- Email: [email protected]
Characterization of the Rhesus Monkey Galactocerebrosidase (GALC) cDNA and Gene and Identification of the Mutation Causing Globoid Cell Leukodystrophy (Krabbe Disease) in This Primate
GENOMICS
42, 319–324 (1997) GE974744
ARTICLE NO.
Characterization of the Rhesus Monkey Galactocerebrosidase (GALC) cDNA and Gene and Identification of the Mutation Causing Globoid Cell Leukodystrophy (Krabbe Disease) in This Primate Paola Luzi,* Mohammad A. Rafi,* Teresa Victoria,* Gary B. Baskin,† and David A. Wenger*,1 *Departments of Medicine (Medical Genetics) and Biochemistry and Molecular Pharmacology, Jefferson Medical College, Philadelphia, Pennsylvania 19107; and †Pathology Department, Tulane Regional Primate Research Center, Covington, Louisiana 70433 Received January 27, 1997; accepted March 31, 1997
Krabbe disease or globoid cell leukodystrophy (GLD) is a severe lysosomal disorder resulting from the deficiency of galactocerebrosidase (GALC) activity. This deficiency results in the insufficient catabolism of several galactolipids that are important in the production of normal myelin. Since the cloning of the human GALC cDNA and gene many disease-causing and polymorphic changes have been identified. This autosomal recessive disease has been reported to occur in several animal species, and recently the murine and canine GALC genes have been cloned. We now describe the cloning of the GALC cDNA and gene from the rhesus monkey and the identification of the mutation causing GLD in this species. The nucleotide sequence of the coding region and the gene organization were nearly identical to human. The deduced amino acid sequence of the monkey GALC was compared to the human, dog, and mouse, and it was found to be 97, 87, and 83% identical, respectively. The mutation causing GLD in the rhesus monkey is a deletion of AC corresponding to cDNA positions 387 and 388 in exon 4. This results in a frame shift and a stop codon after 46 nucleotides. A rapid method to detect this mutation was developed, and when 45 monkeys from this colony were tested, 22 were found to be carriers. The availability of this nonhuman primate model of GLD will provide unique opportunities to evaluate treatment for this severe disease. q 1997 Academic Press
INTRODUCTION
Krabbe disease or globoid cell leukodystrophy (GLD) is an autosomal recessively inherited lysosomal disorder resulting from mutations in the gene for galactocerebrosidase (GALC). These mutations result in low 1 To whom correspondence and reprint requests should be addressed at Division of Medical Genetics, 1100 Walnut Street, Room 410, Philadelphia, PA 19107. Telephone: (215) 955-1666. Fax: (215) 955-9554. E-mail: [email protected].
GALC activity in all tissues, which provides the basis for methods to diagnose new patients using easily obtained tissue samples (Suzuki and Suzuki, 1970, 1971). While most of the human patients present with symptoms before 6 months of age and die before 18 months of age, older patients, including adults, are also diagnosed with this disease. GALC catalyzes the lysosomal degradation of specific galactolipids including galactosylceramide, galactosylsphingosine (psychosine), monogalactosyldiglyceride, and, possibly, lactosylceramide. The abnormal accumulation of the first two glycolipids is responsible for the production of the characteristic globoid cells found on pathological examination of samples from nervous tissues from patients and the destruction of myelin-forming cells in the peripheral and central nervous systems. This disease is unique in having several naturally occurring animal models that can be used to examine pathogenetic mechanisms and to explore treatment options. These include the West Highland White (WHWT) and Cairn terrier (Fankhauser et al., 1963; Fletcher et al., 1966; Suzuki et al., 1970), a cat (Johnson, 1970), the polled Dorset sheep (Pritchard et al., 1980), the twitcher mouse (Kobayashi et al., 1980), and the rhesus monkey (Baskin et al., 1989). Recently, the murine and canine GALC cDNAs were cloned and sequenced, and the disease-causing mutations in these two species were determined (Sakai et al., 1996; Victoria et al., 1996). The mutation in the twitcher mouse consists of a G r A transition at cDNA position 1017, which changes codon 339 from tryptophan to stop, and the mutation causing GLD in both the WHWT and Cairn terrier is an A r C transversion at cDNA position 473, which changes codon 158 from tyrosine to serine. While these models have potential for numerous studies to understand and treat this disease, there would be considerable advantages to using a nonhuman primate for some investigations. In 1989 Baskin and co-workers (1989) reported that a newborn rhesus monkey died shortly after birth, and pathological changes compatible with
319
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
0888-7543/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.
gnma
320
LUZI ET AL.
