membranes in NG bu¡er were solubilized on ice with 1% Emulgen 913 (w/v) for 1 h at detergent/protein ratio (w/w) 3:1. Alternatively, E. coli spheroplasts were solubilized by the addition of 1% Emulgen 913 followed by sonication. Insoluble material was pelleted at 100 000Ug for 1.5 h and the supernatant was loaded onto His-Bind Resin (Novagen, Madison, WI, USA) equilibrated with bu¡er A (100 mM Na-phosphate bu¡er, pH 7.4, containing 20% glycerol, 100 mM NaCl). After washing of the column with 10 vols. bu¡er A containing 50 mM glycine and 0.2% Emulgen 913, the protein was eluted with 40 mM histidine and 0.5% Emulgen 913. Eluted P450c21 was dialyzed against 10 mM NG bu¡er containing 0.1% Emulgen 913 and stored frozen at 370³C. 2.5. Mutagenesis and cloning The E380D mutant was generated by a two-step PCR procedure [18]. Two sets of primers, E3P (nt 349^365, EXON 3, 17mer, sense, 5P-TGGAAAGCCCACAAGAA), D380AS (antisense, nt 1151^1134, 18mer, with E380D mutation, 5P-ACTGTGCCGTCAGGGATG), D380S (18mer, nt 1134^1151 with E380D mutation, sense, 5P-CATCCCTGACGGCACAGT), and E10.2 (exon 10, nt 1591^1575, 17mer, 5P-GAGGAAATAACGAGGGC, antisense), were used to amplify 803 and 457 bp DNA fragments encoding amino acids 116^383 and 377^494 separately. The PCR condition was 94³C, 3 min, 42³C, 1 min, 75³C 1 min for the ¢rst cycle and 94³C, 30 s, 42³C, 1 min, 75³C 1 min for 30 cycles followed by a 75³C 10 min reaction. The PCR products were eluted from the gel before serving as templates for the ampli¢cation of a 1242 bp DNA fragment encoding
97
amino acids 116^494 using the two end primers (E3P and E10.2). This DNA was digested with EcoRI-StuI to replace the EcoRI-StuI fragment of pTacTacC21-21modHis. The mutation was con¢rmed ¢rst by the loss of the MstII site at codon 380 and later by sequencing of the entire PCR product. For the construction of plasmids with mutations at positions 172 and 281, the yeast expression plasmids pYE-c21 with the respective mutations were used as parent plasmids. The EcoRI-StuI fragments harboring the mutations were released from parent plasmids and cloned into pTacTacC21-21modHis by replacement. 2.6. Analytical methods Immunoblotting was carried out according to standard procedures using antibodies speci¢c to human P450c21 [12] and chemiluminescence detection. CO di¡erence and substrate-binding spectra were recorded [19,20] using a Beckman DU 70 spectrophotometer. To test 21-hydroxylase activity in vivo, E. coli cells were cultured and induced as described above and ¢nally washed and resuspended essentially as described [21]. The reaction was initiated by the addition of 1 mM [14 C]17-OHP to the suspension of cells corresponding to 0.5^1 ml of culture. Following 0.5^1 h incubation at 37³C, steroids were extracted, resolved by thin layer chromatography and quanti¢ed using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA, USA). To study 21-hydroxylase activity in vitro, solubilized P450c21 was incubated with NADPH-cytochrome P-450 reductase (100 pmol), energy regenerating system (5 U/ml glucose 6-dehydrogenase, 720 mM glucose 6-phosphate, 0.5 mM NADPH), in 50 mM Na-phosphate bu¡er, pH 7.2, containing 1 mM MgCl2 at 37³C before separation of substrate and product by thin layer chromatography. 3. Results 3.1. Expression of P450c21 For protein expression in E. coli, secondary structures at the 5P-region of the cDNA often a¡ect translational e¤ciency [22]. Computer simulation indi-
BBAPRO 35828 5-2-99
98
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
Fig. 1. Modi¢ed nucleotide and amino acid sequences of human P450c21 at the (A) N and (B) C termini. The introduced mutations are underlined. The XbaI restriction site is shown by a double underline.
cated that the 5P-region of the human P450c21 cDNA had the potential to form secondary structures. Site-directed mutagenesis was performed to eliminate this secondary structure. Three plasmids were constructed to alleviate the potential problem (Fig. 1). Plasmid pTacC21mod has modi¢cation at the third nucleotide of the codon to minimize the potential secondary structure but retain the coding sequence. Plasmid pTacTacC21-21mod has substitutions at the second amino acid for Ala and the fourth for Leu, both of which have been implicated to be most important for protein expression [23]. In addition, we also added four His codons at the C terminus right before the stop codon to ensure easier puri¢cation with a¤nity chromatography (Fig. 1). All three plasmids were transformed into JM109 and the recombinant proteins expressed using our established procedure [16]. Recombinant proteins derived from all three plasmids had similar yield and kinetic properties. Since protein produced from pTacTacC2-21modHis is easier to purify using a nickel column, it was further characterized. Fig. 2 shows that the major protein band after nickel column chromatography was P450c21 based on Coomassie blue staining and reaction with anti-P450c21 antibody. Therefore, a simple one-step column chroTable 1 Kinetic parameters of P450c21-4His Substrate
Km (WM)
Vmax (nmol/minUnmol P450c21)
17-OHP Progesterone
0.73 þ 0.12 0.23 þ 0.14
70.6 þ 14.4 13.43 þ 1.33
Values are the average of three determinations for each substrate and presented as means þ S.D.