a diagnosis of GLD were obtained. The mother had lower than normal GALC activity consistent with carrier status for GLD. Until recently, repeat matings with potential carrier males did not result in another affected offspring. Additional measurements of GALC activity identified some obvious carriers in this colony, and recent matings resulted in the birth of two affected monkeys by the original mother and her daughter. One died within 2 weeks after birth and the other lived for 5 months (manuscript in preparation). In this paper we present the cloning of the rhesus monkey GALC cDNA, the characterization of the GALC gene, and identification of the mutation causing GLD in these monkeys. More than 20 monkeys carrying the mutation have been identified in this colony by our rapid DNAbased test, and this will permit selective matings to obtain additional affected monkeys for study. The availability of a nonhuman primate model of a metabolic disorder provides a unique opportunity for studies to evaluate the effectiveness of several treatment options, including in utero and neonatal heterologous bone marrow transplantation (BMT) and autologous BMT using hematopoietic stem cells (HSC) corrected by insertion of the normal gene. MATERIALS AND METHODS Tissue samples. Skin biopsies and blood samples were taken from normal, carrier, and affected rhesus monkeys. Leukocytes were isolated using dextran sedimentation according to the method of Skogg and Beck (1956). Cultured skin fibroblasts were grown in Eagle’s minimal essential medium supplemented with 10% fetal calf serum and 2 mM glutamine. Measurement of GALC activity. GALC activity was measured using [3H]galactose-labeled galactosylceramide as previously described (Wenger and Williams, 1991). Cloning of the monkey GALC cDNA. Total RNA was isolated from cultured skin fibroblasts of a normal rhesus monkey according to the method of Chomczynski and Sacchi (1987). The RNA was reverse transcribed and amplified by polymerase chain reaction (PCR) using human primer pairs II to VI listed in Table 1. Amplification of all regions, except for the one utilizing primer pair II, was performed under the following conditions: initial denaturation, 967C for 1 min, followed by 30 cycles of 30 s, 947C, 30 s, 567C; and 1 min, 727C in the presence of 2.5 mM MgCl2 and 3% DMSO. The 5* end of the cDNA was amplified using primer pair II under the above conditions with 8% DMSO. PCR products were sequenced directly or cloned into the pCR II vector (Invitrogen) and sequenced by the dideoxy chain termination method (Sanger et al., 1977). To identify the 3 * end of the cDNA, total RNA was amplified using the RACE system (Gibco BRL) following the instructions of the manufacturer. Characterization of the monkey GALC gene. Genomic DNA was isolated from cultured skin fibroblasts and/or tissue samples from normal monkeys using standard methods. To determine the location and size of the introns, genomic DNA was subjected to long PCR (Gene Amp XL-PCR kit, Perkin–Elmer) using primers generated from exonic sequences. Amplified material was analyzed on 0.8% agarose gel in the presence of standard DNA markers. Intron sizes were estimated by comparison with marker fragments. The PCR products were subcloned into the pCR II vector and sequenced to determine the exon–intron boundaries. The 5* and 3* regions were obtained by PCR amplification of genomic DNA using primer pairs I and VII (Table 1), respectively, under the following conditions: 957C for 1 min followed by 30 cycles of 30 s, 947C, 30 s, 567C, and 1
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
TABLE 1 Oligonucleotide Primer Pairs Used for the Amplification of Monkey GALC cDNA Primer pair I II III IV V VI VII
Positiona (/ or 0)b 0787 19 023 786 653 1199 950 1687 1609 2088 1893 3195 3044 3932
(/) (0) (/) (0) (/) (0) (/) (0) (/) (0) (/) (0) (/) (0)
Sequence (5* to 3*) GGAAGACATCTTTCACATGG AACCCGCGGCGGCCGTCAT CCTGGCAACGCCGAGCGAA AGTGCTAAAGTCTTCAGAAGAC CTGCATCCATGCTCCTTGATGC GATCCCTTAAGAACAAAGGTGG GGCACTACGTGGTAGAATCTCC CAATGAACACACCTCCTGTGTC GGAGACTACAACTGGACCAATC GAAACAAGAATTGGCTCTGAACCAAAAC CAAGTCTCTGTGGACAGACATC CTTCAAAAGCAATGCAAAAC GTGGCTCTATGTAGCAAATC ATGACAACATGAAGCACTGAC
a Position numbers are from the cDNA sequence counting from the A of the initiation codon. b (/) sense; (0) antisense.
min, 727C in the presence of 2.5 mM MgCl2 and 5 and 3% DMSO, respectively. Characterization of the mutation causing GLD in rhesus monkeys. Genomic DNA was isolated from leukocyte sonicates of affected and carrier monkeys according to our published method (Louie et al., 1991), or from whole blood using the QIAamp blood kit (Qiagen). All exons and exon–intron boundaries were amplified using human intronic primers and sequenced directly. The mutation could also be found after RT-PCR amplification and sequencing of RNA isolated from an affected monkey. After the mutation was identified in the two affected monkeys, other members of the colony, including obligate heterozygotes, were analyzed for this mutation. Rapid test to identify the ‘‘AC’’ deletion. To detect this mutation, located in exon 4, genomic DNA samples were amplified using an engineered sense primer (5*-AGAAGAGGAATCCCAATAGTAC-3*) located in exon 4 and an antisense primer (5*-CCGTATTAATAGAGATTCCACCA-3*) from intron 4. The mismatched nucleotide (underlined) provides a restriction enzyme cut site for ScaI (AGT f ACT) in the mutated sequence of the 118-bp amplification product (resulting in 20- and 98-bp fragments after digestion). The 120-bp amplified fragment from normal sequence remains uncut. The products of digestion are analyzed on a 3% Metaphore gel (FMC).
RESULTS
Cloning of Monkey GALC cDNA The coding region of the rhesus monkey GALC cDNA consists of 2007 nt, the same as that in human and dog (Chen et al., 1993; Victoria et al., 1996). The cDNA sequence is available from GenBank under Accession No. U87628. As in the human and the dog, there is a suboptimal A at position /4 of the initiation codon (Kozac, 1989). Figure 1 shows the deduced amino acid sequence compared to human, dog, and mouse. The amino acids are 97% identical to human, 87% identical to dog, and 83% identical to mouse. The monkey GALC has seven potential glycosylation sites, including six in common with humans and dogs and an additional one at codon 435 (shown in boldface in Fig. 1). This addi-
gnma
MONKEY GALC GENE AND GLD-CAUSING MUTATION
321
FIG. 1. Deduced amino acid sequences of the human, monkey, dog, and mouse GALC cDNAs. Only the amino acids that differ from human are shown; the identical amino acids are indicated by a dash. The potential glycosylation sites, six in human and an additional one in the monkey, are indicated by a boldface N. The three human polymorphisms are shown as amino acids above the human sequence at positions 168, 224, and 546. The arrow denotes the start of the coding region for the 30-kDa subunit. The asterisk at amino acid 508 in the mouse denotes the three missing nucleotides at that position.
tional potential glycosylation site is only 1 amino acid before the start of the 30-kDa subunit found in purified human GALC. The 26-amino-acid signal peptide is identical to human except for the change of phenylalanine for leucine at codon 15. That is the only amino acid different from human until codon 199. Three polymorphisms in the coding region of human GALC have been found (shown in Fig. 1), and the monkey has only the most common human sequence. Results from 3* RACE analysis revealed that monkeys utilize two polyadenylation signals. One is the same as human, and the other, located about 400 bp upstream, is present but apparently not used in humans. Characterization of the Monkey GALC Gene As shown above there was a high level of identity between the monkey and the human GALC cDNAs. This was also true with regard to the gene organization. The organization of the human GALC gene was previously published (Luzi et al., 1995a). Table 2 shows the sizes and location of each exon in the monkey (Accession Nos. U87463 to U87477). The lengths of the exons were identical to human, and the estimated lengths of the introns were nearly identical to human except for introns 8 and 10. All introns follow the gt-ag rule, and the sequences at the boundaries were nearly
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
identical to those found in the human GALC gene. Eight hundred basepairs of the 5* untranslated region were sequenced (Accession No. U87463) and found to be 93% identical to human. The first 180 nucleotides upstream from the initiation ATG were the most conserved, showing only eight changes from the human sequence. The 3*-untranslated region of the monkey gene amplified from genomic DNA revealed an insertion of 330 bp not present in the human gene, starting 601 bp after the stop codon. Characterization of the Mutation Causing GLD in Rhesus Monkeys The two affected monkeys were found to have GALC activity less than 2% of normal in leukocytes and cultured skin fibroblasts (manuscript in preparation). Amplification and sequencing of all exonic regions of an affected monkey resulted in the identification of the deletion of the AC dinucleotide corresponding to cDNA positions 387 and 388 (Fig. 2). The affected monkeys were homozygous for this mutation, as expected for this inbred colony of monkeys. This mutation, located in exon 4, results in a frame shift leading to a stop codon 46 bp after the deletion. Figure 3 shows the nucleotide sequence and deduced amino acid sequence in the region of the AC deletion. This deletion also was found
gnma
322
LUZI ET AL.
TABLE 2 Sizes and Locations of Exons and Introns and Sequences at Exon–Intron Boundaries Sequences at exon–intron boundaries Exon
Exon size (bp)
Location of introna
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
ú500 69 64 114 140 39 131 156 125 128 90 87 151 181 164 77 2177b
147 216 280 394 534 573 704 860 985 1113 1203 1290 1441 1622 1786 1863
a b
5* border GGCGGCGGGgtgagcggcg. CTCTTTAAGgtaatgaaaa. AGACAACAGgtaggaggat. CACTCATTGgtaagaaatg. TATATTGGAgttagtaata. TACATTAAGgtgtgtacaa. TGTTATAGGgtaaggcatg. TATGACTTCgtaagttatt. GGGTGTCAGgtatggttca. GAAACCATGgtaaactttt. GGATCTTTTgtaagtaaat. TCTCTATGGgtaattttaa. TCAATGTTGgtgagtattt. CTACAACTGgtaagattga. GGGATTTAGgtaagtgact. ACTATTAAGgtaggtattg.
3* border . . . . . . . . . . . . . . . .
.atttttttagGCAACCTCC .cttttcacagCCGAATTTT .ctctattcagATGGCACTG .ctctctgcagGGTTGCCAT .tgttttgcagATTTGGAAT .actccaaaagATATTAAGA .tttttcctagGGCTCATTA .catcttttagCACAATCGC .ttttctatagCTCATACCA .tttttttcagAGTCATAAA .ttctttacagAGTGAAATA .tctttttcagCTCCTCGAC .ttctgaacagATTACCCAT .tattttgcagGACGAATCT .tgtgttacagCTGGATGGA .tctactccagGGTCGTTTT
Intron size (kb) 4.3 0.246 1.5 1.8 2.1 5.8 7.4 3.0 1.9 9.0 0.7 1.9 2.0 3.9 1.4 4.8
Counting from the A of the initiation codon in cDNA. To the second polyadenylation signal.
by RT-PCR amplification and sequencing of RNA from the cultured skin fibroblasts of an affected monkey. Rapid Method to Detect the Mutation in the Rhesus Monkey Colony To screen the other members of this colony rapidly, and to identify affected fetuses and infants for therapy trials, a simple test to identify this mutation was developed. Samples of genomic DNA were amplified using the primers presented under Materials and Methods, followed by digestion with ScaI. The normal 120-bp fragment was not cut by this enzyme; however, the 118-bp amplification product from the mutant allele was cut into 20- and 98-bp fragments (Fig. 4). Using this method, 45 rhesus monkeys were screened; 22 were found to be heterozygous for this mutation and 23 were found to be homozygous normal.