Fig. 2. Analysis of P450c21 by gel electrophoresis. E. coli cells harboring recombinant P450c21 were broken, solubilized, then passed through a nickel column. Proteins from the solubilized lysate (Sup, 3 Wg) and Ni column eluate (Ni, 0.6 Wg) were electrophoresed, then stained with Coomassie blue, or transferred to a membrane for antibody reaction. M stands for size marker.
matography achieved puri¢cation which is su¤cient for subsequent analysis. The P450c21 expressed from E. coli (Table 1) has similar Km and Vmax values as that expressed from yeast cells [14] or that puri¢ed directly from bovine adrenal [20,24], indicating that expression systems do not a¡ect the properties of the protein. 3.2. Function of mutant proteins expressed in E. coli To test whether this E. coli expression system is suitable for the functional study of mutant protein, we have generated plasmids which contain single substitution at positions 172 and 281. The Ile-172 to Asn and Val-281 to Leu mutations were found in the simple virilizing and non-classical forms of the 21-hydroxylase de¢ciency, respectively [25,26]. The plasmids for the expression of the mutant proteins were constructed and transformed into E. coli. As shown in Fig. 3, mutation at amino acid 172 was deleterious and the mutant proteins had around 1^ 5% activity, depending on the type of amino acids which replaced Ile. Mutation at Val-281, which is associated with the milder activity loss, was more tolerable. Mutant proteins had 4^40% residual activity (Fig. 3), also depending on the kind of amino acid which substituted Val-281. These activity data are
BBAPRO 35828 5-2-99
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
99
Table 2 Kinetic parameters of the wild type P450c21-His and its D380 mutant proteins isolated from E. coli Enzyme
Km (WM)
Activity (mol/hUWg protein)
WT-c21 D380
0.50 þ 0.35 0.47 þ 0.38
29.41 þ 10.12 8.70 þ 3.25
P450c21 proteins expressed from E. coli were solubilized by Emulgen before isolation. Enzymatic activities were determined from varying concentrations (0.08, 0.1, 0.12, 0.16, 0.18, 0.2, 0.3, 0.4, 1 WM) of substrate 17-hydroxyprogesterone to the reconstituted reaction mixture. Km /Vmax values were calculated using the double reciprocal plots. Values are the average of four determinations for each substrate and presented as means þ S.D.
consistent with our earlier studies expressing 172 and 281 mutant proteins in mammalian cells and yeast [9,12]. The amount of 281 mutant protein expressed in E. coli was detected by immunoblot analysis (Fig. 4A). It shows that all the 281 mutant proteins are produced at equal amounts, again con¢rming earlier results [9]. These results thus validate the use of E. coli in expression of P450c21 for functional studies. 3.3. Property of the E380D mutant protein A novel mutation of the CYP21A1 gene changing Glu-380 into Asp has been identi¢ed in a patient su¡ering from 21-hydroxylase de¢ciency [7]. To understand the role of this residue in the structure and function of the protein, a D380 mutant protein
Fig. 4. The amount of mutant proteins in the cell. (A) 281 mutant proteins. (B) D380 mutant protein. Equal amounts (20 Wg) of total proteins from E. coli strains harboring either wild type (WTc21) or the mutant cDNA were separated by gels and the P450c21 proteins were detected by antibody.
Fig. 3. Enzymatic activity of the mutant proteins. E. coli strains (1 ml) harboring plasmid expressing wild type or mutant proteins were grown to OD 0.1 when the substrate was added for the 21-hydroxylase activity test. The positions of the mutation of each protein are marked on the X-axis and the Y-axis represents relative 21-hydroxylase activity of each mutant.
was expressed from E. coli. The enzymatic activity was determined in vivo by adding radioactive substrate to the culture medium and measuring the amount of product formation. The bacterial strain harboring the D380 mutant plasmid had about 30% activity of strain containing the wild type P450c21. Therefore, this conservative substitution replacing Glu with Asp had a small but signi¢cant
BBAPRO 35828 5-2-99
100
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
e¡ect on the enzymatic activity of the protein. The amount of protein expression was measured by immunoblot analysis (Fig. 4B). About the same amount of the apoprotein was produced from the strains harboring the wild type P450c21 and the D380 mutant protein. Both membrane fractions and solubilized proteins were used for kinetic analysis (Table 2). The wild type and the D380 mutant proteins had similar Km values, but the D380 mutant protein had about 1/3 the Vmax value when equal amounts of proteins were used for the analysis. It indicated that the D380 mutant protein binds substrate normally, but the enzymatic activity is lower. The spectroscopic properties of the D380 mutant protein were examined. The CO di¡erence spectrum, which measures hemoprotein content, showed that the D380 mutant had about 1/3 of the heme content of the wild type protein (Fig. 5). The substrate-binding spectra of the D380 mutant protein, which measure the environment of the region around heme, were
Fig. 5. Spectroscopic properties of WT-c21 and the D380 mutant protein. Both CO di¡erence (A) and substrate-binding spectra (B) from membrane preparations of the E. coli harboring the WTc21 and the D380 mutant are shown. 17-OH-Progesterone (20 WM) was added to 1 ml of protein preparation (1 mg/ml protein) for spectroscopic measurement.
Fig. 6. Alignment of microsomal cytochromes P-450 at regions around residue 380. The amino acid residues are shown in oneletter code. The position corresponding to Glu-380 of the human P450c21 is boxed.