FIG. 2. Partial sequence of genomic DNA from a normal monkey and a monkey affected with GLD. The two asterisks denote the two nucleotides missing in the affected monkey.
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
DISCUSSION
This paper describes the cloning of the monkey GALC cDNA, characterization of the GALC gene, and identification of the mutation causing GLD in this colony of rhesus monkeys. The sequence of the 2007 nucleotide GALC cDNA and the deduced amino acid sequence are 97% identical to human (Fig. 1). Except for the additional potential glycosylation site, the monkey GALC is nearly identical to human. As the monkey GALC has not been purified, it is not known if the 80kDa precursor is processed into 50- to 52-kDa and 30kDa subunits like human GALC (Chen and Wenger, 1993). However, the GALC activity measured in leukocytes and cultured skin fibroblasts is very similar in these two species. The monkey GALC gene was characterized, and in almost all respects it resembles the human GALC gene (Luzi et al., 1995a). As in humans, intron 10 is the largest (approximately 12 kb in humans and 9 kb in monkeys), and intron 2 is the smallest. The 5* UTR is GC-rich and is highly conserved in the first 180 nucleotides preceding the initiation codon, where moderately strong promoter activity was detected in the human gene (Luzi et al., manuscript in preparation). Before the recent birth of affected monkeys, an attempt was made to find the disease-causing mutation in this colony. Initially, RNA was isolated from cultured skin fibroblasts from the obligate carrier mother and sequenced following RT-PCR. Only normal sequence was obtained, indicating that the mutation probably resulted in low GALC mRNA. After the birth of an affected monkey, RNA and DNA could be isolated from tissue samples and cultured skin fibroblasts. Using primers generated from sequences in the introns of
gnma
MONKEY GALC GENE AND GLD-CAUSING MUTATION
323
FIG. 3. Partial nucleotide sequences and deduced amino acid sequences of a normal monkey and a monkey affected with GLD showing the effect of the deletion of the AC at cDNA positions 387 and 388 (underlined). The deletion results in 15 different amino acids followed by a stop codon (double underlined).
the human GALC gene, all exonic regions were amplified and sequenced and compared to the sequence from a normal, noncarrier monkey. The affected monkey was found to have a deletion of two nucleotides in exon 4 (Fig. 2). The carrier mother was found to be heterozygous for this mutation. This mutation results in a frame shift and a stop codon after 15 different amino acids. Due to the unstable nature of mRNAs not fully translated, it is not surprising that we detected no mutant GALC mRNA in the RT-PCR products of the obligate carrier mother. Her normal mRNA may be present in much higher concentration than the mutant mRNA. Using our test for the mutation we have identified 22 carriers within the colony. It would be interesting to determine if this mutation is present in any other colony of rhesus monkeys or in the wild. Using the simple method presented here, DNA samples from any monkey could be easily tested. Clinically these monkeys resemble human patients with the infantile form of Krabbe disease who have onset of symptoms within the first 3–6 months of life and die by about 1 year of age. This is not surprising since the AC deletion in exon 4 results in a premature stop codon and inactive, shortened GALC. About 40% of the mutant alleles in human patients consist of a 30-kb deletion starting within intron 10 and continuing beyond the polyadenylation signal (Rafi et al., 1995; Luzi et al., 1995b). This deletion results in the production of no active enzyme due to the loss of the coding region for the 30-kDa subunit and 15% of the 50-kDa subunit. Over 40 disease-causing mutations have been identified in human patients with GLD (for review see Wenger et al., 1997). Five mutations have been identified in exon 4, 4 are missense mutations, and 1, at cDNA position 382, is the deletion of an A leading to a frame shift and premature stop codon. The deletion mutation was found in one allele, along with a known ‘‘mild’’ allele (G809A, G270D), in a patient with juve-
nile Krabbe disease. It is obvious from mutation analysis in human patients that both subunits, derived from the 80-kDa precursor, are needed to produce active enzyme. Severe mutations in either subunit can produce GLD, although the clinical presentation will vary with the nature of the mutations in both alleles. The characterization of the GALC gene in a nonhuman primate, and the identification of the disease-causing mutation in rhesus monkeys with GLD, opens the way to their use in therapy trials. There is no other primate model of a metabolic disorder available for study. At this time more than 10 human patients with GLD have undergone BMT, and, while some have died due to complications, some have demonstrated a stabilization of their clinical course (Shapiro et al., 1991; unpublished data). One attempt at in utero BMT in a fetus predicted to be affected with Krabbe disease resulted in fetal death. However, there was evidence for engraftment in fetal liver tissue (Bambach et al., 1997). Bone marrow transplantation of the twitcher mouse model has demonstrated prolonged survival of mice transplanted early in life (Yeager et al., 1984; Ichioka et al., 1987; Hoogerbrugge et al., 1988a,b). However, these mice eventually die with biochemical and pathological features of GLD, indicating that therapy must be instituted earlier in development, possibly in utero, or that a higher level of donated GALC activity must be provided from the donor cells. The rhesus monkey model could be used to investigate in utero BMT following early prenatal diagnosis and heterologous BMT early in life. In addition, the monkeys will be used in studies to investigate gene therapy, initially using hematopoietic stem cells transduced with our retroviral construct containing the human GALC cDNA (Rafi et al., 1996). Similarities between the human and the monkey hematopoietic systems make this study possible in the near future. Transduced cells overexpressing GALC activity have been shown to donate GALC actively to neighboring cells, where it is rapidly taken up (Rafi et al., 1996). These studies on the rhesus monkey model of GLD provide the foundation for future attempts at treating this severe genetic disease.
ACKNOWLEDGMENTS FIG. 4. A 3% Metaphore gel showing the results of PCR amplification and ScaI digestion of the amplified fragments of a normal monkey (NI), a carrier monkey (Het), and an affected monkey (Aff). U, the uncut fragment; C, the cut fragment; M, size marker.
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
This research was supported in part by grants from the National Institutes of Health (D.A.W., DK38795 and G.B.B., RR-00164). The authors gratefully acknowledge the excellent technical assistance of H. Zhi Rao, H. Xian Shen, Caren Dubell, and Maryam Shahinfar.
gnma
324
LUZI ET AL.
REFERENCES Bambach, B. J., Moser, H. W., Blakemore, K. J., Corson, V. L., Griffin, C. A., Noga, S. J., Perlman, E. J., Zuckerman, R., Wenger, D. A., and Jones, R. J. (1997). Engraftment following in utero bone marrow transplantation for globoid cell leukodystrophy. Bone Marrow Transplant. 19: 399–402. Baskin, G., Alroy, J., Li, Y-T., Dayal, Y., Raghavan, S. S., and Sharer, L. (1989). Galactosylceramide-lipidosis in Rhesus monkeys. Lab. Invest. 60: 7A. Chen, Y. Q., and Wenger, D. A. (1993). Galactocerebrosidase from human urine: Purification and partial characterization. Biochim. Biophys. Acta 1170: 53–61. Chen, Y. Q., Rafi, M. A., deGala, G., and Wenger, D. A. (1993). Cloning and expression of cDNA encoding human galactocerebrosidase, the enzyme deficient in globoid cell leukodystrophy. Hum. Mol. Genet. 2: 1841–1845. Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162: 156–159. Fankhauser, R., Luginbuhl, H., and Hartley, W. J. (1963). Leukodystrophie vom typus Krabbe beim hund. Schweiz Arch Tierheilkd. 105: 198–207. Fletcher, T. F., Kurtz, H. J., and Low, D. G. (1966). Globoid cell leukodystrophy (Krabbe type) in the dog. J. Am. Vet. Med. Assoc. 149: 165–172. Hoogerbrugge, P. M., Poorthuis, B. J., Romme, A. E., van de Kamp, J. J., Wagemaker, G., and van Bekkum, D. W. (1988a). Effect of bone marrow transplantation on enzyme levels and clinical course in the neurologically affected twitcher mouse. J. Clin. Invest. 81: 1790–1794. Hoogerbrugge, P. M., Suzuki, K., Suzuki, K., Poorthuis, B. J. H. M., Kobayashi, T., Wagemaker, G., and Bekkum, D. W. V. (1988b). Donor derived cells in the central nervous system of twitcher mice after bone marrow transplantation. Science 239: 1035–1038. Ichioka, T., Kishimoto, Y., Brennan, S., Santos, G. W., and Yeager, A. M. (1987). Hematopoietic cell transplantation in murine globoid cell leukodystrophy (the twitcher mouse): Effects on levels of galactosylceramidase, psychosine, and galactocerebrosides. Proc. Natl. Acad. Sci. USA 84: 4259–4263. Johnson, K. J. (1970). Globoid cell leukodystrophy in the cat. J. Am. Vet. Med. Assoc. 157: 2057–2064. Kobayashi, T., Yamanaka, T., Jacobs, J. M., Teixera, F., and Suzuki, K (1980). The twitcher mouse: An enzymatically authentic murine model of human globoid cell leukodystrophy (Krabbe disease). Brain Res. 202: 479–483. Kozac, M. (1989). The scanning model for translation: An update. J. Cell Biol. 108: 229–241. Louie, E., Rafi, M. A., and Wenger, D. A. (1991). Leukocyte sonicates as a source for both enzyme assay and DNA amplification for mutational analyses of certain lysosomal disorders. Clin. Chim. Acta 199: 7–16. Luzi, P., Rafi, M. A., and Wenger, D. A. (1995a). Structure and organization of the human galactocerebrosidase (GALC) gene. Genomics 26: 407–409.