also decreased to 40% of wild type. Taken together, these data showed that the D380 mutant protein binds to heme at about 30^40% the wild type e¤ciency. 4. Discussion In this report, we showed our attempt to express and purify human P450c21 from E. coli. A one-step column chromatographic procedure was used to purify P450c21 quickly. Using this expression system, we analyzed a novel mutation of the CYP21A1 gene in congenital adrenal hyperplasia. The D380 mutation resulted in a 3-fold decrease in enzymatic activity and hemoprotein content, but a normal amount of apoprotein production. This is the ¢rst time this novel mutation has been characterized so extensively. The Glu-380 to Asp mutation was found in CYP21A1 gene from a patient su¡ering from the severe salt-wasting form of the disease [7]. This form of the disease usually correlated with zero enzymatic activity [5]. Our discovery of 30% activity from the D380 mutant protein does not correlate with the phenotypic presentation of the disease. Therefore, other mutations must be present in this patient. Since the entire coding region of the CYP21A1 gene has been characterized [7], one possibility is that the promoter or another region may have some yet unidenti¢ed mutations which can aggravate the disease presentation. To understand the involvement of the Glu-380 residue in the structure and function of P450c21, a comparison of the sequences of di¡erent P-450s around this residue was made (Fig. 6). Glu-380 is located in
BBAPRO 35828 5-2-99
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
a rather conserved region which enables sequence alignment easily. It is, however, not invariant. It could be either Glu or Lys as in mouse P450c21 and other hepatic P-450s. It appears that a charged residue with a long side chain may be required at this position. Asp is charged with a short side chain. It appears that this change could be tolerated somewhat so that the mutant protein retained about 30% activity. The major defect of the D380 mutant appears to be its decreased ability to bind heme. The ¢nal result is its lower hemoprotein content as measured by the decreased peak height in the CO di¡erence and substrate-binding spectra. The amount of apoprotein production in immunoblot analysis and the a¤nity of the mutant protein towards substrate as shown by its Km value were normal. Taking the lower amount of the hemoprotein content into account, then the 380D mutant had normal catalytic activity as long as it binds heme. Therefore, the 380D mutation did not appear to be located at the catalytic center of the protein. Its substitution a¡ected the ability of the protein to bind heme but not catalysis per se. Heterologous expression of P-450s in E. coli has been widely used for structure-function characterization. We were able to express P450c21 and measure its activity in E. coli without co-expressing NADPHdependent reductase. This result is similar to that observed for P450c17 expression [21], and reductase-like proteins have been characterized in E. coli [27]. High-level expression of fusion proteins containing the domains of mammalian cytochromes P-450 and NADPH-P-450 reductase £avoprotein has also been reported [28]. Therefore, there is a wide selection of expression systems for functional studies. Several P-450s were overexpressed in E. coli at high quantities (more than 200 nmol/l culture) as active proteins upon modi¢cation of the 5P-coding region of their cDNAs [29,30]. However, other proteins could not be expressed at such high levels even after the 5P-modi¢cation [31,32]. The expression level we achieved for human P450c21 was 40^50 nmol/l culture, which was not as high as some P-450s but was still much higher than the level found in the adrenal based on the enzymatic activity in vivo. Furthermore, higher yields of the protein can be obtained because the engineering of the His residues
101
at the C terminus ensures easy puri¢cation thus decreases loss during puri¢cation. Acknowledgements The authors would like to thank Meng-Chun Hu for constructing the pTacC21mod plasmid and JeouYuan Chen and Mei-Hui Hsu for helpful suggestions. This work was supported by Academia Sinica, National Science Council (Grant NSC84-2331-B001-002 M02) and National Health Research Institutes (Grant DOH87-HR-609), Republic of China.
References [1] B.-c. Chung, Adv. Mol. Cell Biol. 14 (1996) 199^219. [2] W.L. Miller, Y. Morel, Annu. Rev. Genet. 23 (1989) 371^ 393. [3] P.C. White, M.I. New, B. Dupont, Proc. Natl. Acad. Sci. USA 83 (1986) 5111^5115. [4] Y. Morel, W.L. Miller, Adv. Hum. Genet. 20 (1991) 1^68. [5] P.W. Speiser, J. Dupont, D. Zhu, M. Buegeleisen, M.-T. Tusie-Luna, M. Lesser, M.I. New, P.C. White, J. Clin. Invest. 90 (1992) 584^595. [6] H.-H. Lee, H.-T. Chao, Y.-J. Lee, S.-G. Shu, M.-C. Chao, J.-M. Kuo, B.-c. Chung, Hum. Genet. 103 (1998) 304^310. [7] L. Kirby-Keyser, C.C. Porter, P.A. Donohoue, Hum. Mut. 9 (1997) 181^182. [8] L.-C. Hsu, N.-C. Hsu, J.A. Guzova, V.M. Guzov, S.-F. Chang, B.-c. Chung, J. Biol. Chem. 271 (1996) 3306^3310. [9] D.-A. Wu, B.-c. Chung, J. Clin. Invest. 88 (1991) 519^523. [10] M.-C. Hu, L.-C. Hsu, N.-C. Hsu, B.-c. Chung, Biochem. J. 316 (1996) 325^329. [11] M. Ricketts, E. Chiao, M.C. Hu, B.c. Chung, Biochem. Biophys. Res. Commun. 186 (1992) 426^431. [12] M.-C. Hu, B.-c. Chung, Mol. Endocrinol. 4 (1990) 893^898. [13] M.-T. Tusie-Luna, P. Traktman, P.C. White, J. Biol. Chem. 265 (1990) 20916^20922. [14] D.-A. Wu, M.-C. Hu, B.-c. Chung, DNA Cell Biol. 10 (1991) 201^209. [15] T. Sakaki, M. Shibata, Y. Yabusaki, H. Murakami, H. Ohkawa, DNA Cell Biol. 9 (1990) 603^614. [16] B.-c. Chung, M.-C. Hu, V.M. Guzov, D.-A. Wu, Endocr. Res. 21 (1995) 343^352. [17] S. Bauer, J. Shiloach, Biotechnol. Bioeng. 16 (1974) 933^941. [18] S.N. Ho, H.D. Hunt, R.M. Horton, J.K. Pullen, L.R. Pease, Gene 77 (1989) 51^59. [19] T. Omura, R. Sato, J. Biol. Chem. 239 (1964) 2370^2378. [20] S. Kominami, H. Ochi, Y. Kobayashi, S. Takemori, J. Biol. Chem. 255 (1980) 3386^3394.