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
Luzi, P., Rafi, M. A., and Wenger D. A. (1995b). Characterization of the large deletion in the GALC gene found in patients with Krabbe disease. Hum. Mol. Genet. 4: 2335–2338. Pritchard, D. H., Napthine, D. V., and Sinclair, A. J. (1980). Globoid cell leukodystrophy in polled Dorset sheep. Vet. Pathol. 17: 399– 405. Rafi, M. A., Luzi, P., Chen, Y. Q., and Wenger, D. A. (1995). A large deletion together with a point mutation in the GALC gene is a common mutant allele in patients with infantile Krabbe disease. Hum. Mol. Genet. 4: 1285–1289. Rafi, M. A., Fugaro, J., Amini, S., Luzi, P., de Gala, G., Victoria, T., Dubell, C., Shahinfar, M., and Wenger, D. A. (1996). Retroviral vector-mediated transfer of the galactocerebrosidase (GALC) cDNA leads to overexpression and transfer of GALC activity to neighboring cells. Biochem. Mol. Med. 58: 142–150. Sakai, N., Inui, K., Tatsumi, N., Fukushima, H., Nishigaki, T., Taniike, M., Nishimoto, J., Tsukamoto, H., Yanagihara, I., Ozono, K., and Okada, S. (1996). Molecular cloning and expression of cDNA for murine galactocerebrosidase and mutation analysis of the twitcher mouse, a model of Krabbe’s disease. J. Neurochem. 66: 1118–1124. Sanger, F., Nickelson, J., and Coulson, A. R. (1977). DNA sequencing with chain termination. Proc. Natl. Acad. Sci. USA 74: 5463–5467. Shapiro, E., Lockman, L., Kennedy, W., Zimmerman, D., Kolodny, E., Raghavan, S., Wiederschain. G., Wenger, D. A., Sung, J. H., Summers, C. G., and Krivit, W. (1991). Bone marrow transplantation as treatment for globoid cell leukodystrophy. In ‘‘Treatment of Genetic Disease’’ (R. J. Desnick, Ed.), pp. 221–236, ChurchillLivingstone, New York. Skoog, W. A., and Beck, W. S. (1956). Studies on the fibrinogen, dextran and phytohemagglutinin methods of isolating leukocytes. Blood 11: 436–454. Suzuki, K., and Suzuki, Y. (1970). Globoid cell leukodystrophy (Krabbe’s disease): Deficiency of galactocerebrosidase b-galactosidase. Proc. Natl. Acad. Sci. USA 66: 302–309. Suzuki, Y., Austin, J., Armstrong, D., Suzuki, K., Schlenker, J., and Fletcher, T. (1970). Studies in globoid cell leukodystrophy: Enzymatic and lipid findings in the canine form. Exp. Neurol. 29: 65– 75. Suzuki, Y., and Suzuki, K. (1971). Krabbe’s globoid cell leukodystrophy: Deficiency of galactocerebrosidase in serum, leukocytes, and fibroblasts. Science 171: 73–75. Victoria, T., Rafi, M. A., and Wenger, D. A. (1996). Cloning of the canine GALC cDNA and identification of the mutation causing globoid cell leukodystrophy in West Highland White and Cairn terriers. Genomics 33: 457–462. Wenger, D. A., and Williams, C. (1991). Screening for lysosomal disorders. In ‘‘Techniques in Diagnostic Human Biochemical Genetics’’ (F. A. Hommes, Ed.), pp. 587–617, Wiley-Liss, New York. Wenger, D. A., Rafi, M. A., and Luzi, P. (1997). Molecular genetics of Krabbe disease (globoid cell leukodystrophy): Diagnostic and clinical implications. Hum. Mutat., in press. Yeager, A. M., Brennan, S., Tiffany, C., Moser, H. W., and Santos, G. W. (1984). Prolonged survival and remyelination after hematopoietic cell transplantation in the twitcher mouse. Science 225: 1053–1054.
gnma
42, 319–324 (1997) GE974744
ARTICLE NO.
Characterization of the Rhesus Monkey Galactocerebrosidase (GALC) cDNA and Gene and Identification of the Mutation Causing Globoid Cell Leukodystrophy (Krabbe Disease) in This Primate Paola Luzi,* Mohammad A. Rafi,* Teresa Victoria,* Gary B. Baskin,† and David A. Wenger*,1 *Departments of Medicine (Medical Genetics) and Biochemistry and Molecular Pharmacology, Jefferson Medical College, Philadelphia, Pennsylvania 19107; and †Pathology Department, Tulane Regional Primate Research Center, Covington, Louisiana 70433 Received January 27, 1997; accepted March 31, 1997
Krabbe disease or globoid cell leukodystrophy (GLD) is a severe lysosomal disorder resulting from the deficiency of galactocerebrosidase (GALC) activity. This deficiency results in the insufficient catabolism of several galactolipids that are important in the production of normal myelin. Since the cloning of the human GALC cDNA and gene many disease-causing and polymorphic changes have been identified. This autosomal recessive disease has been reported to occur in several animal species, and recently the murine and canine GALC genes have been cloned. We now describe the cloning of the GALC cDNA and gene from the rhesus monkey and the identification of the mutation causing GLD in this species. The nucleotide sequence of the coding region and the gene organization were nearly identical to human. The deduced amino acid sequence of the monkey GALC was compared to the human, dog, and mouse, and it was found to be 97, 87, and 83% identical, respectively. The mutation causing GLD in the rhesus monkey is a deletion of AC corresponding to cDNA positions 387 and 388 in exon 4. This results in a frame shift and a stop codon after 46 nucleotides. A rapid method to detect this mutation was developed, and when 45 monkeys from this colony were tested, 22 were found to be carriers. The availability of this nonhuman primate model of GLD will provide unique opportunities to evaluate treatment for this severe disease. q 1997 Academic Press
INTRODUCTION
Krabbe disease or globoid cell leukodystrophy (GLD) is an autosomal recessively inherited lysosomal disorder resulting from mutations in the gene for galactocerebrosidase (GALC). These mutations result in low 1 To whom correspondence and reprint requests should be addressed at Division of Medical Genetics, 1100 Walnut Street, Room 410, Philadelphia, PA 19107. Telephone: (215) 955-1666. Fax: (215) 955-9554. E-mail: [email protected].
GALC activity in all tissues, which provides the basis for methods to diagnose new patients using easily obtained tissue samples (Suzuki and Suzuki, 1970, 1971). While most of the human patients present with symptoms before 6 months of age and die before 18 months of age, older patients, including adults, are also diagnosed with this disease. GALC catalyzes the lysosomal degradation of specific galactolipids including galactosylceramide, galactosylsphingosine (psychosine), monogalactosyldiglyceride, and, possibly, lactosylceramide. The abnormal accumulation of the first two glycolipids is responsible for the production of the characteristic globoid cells found on pathological examination of samples from nervous tissues from patients and the destruction of myelin-forming cells in the peripheral and central nervous systems. This disease is unique in having several naturally occurring animal models that can be used to examine pathogenetic mechanisms and to explore treatment options. These include the West Highland White (WHWT) and Cairn terrier (Fankhauser et al., 1963; Fletcher et al., 1966; Suzuki et al., 1970), a cat (Johnson, 1970), the polled Dorset sheep (Pritchard et al., 1980), the twitcher mouse (Kobayashi et al., 1980), and the rhesus monkey (Baskin et al., 1989). Recently, the murine and canine GALC cDNAs were cloned and sequenced, and the disease-causing mutations in these two species were determined (Sakai et al., 1996; Victoria et al., 1996). The mutation in the twitcher mouse consists of a G r A transition at cDNA position 1017, which changes codon 339 from tryptophan to stop, and the mutation causing GLD in both the WHWT and Cairn terrier is an A r C transversion at cDNA position 473, which changes codon 158 from tyrosine to serine. While these models have potential for numerous studies to understand and treat this disease, there would be considerable advantages to using a nonhuman primate for some investigations. In 1989 Baskin and co-workers (1989) reported that a newborn rhesus monkey died shortly after birth, and pathological changes compatible with
319
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
0888-7543/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.
gnma
320
LUZI ET AL.
a diagnosis of GLD were obtained. The mother had lower than normal GALC activity consistent with carrier status for GLD. Until recently, repeat matings with potential carrier males did not result in another affected offspring. Additional measurements of GALC activity identified some obvious carriers in this colony, and recent matings resulted in the birth of two affected monkeys by the original mother and her daughter. One died within 2 weeks after birth and the other lived for 5 months (manuscript in preparation). In this paper we present the cloning of the rhesus monkey GALC cDNA, the characterization of the GALC gene, and identification of the mutation causing GLD in these monkeys. More than 20 monkeys carrying the mutation have been identified in this colony by our rapid DNAbased test, and this will permit selective matings to obtain additional affected monkeys for study. The availability of a nonhuman primate model of a metabolic disorder provides a unique opportunity for studies to evaluate the effectiveness of several treatment options, including in utero and neonatal heterologous bone marrow transplantation (BMT) and autologous BMT using hematopoietic stem cells (HSC) corrected by insertion of the normal gene. MATERIALS AND METHODS Tissue samples. Skin biopsies and blood samples were taken from normal, carrier, and affected rhesus monkeys. Leukocytes were isolated using dextran sedimentation according to the method of Skogg and Beck (1956). Cultured skin fibroblasts were grown in Eagle’s minimal essential medium supplemented with 10% fetal calf serum and 2 mM glutamine. Measurement of GALC activity. GALC activity was measured using [3H]galactose-labeled galactosylceramide as previously described (Wenger and Williams, 1991). Cloning of the monkey GALC cDNA. Total RNA was isolated from cultured skin fibroblasts of a normal rhesus monkey according to the method of Chomczynski and Sacchi (1987). The RNA was reverse transcribed and amplified by polymerase chain reaction (PCR) using human primer pairs II to VI listed in Table 1. Amplification of all regions, except for the one utilizing primer pair II, was performed under the following conditions: initial denaturation, 967C for 1 min, followed by 30 cycles of 30 s, 947C, 30 s, 567C; and 1 min, 727C in the presence of 2.5 mM MgCl2 and 3% DMSO. The 5* end of the cDNA was amplified using primer pair II under the above conditions with 8% DMSO. PCR products were sequenced directly or cloned into the pCR II vector (Invitrogen) and sequenced by the dideoxy chain termination method (Sanger et al., 1977). To identify the 3 * end of the cDNA, total RNA was amplified using the RACE system (Gibco BRL) following the instructions of the manufacturer. Characterization of the monkey GALC gene. Genomic DNA was isolated from cultured skin fibroblasts and/or tissue samples from normal monkeys using standard methods. To determine the location and size of the introns, genomic DNA was subjected to long PCR (Gene Amp XL-PCR kit, Perkin–Elmer) using primers generated from exonic sequences. Amplified material was analyzed on 0.8% agarose gel in the presence of standard DNA markers. Intron sizes were estimated by comparison with marker fragments. The PCR products were subcloned into the pCR II vector and sequenced to determine the exon–intron boundaries. The 5* and 3* regions were obtained by PCR amplification of genomic DNA using primer pairs I and VII (Table 1), respectively, under the following conditions: 957C for 1 min followed by 30 cycles of 30 s, 947C, 30 s, 567C, and 1
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
TABLE 1 Oligonucleotide Primer Pairs Used for the Amplification of Monkey GALC cDNA Primer pair I II III IV V VI VII
Positiona (/ or 0)b 0787 19 023 786 653 1199 950 1687 1609 2088 1893 3195 3044 3932
(/) (0) (/) (0) (/) (0) (/) (0) (/) (0) (/) (0) (/) (0)
Sequence (5* to 3*) GGAAGACATCTTTCACATGG AACCCGCGGCGGCCGTCAT CCTGGCAACGCCGAGCGAA AGTGCTAAAGTCTTCAGAAGAC CTGCATCCATGCTCCTTGATGC GATCCCTTAAGAACAAAGGTGG GGCACTACGTGGTAGAATCTCC CAATGAACACACCTCCTGTGTC GGAGACTACAACTGGACCAATC GAAACAAGAATTGGCTCTGAACCAAAAC CAAGTCTCTGTGGACAGACATC CTTCAAAAGCAATGCAAAAC GTGGCTCTATGTAGCAAATC ATGACAACATGAAGCACTGAC
a Position numbers are from the cDNA sequence counting from the A of the initiation codon. b (/) sense; (0) antisense.