BBAPRO 35828 5-2-99
102
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
[21] H.J. Barnes, M.P. Arlotto, M.R. Waterman, Proc. Natl. Acad. Sci USA 88 (1991) 5597^5601. [22] B. Schauder, J.E. McCarthy, Gene 78 (1989) 59^72. [23] A.C. Looman, J. Bodlaender, L.J. Comstock, D. Eaton, P. Jhurani, H.A. de-Boer, P.H. van-Knippenberg, EMBO J. 6 (1987) 2489^2492. [24] A. Hiwatashi, Y. Ichikawa, Biochim. Biophys. Acta 664 (1981) 33^48. [25] M. Amor, K.L. Parker, H. Globerman, M.I. New, P.C. White, Proc. Natl. Acad. Sci. USA 85 (1988) 1600^1604. [26] P.W. Speiser, M.I. New, P.C. White, New Engl. J. Med. 319 (1988) 19^23. [27] C.M. Jenkins, M.R. Waterman, J. Biol. Chem. 269 (1994) 27401^27408.
[28] C.W. Fisher, M.S. Shet, D.L. Caudle, C.A. Martin-Wixtrom, R.W. Estabrook, Proc. Natl. Acad. Sci. USA 89 (1992) 10817^10821. [29] T. Imai, H. Globerman, J.M. Gertner, N. Kagawa, M.R. Waterman, J. Biol. Chem. 268 (1993) 19681^19689. [30] T.H. Richardson, M.-H. Hsu, T. Kronbach, H.J. Barnes, G. Chan, M.R. Waterman, B. Kemper, E.F. Johnson, Arch. Biochem. Biophys. 300 (1993) 510^516. [31] P. Sandhu, T. Baba, F.P. Guengerich, Arch. Biochem. Biophys. 306 (1993) 443^450. [32] C.N.A. Palmer, T.H. Richardson, K.J. Gri¤n, M.-H. Hsu, A.S. Muerho¡, J.E. Clark, E.F. Johnson, Biochim. Biophys. Acta 1172 (1993) 161^166.
BBAPRO 35828 5-2-99
Characterization of the consequence of a novel Glu-380 to Asp mutation by expression of functional P450c21 in Escherichia coli Nai-Chi Hsu, Victor M. Guzov 1 , Li-Chung Hsu, Bon-chu Chung * Institute of Molecular Biology, Academia Sinica, Nankang, Taipei, Taiwan Received 11 September 1998; received in revised form 1 December 1998; accepted 2 December 1998
Abstract P450c21 catalyzes an important step in steroid synthesis. Its deficiency leads to symptoms of steroid imbalance. To obtain enough P450c21 for structure and function studies, we developed a method to express P450c21 in Escherichia coli. The 5Pregion of the human P450c21 cDNA was modified to ensure efficient translation and the C terminus of the protein was extended with four His residues for easy purification. Mutant proteins with substitutions at residues 172 and 281 exhibited decreased enzymatic activities similar to those found in mammalian cells. One new mutation changing Glu-380 to Asp (D380) caused 3-fold reduction in enzymatic activity. The amount of apoprotein production detected by immunoblotting and the affinity of the mutant protein towards substrate as measured by Km were normal. The defect lies in the decreased ability of the apoprotein to bind heme, which was measured by CO difference and substrate-binding spectra. The D380 mutant protein had 3-fold reduction in peak heights in both spectra. This reduced heme binding resulted in 3-fold lower enzymatic activity. ß 1999 Elsevier Science B.V. All rights reserved. Keywords: Steroidogenesis; Congenital adrenal hyperplasia; 21-Hydroxylase; Steroid secretion
1. Introduction Cytochromes P-450 (P-450s) are enzymes that catalyze steps in biosynthesis of physiologically signi¢cant substances (such as steroid hormones, fatty acids, prostaglandins, vitamin D) as well as steps in detoxi¢cation of xenobiotics. P450c21 catalyzes essential steps in biosynthesis of mineralocorticoids Abbreviations: 17-OHP, 17-hydroxyprogesterone; PCR, polymerase chain reaction * Corresponding author. Fax: +886 (2) 27826085; E-mail: [email protected] 1 Visiting postdoctoral fellow from the Institute of Bioorganic Chemistry, Academy of Sciences of Belarus, Minsk, Republic of Belarus.
(conversion of progesterone to deoxycorticosterone) and glucocorticoids (conversion of 17-hydroxyprogesterone to 11-deoxycortisol) in the endoplasmic reticulum of the adrenal cortex [1]. The inborn de¢ciency of P450c21 contributes to more than 90% cases of congenital adrenal hyperplasia, which is a common genetic disease occurring at a frequency of one in 15 000 [2]. The gene encoding P450c21 is termed CYP21A1. Besides it, there is a pseudogene called CYP21A1P. These two genes are more than 98% identical permitting frequent gene conversion events [3]. Ten major mutations in the coding region of the human CYP21A1 gene have been characterized [1,4]. These mutations are due to frequent gene conversion events changing the active CYP21A1 gene into its neighboring pseudogene CYP21A1P.
0167-4838 / 99 / $ ^ see front matter ß 1999 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 8 3 8 ( 9 8 ) 0 0 2 7 1 - 4
BBAPRO 35828 5-2-99
96
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
Gene conversion could account for about 95% of the mutations identi¢ed so far [5]. There are, however, other infrequent mutations which are not caused by apparent gene conversion [6]. A mutation changing Gly-380 into Asp, found in a patient su¡ering from the severe salt-wasting form of the disease, represents such a situation [7]. The naturally occurring missense mutations a¡ecting the function of P450c21 are convenient probes to study the structural requirements for P-450 functions. Among them, mutation at Ile-172 has been shown to result in a protein with altered conformation and lower catalytic activity [8], Val-281 mutation to lead to decreased heme-binding of the mutant protein [9], and mutation at Pro-30 to lead to reduced production of the protein [10]. A structural basis for the reactions carried out by these P-450s has not been established since the threedimensional structure of mammalian P-450s is unknown due to the di¤culties in obtaining large amounts of protein and the even more di¤cult task of membrane protein crystallization. To study the mutants an e¤cient heterologous expression system is needed. So far, P450c21 has been expressed in mammalian cells [11^13], yeast [14,15] and bacteria [16]. In yeast and mammalian cells P450c21 protein has been expressed as an active enzyme but at quantities not su¤cient for enzyme puri¢cation. In bacteria it was easily overexpressed but as an inactive protein in inclusion bodies [12]. We have developed a bacterial expression system which expressed active P450c21 [16]. In this report, we showed our attempt to purify P450c21 using a one-step procedure. This simple procedure enables further characterization of P450c21. We showed that the E380D mutant protein was produced at normal levels but had a slight structural change surrounding the heme-binding domain. This resulted in a change in its spectroscopic property and the reduced enzymatic activity. 2. Materials and methods 2.1. Plasmid construction The construction of plasmids expressing P450c21 with slight 5P-modi¢cation was described before [16]. Four His codons were introduced into the C termi-
nus of P450c21 by PCR ampli¢cation of the region between the stop codon and upstream StuI unique restriction site, while introducing an XbaI site at the 3P-end using a 3P-end mutant oligo (CGGCTGGCATCGGTCTAGATCAATGATGATGATGCTGGCTCTGGCCCGG). The PCR product was digested with StuI-XbaI before replacing the corresponding 3P-fragment of pBC21-21mod. After sequence veri¢cation, the resulting plasmid pBC2121modHis was transformed into a Dam-de¢cient Escherichia coli strain GM119 because the XbaI site was Dam-methylated. The EcoRI-XbaI fragment of pBC21-21modHis was then cloned into the expression plasmid by replacing the corresponding fragment of the P450c21 cDNA to form pTacTacC2121modHis in a JM109 host. 2.2. Expression of P450c21 The procedure of P450c21 expression was described before [16]. Brie£y, 0.5 mM N-aminolevulinic acid was added to the cell culture at OD600 0.3^0.4 in TBS medium (24 g yeast extract, 12 g tryptone, 2 g peptone, 4 ml glycerol per liter), plus 0.017 M KH2 PO4 , 0.072 M K2 HPO4 , pH 7.4, 1 mM thiamine and 0.25 ml stock trace elements per liter medium (27 g FeCl3 6H2 O, 2 g ZnCl2 4H2 O, 2 g CoCl2 6 H2 O, 2 g Na2 MoO4 2 H2 O, 1 g CaCl2 2H2 O, 1 g CuCl2 , 0.5 g H3 BO3 and 100 ml concentrated HCl per liter) [17] growing at 37³C. When OD600 reached 0.6^0.8, expression of P450c21 was induced by 1 mM isopropyl-L-D-thiogalactoside at 20³C. N-Aminolevulinic acid (2 mM) was added again 45 min later and the cultures were further shaken at 20³C for 2 days. 2.3. Isolation of membranes from E. coli Cell pellets were resuspended (15 ml/g wet weight of cells) in cold TES bu¡er (100 mM Tris-acetate, pH 7.6, 500 mM sucrose, 0.5 mM EDTA, 0.1 mM dithiothreitol) before the sequential gradual addition of lysozyme to 0.5 mg/ml and an equal volume of cold 0.1 mM EDTA, pH 8.0, 0.1 mM dithiothreitol. Spheroplasts which formed by stirring for 30 min at 4³C were pelleted (8000Ug, 15 min) and resuspended (2 ml/g wet weight of cells) in cold KG bu¡er (50 mM K-phosphate, pH 7.4, 20% glycerol) containing 0.5 mM PMSF, 0.04 U/ml aprotinin and 0.1 Wg/ml
BBAPRO 35828 5-2-99
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
leupeptin. Upon sonication at an output of about 100 W using six 10 s pulses separated by 30 s breaks on ice, cell debris was removed at 8000Ug for 15 min and membranes were pelleted at 42 000 rpm in a 60 Ti rotor for 1.5 h. Final membrane preparation was resuspended (1:100 volume of the initial culture) in NG bu¡er (50 mM Na-phosphate bu¡er, pH 7.4, 20% glycerol) containing 0.1 mM PMSF and stored frozen at 370³C. 2.4. Puri¢cation of P450c21 Membranes in NG bu¡er were solubilized on ice with 1% Emulgen 913 (w/v) for 1 h at detergent/protein ratio (w/w) 3:1. Alternatively, E. coli spheroplasts were solubilized by the addition of 1% Emulgen 913 followed by sonication. Insoluble material was pelleted at 100 000Ug for 1.5 h and the supernatant was loaded onto His-Bind Resin (Novagen, Madison, WI, USA) equilibrated with bu¡er A (100 mM Na-phosphate bu¡er, pH 7.4, containing 20% glycerol, 100 mM NaCl). After washing of the column with 10 vols. bu¡er A containing 50 mM glycine and 0.2% Emulgen 913, the protein was eluted with 40 mM histidine and 0.5% Emulgen 913. Eluted P450c21 was dialyzed against 10 mM NG bu¡er containing 0.1% Emulgen 913 and stored frozen at 370³C. 2.5. Mutagenesis and cloning The E380D mutant was generated by a two-step PCR procedure [18]. Two sets of primers, E3P (nt 349^365, EXON 3, 17mer, sense, 5P-TGGAAAGCCCACAAGAA), D380AS (antisense, nt 1151^1134, 18mer, with E380D mutation, 5P-ACTGTGCCGTCAGGGATG), D380S (18mer, nt 1134^1151 with E380D mutation, sense, 5P-CATCCCTGACGGCACAGT), and E10.2 (exon 10, nt 1591^1575, 17mer, 5P-GAGGAAATAACGAGGGC, antisense), were used to amplify 803 and 457 bp DNA fragments encoding amino acids 116^383 and 377^494 separately. The PCR condition was 94³C, 3 min, 42³C, 1 min, 75³C 1 min for the ¢rst cycle and 94³C, 30 s, 42³C, 1 min, 75³C 1 min for 30 cycles followed by a 75³C 10 min reaction. The PCR products were eluted from the gel before serving as templates for the ampli¢cation of a 1242 bp DNA fragment encoding
97
amino acids 116^494 using the two end primers (E3P and E10.2). This DNA was digested with EcoRI-StuI to replace the EcoRI-StuI fragment of pTacTacC21-21modHis. The mutation was con¢rmed ¢rst by the loss of the MstII site at codon 380 and later by sequencing of the entire PCR product. For the construction of plasmids with mutations at positions 172 and 281, the yeast expression plasmids pYE-c21 with the respective mutations were used as parent plasmids. The EcoRI-StuI fragments harboring the mutations were released from parent plasmids and cloned into pTacTacC21-21modHis by replacement. 2.6. Analytical methods Immunoblotting was carried out according to standard procedures using antibodies speci¢c to human P450c21 [12] and chemiluminescence detection. CO di¡erence and substrate-binding spectra were recorded [19,20] using a Beckman DU 70 spectrophotometer. To test 21-hydroxylase activity in vivo, E. coli cells were cultured and induced as described above and ¢nally washed and resuspended essentially as described [21]. The reaction was initiated by the addition of 1 mM [14 C]17-OHP to the suspension of cells corresponding to 0.5^1 ml of culture. Following 0.5^1 h incubation at 37³C, steroids were extracted, resolved by thin layer chromatography and quanti¢ed using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA, USA). To study 21-hydroxylase activity in vitro, solubilized P450c21 was incubated with NADPH-cytochrome P-450 reductase (100 pmol), energy regenerating system (5 U/ml glucose 6-dehydrogenase, 720 mM glucose 6-phosphate, 0.5 mM NADPH), in 50 mM Na-phosphate bu¡er, pH 7.2, containing 1 mM MgCl2 at 37³C before separation of substrate and product by thin layer chromatography. 3. Results 3.1. Expression of P450c21 For protein expression in E. coli, secondary structures at the 5P-region of the cDNA often a¡ect translational e¤ciency [22]. Computer simulation indi-
BBAPRO 35828 5-2-99
98
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
Fig. 1. Modi¢ed nucleotide and amino acid sequences of human P450c21 at the (A) N and (B) C termini. The introduced mutations are underlined. The XbaI restriction site is shown by a double underline.
cated that the 5P-region of the human P450c21 cDNA had the potential to form secondary structures. Site-directed mutagenesis was performed to eliminate this secondary structure. Three plasmids were constructed to alleviate the potential problem (Fig. 1). Plasmid pTacC21mod has modi¢cation at the third nucleotide of the codon to minimize the potential secondary structure but retain the coding sequence. Plasmid pTacTacC21-21mod has substitutions at the second amino acid for Ala and the fourth for Leu, both of which have been implicated to be most important for protein expression [23]. In addition, we also added four His codons at the C terminus right before the stop codon to ensure easier puri¢cation with a¤nity chromatography (Fig. 1). All three plasmids were transformed into JM109 and the recombinant proteins expressed using our established procedure [16]. Recombinant proteins derived from all three plasmids had similar yield and kinetic properties. Since protein produced from pTacTacC2-21modHis is easier to purify using a nickel column, it was further characterized. Fig. 2 shows that the major protein band after nickel column chromatography was P450c21 based on Coomassie blue staining and reaction with anti-P450c21 antibody. Therefore, a simple one-step column chroTable 1 Kinetic parameters of P450c21-4His Substrate
Km (WM)
Vmax (nmol/minUnmol P450c21)
17-OHP Progesterone
0.73 þ 0.12 0.23 þ 0.14
70.6 þ 14.4 13.43 þ 1.33
Values are the average of three determinations for each substrate and presented as means þ S.D.
Fig. 2. Analysis of P450c21 by gel electrophoresis. E. coli cells harboring recombinant P450c21 were broken, solubilized, then passed through a nickel column. Proteins from the solubilized lysate (Sup, 3 Wg) and Ni column eluate (Ni, 0.6 Wg) were electrophoresed, then stained with Coomassie blue, or transferred to a membrane for antibody reaction. M stands for size marker.
matography achieved puri¢cation which is su¤cient for subsequent analysis. The P450c21 expressed from E. coli (Table 1) has similar Km and Vmax values as that expressed from yeast cells [14] or that puri¢ed directly from bovine adrenal [20,24], indicating that expression systems do not a¡ect the properties of the protein. 3.2. Function of mutant proteins expressed in E. coli To test whether this E. coli expression system is suitable for the functional study of mutant protein, we have generated plasmids which contain single substitution at positions 172 and 281. The Ile-172 to Asn and Val-281 to Leu mutations were found in the simple virilizing and non-classical forms of the 21-hydroxylase de¢ciency, respectively [25,26]. The plasmids for the expression of the mutant proteins were constructed and transformed into E. coli. As shown in Fig. 3, mutation at amino acid 172 was deleterious and the mutant proteins had around 1^ 5% activity, depending on the type of amino acids which replaced Ile. Mutation at Val-281, which is associated with the milder activity loss, was more tolerable. Mutant proteins had 4^40% residual activity (Fig. 3), also depending on the kind of amino acid which substituted Val-281. These activity data are
BBAPRO 35828 5-2-99
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
99
Table 2 Kinetic parameters of the wild type P450c21-His and its D380 mutant proteins isolated from E. coli Enzyme
Km (WM)
Activity (mol/hUWg protein)
WT-c21 D380
0.50 þ 0.35 0.47 þ 0.38
29.41 þ 10.12 8.70 þ 3.25
P450c21 proteins expressed from E. coli were solubilized by Emulgen before isolation. Enzymatic activities were determined from varying concentrations (0.08, 0.1, 0.12, 0.16, 0.18, 0.2, 0.3, 0.4, 1 WM) of substrate 17-hydroxyprogesterone to the reconstituted reaction mixture. Km /Vmax values were calculated using the double reciprocal plots. Values are the average of four determinations for each substrate and presented as means þ S.D.
consistent with our earlier studies expressing 172 and 281 mutant proteins in mammalian cells and yeast [9,12]. The amount of 281 mutant protein expressed in E. coli was detected by immunoblot analysis (Fig. 4A). It shows that all the 281 mutant proteins are produced at equal amounts, again con¢rming earlier results [9]. These results thus validate the use of E. coli in expression of P450c21 for functional studies. 3.3. Property of the E380D mutant protein A novel mutation of the CYP21A1 gene changing Glu-380 into Asp has been identi¢ed in a patient su¡ering from 21-hydroxylase de¢ciency [7]. To understand the role of this residue in the structure and function of the protein, a D380 mutant protein
Fig. 4. The amount of mutant proteins in the cell. (A) 281 mutant proteins. (B) D380 mutant protein. Equal amounts (20 Wg) of total proteins from E. coli strains harboring either wild type (WTc21) or the mutant cDNA were separated by gels and the P450c21 proteins were detected by antibody.
Fig. 3. Enzymatic activity of the mutant proteins. E. coli strains (1 ml) harboring plasmid expressing wild type or mutant proteins were grown to OD 0.1 when the substrate was added for the 21-hydroxylase activity test. The positions of the mutation of each protein are marked on the X-axis and the Y-axis represents relative 21-hydroxylase activity of each mutant.
was expressed from E. coli. The enzymatic activity was determined in vivo by adding radioactive substrate to the culture medium and measuring the amount of product formation. The bacterial strain harboring the D380 mutant plasmid had about 30% activity of strain containing the wild type P450c21. Therefore, this conservative substitution replacing Glu with Asp had a small but signi¢cant
BBAPRO 35828 5-2-99
100
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
e¡ect on the enzymatic activity of the protein. The amount of protein expression was measured by immunoblot analysis (Fig. 4B). About the same amount of the apoprotein was produced from the strains harboring the wild type P450c21 and the D380 mutant protein. Both membrane fractions and solubilized proteins were used for kinetic analysis (Table 2). The wild type and the D380 mutant proteins had similar Km values, but the D380 mutant protein had about 1/3 the Vmax value when equal amounts of proteins were used for the analysis. It indicated that the D380 mutant protein binds substrate normally, but the enzymatic activity is lower. The spectroscopic properties of the D380 mutant protein were examined. The CO di¡erence spectrum, which measures hemoprotein content, showed that the D380 mutant had about 1/3 of the heme content of the wild type protein (Fig. 5). The substrate-binding spectra of the D380 mutant protein, which measure the environment of the region around heme, were
Fig. 5. Spectroscopic properties of WT-c21 and the D380 mutant protein. Both CO di¡erence (A) and substrate-binding spectra (B) from membrane preparations of the E. coli harboring the WTc21 and the D380 mutant are shown. 17-OH-Progesterone (20 WM) was added to 1 ml of protein preparation (1 mg/ml protein) for spectroscopic measurement.
Fig. 6. Alignment of microsomal cytochromes P-450 at regions around residue 380. The amino acid residues are shown in oneletter code. The position corresponding to Glu-380 of the human P450c21 is boxed.
also decreased to 40% of wild type. Taken together, these data showed that the D380 mutant protein binds to heme at about 30^40% the wild type e¤ciency. 4. Discussion In this report, we showed our attempt to express and purify human P450c21 from E. coli. A one-step column chromatographic procedure was used to purify P450c21 quickly. Using this expression system, we analyzed a novel mutation of the CYP21A1 gene in congenital adrenal hyperplasia. The D380 mutation resulted in a 3-fold decrease in enzymatic activity and hemoprotein content, but a normal amount of apoprotein production. This is the ¢rst time this novel mutation has been characterized so extensively. The Glu-380 to Asp mutation was found in CYP21A1 gene from a patient su¡ering from the severe salt-wasting form of the disease [7]. This form of the disease usually correlated with zero enzymatic activity [5]. Our discovery of 30% activity from the D380 mutant protein does not correlate with the phenotypic presentation of the disease. Therefore, other mutations must be present in this patient. Since the entire coding region of the CYP21A1 gene has been characterized [7], one possibility is that the promoter or another region may have some yet unidenti¢ed mutations which can aggravate the disease presentation. To understand the involvement of the Glu-380 residue in the structure and function of P450c21, a comparison of the sequences of di¡erent P-450s around this residue was made (Fig. 6). Glu-380 is located in
BBAPRO 35828 5-2-99
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
a rather conserved region which enables sequence alignment easily. It is, however, not invariant. It could be either Glu or Lys as in mouse P450c21 and other hepatic P-450s. It appears that a charged residue with a long side chain may be required at this position. Asp is charged with a short side chain. It appears that this change could be tolerated somewhat so that the mutant protein retained about 30% activity. The major defect of the D380 mutant appears to be its decreased ability to bind heme. The ¢nal result is its lower hemoprotein content as measured by the decreased peak height in the CO di¡erence and substrate-binding spectra. The amount of apoprotein production in immunoblot analysis and the a¤nity of the mutant protein towards substrate as shown by its Km value were normal. Taking the lower amount of the hemoprotein content into account, then the 380D mutant had normal catalytic activity as long as it binds heme. Therefore, the 380D mutation did not appear to be located at the catalytic center of the protein. Its substitution a¡ected the ability of the protein to bind heme but not catalysis per se. Heterologous expression of P-450s in E. coli has been widely used for structure-function characterization. We were able to express P450c21 and measure its activity in E. coli without co-expressing NADPHdependent reductase. This result is similar to that observed for P450c17 expression [21], and reductase-like proteins have been characterized in E. coli [27]. High-level expression of fusion proteins containing the domains of mammalian cytochromes P-450 and NADPH-P-450 reductase £avoprotein has also been reported [28]. Therefore, there is a wide selection of expression systems for functional studies. Several P-450s were overexpressed in E. coli at high quantities (more than 200 nmol/l culture) as active proteins upon modi¢cation of the 5P-coding region of their cDNAs [29,30]. However, other proteins could not be expressed at such high levels even after the 5P-modi¢cation [31,32]. The expression level we achieved for human P450c21 was 40^50 nmol/l culture, which was not as high as some P-450s but was still much higher than the level found in the adrenal based on the enzymatic activity in vivo. Furthermore, higher yields of the protein can be obtained because the engineering of the His residues
101
at the C terminus ensures easy puri¢cation thus decreases loss during puri¢cation. Acknowledgements The authors would like to thank Meng-Chun Hu for constructing the pTacC21mod plasmid and JeouYuan Chen and Mei-Hui Hsu for helpful suggestions. This work was supported by Academia Sinica, National Science Council (Grant NSC84-2331-B001-002 M02) and National Health Research Institutes (Grant DOH87-HR-609), Republic of China.
References [1] B.-c. Chung, Adv. Mol. Cell Biol. 14 (1996) 199^219. [2] W.L. Miller, Y. Morel, Annu. Rev. Genet. 23 (1989) 371^ 393. [3] P.C. White, M.I. New, B. Dupont, Proc. Natl. Acad. Sci. USA 83 (1986) 5111^5115. [4] Y. Morel, W.L. Miller, Adv. Hum. Genet. 20 (1991) 1^68. [5] P.W. Speiser, J. Dupont, D. Zhu, M. Buegeleisen, M.-T. Tusie-Luna, M. Lesser, M.I. New, P.C. White, J. Clin. Invest. 90 (1992) 584^595. [6] H.-H. Lee, H.-T. Chao, Y.-J. Lee, S.-G. Shu, M.-C. Chao, J.-M. Kuo, B.-c. Chung, Hum. Genet. 103 (1998) 304^310. [7] L. Kirby-Keyser, C.C. Porter, P.A. Donohoue, Hum. Mut. 9 (1997) 181^182. [8] L.-C. Hsu, N.-C. Hsu, J.A. Guzova, V.M. Guzov, S.-F. Chang, B.-c. Chung, J. Biol. Chem. 271 (1996) 3306^3310. [9] D.-A. Wu, B.-c. Chung, J. Clin. Invest. 88 (1991) 519^523. [10] M.-C. Hu, L.-C. Hsu, N.-C. Hsu, B.-c. Chung, Biochem. J. 316 (1996) 325^329. [11] M. Ricketts, E. Chiao, M.C. Hu, B.c. Chung, Biochem. Biophys. Res. Commun. 186 (1992) 426^431. [12] M.-C. Hu, B.-c. Chung, Mol. Endocrinol. 4 (1990) 893^898. [13] M.-T. Tusie-Luna, P. Traktman, P.C. White, J. Biol. Chem. 265 (1990) 20916^20922. [14] D.-A. Wu, M.-C. Hu, B.-c. Chung, DNA Cell Biol. 10 (1991) 201^209. [15] T. Sakaki, M. Shibata, Y. Yabusaki, H. Murakami, H. Ohkawa, DNA Cell Biol. 9 (1990) 603^614. [16] B.-c. Chung, M.-C. Hu, V.M. Guzov, D.-A. Wu, Endocr. Res. 21 (1995) 343^352. [17] S. Bauer, J. Shiloach, Biotechnol. Bioeng. 16 (1974) 933^941. [18] S.N. Ho, H.D. Hunt, R.M. Horton, J.K. Pullen, L.R. Pease, Gene 77 (1989) 51^59. [19] T. Omura, R. Sato, J. Biol. Chem. 239 (1964) 2370^2378. [20] S. Kominami, H. Ochi, Y. Kobayashi, S. Takemori, J. Biol. Chem. 255 (1980) 3386^3394.
BBAPRO 35828 5-2-99
102
N.-C. Hsu et al. / Biochimica et Biophysica Acta 1430 (1999) 95^102
[21] H.J. Barnes, M.P. Arlotto, M.R. Waterman, Proc. Natl. Acad. Sci USA 88 (1991) 5597^5601. [22] B. Schauder, J.E. McCarthy, Gene 78 (1989) 59^72. [23] A.C. Looman, J. Bodlaender, L.J. Comstock, D. Eaton, P. Jhurani, H.A. de-Boer, P.H. van-Knippenberg, EMBO J. 6 (1987) 2489^2492. [24] A. Hiwatashi, Y. Ichikawa, Biochim. Biophys. Acta 664 (1981) 33^48. [25] M. Amor, K.L. Parker, H. Globerman, M.I. New, P.C. White, Proc. Natl. Acad. Sci. USA 85 (1988) 1600^1604. [26] P.W. Speiser, M.I. New, P.C. White, New Engl. J. Med. 319 (1988) 19^23. [27] C.M. Jenkins, M.R. Waterman, J. Biol. Chem. 269 (1994) 27401^27408.
[28] C.W. Fisher, M.S. Shet, D.L. Caudle, C.A. Martin-Wixtrom, R.W. Estabrook, Proc. Natl. Acad. Sci. USA 89 (1992) 10817^10821. [29] T. Imai, H. Globerman, J.M. Gertner, N. Kagawa, M.R. Waterman, J. Biol. Chem. 268 (1993) 19681^19689. [30] T.H. Richardson, M.-H. Hsu, T. Kronbach, H.J. Barnes, G. Chan, M.R. Waterman, B. Kemper, E.F. Johnson, Arch. Biochem. Biophys. 300 (1993) 510^516. [31] P. Sandhu, T. Baba, F.P. Guengerich, Arch. Biochem. Biophys. 306 (1993) 443^450. [32] C.N.A. Palmer, T.H. Richardson, K.J. Gri¤n, M.-H. Hsu, A.S. Muerho¡, J.E. Clark, E.F. Johnson, Biochim. Biophys. Acta 1172 (1993) 161^166.
BBAPRO 35828 5-2-99