min, 727C in the presence of 2.5 mM MgCl2 and 5 and 3% DMSO, respectively. Characterization of the mutation causing GLD in rhesus monkeys. Genomic DNA was isolated from leukocyte sonicates of affected and carrier monkeys according to our published method (Louie et al., 1991), or from whole blood using the QIAamp blood kit (Qiagen). All exons and exon–intron boundaries were amplified using human intronic primers and sequenced directly. The mutation could also be found after RT-PCR amplification and sequencing of RNA isolated from an affected monkey. After the mutation was identified in the two affected monkeys, other members of the colony, including obligate heterozygotes, were analyzed for this mutation. Rapid test to identify the ‘‘AC’’ deletion. To detect this mutation, located in exon 4, genomic DNA samples were amplified using an engineered sense primer (5*-AGAAGAGGAATCCCAATAGTAC-3*) located in exon 4 and an antisense primer (5*-CCGTATTAATAGAGATTCCACCA-3*) from intron 4. The mismatched nucleotide (underlined) provides a restriction enzyme cut site for ScaI (AGT f ACT) in the mutated sequence of the 118-bp amplification product (resulting in 20- and 98-bp fragments after digestion). The 120-bp amplified fragment from normal sequence remains uncut. The products of digestion are analyzed on a 3% Metaphore gel (FMC).
RESULTS
Cloning of Monkey GALC cDNA The coding region of the rhesus monkey GALC cDNA consists of 2007 nt, the same as that in human and dog (Chen et al., 1993; Victoria et al., 1996). The cDNA sequence is available from GenBank under Accession No. U87628. As in the human and the dog, there is a suboptimal A at position /4 of the initiation codon (Kozac, 1989). Figure 1 shows the deduced amino acid sequence compared to human, dog, and mouse. The amino acids are 97% identical to human, 87% identical to dog, and 83% identical to mouse. The monkey GALC has seven potential glycosylation sites, including six in common with humans and dogs and an additional one at codon 435 (shown in boldface in Fig. 1). This addi-
gnma
MONKEY GALC GENE AND GLD-CAUSING MUTATION
321
FIG. 1. Deduced amino acid sequences of the human, monkey, dog, and mouse GALC cDNAs. Only the amino acids that differ from human are shown; the identical amino acids are indicated by a dash. The potential glycosylation sites, six in human and an additional one in the monkey, are indicated by a boldface N. The three human polymorphisms are shown as amino acids above the human sequence at positions 168, 224, and 546. The arrow denotes the start of the coding region for the 30-kDa subunit. The asterisk at amino acid 508 in the mouse denotes the three missing nucleotides at that position.
tional potential glycosylation site is only 1 amino acid before the start of the 30-kDa subunit found in purified human GALC. The 26-amino-acid signal peptide is identical to human except for the change of phenylalanine for leucine at codon 15. That is the only amino acid different from human until codon 199. Three polymorphisms in the coding region of human GALC have been found (shown in Fig. 1), and the monkey has only the most common human sequence. Results from 3* RACE analysis revealed that monkeys utilize two polyadenylation signals. One is the same as human, and the other, located about 400 bp upstream, is present but apparently not used in humans. Characterization of the Monkey GALC Gene As shown above there was a high level of identity between the monkey and the human GALC cDNAs. This was also true with regard to the gene organization. The organization of the human GALC gene was previously published (Luzi et al., 1995a). Table 2 shows the sizes and location of each exon in the monkey (Accession Nos. U87463 to U87477). The lengths of the exons were identical to human, and the estimated lengths of the introns were nearly identical to human except for introns 8 and 10. All introns follow the gt-ag rule, and the sequences at the boundaries were nearly
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
identical to those found in the human GALC gene. Eight hundred basepairs of the 5* untranslated region were sequenced (Accession No. U87463) and found to be 93% identical to human. The first 180 nucleotides upstream from the initiation ATG were the most conserved, showing only eight changes from the human sequence. The 3*-untranslated region of the monkey gene amplified from genomic DNA revealed an insertion of 330 bp not present in the human gene, starting 601 bp after the stop codon. Characterization of the Mutation Causing GLD in Rhesus Monkeys The two affected monkeys were found to have GALC activity less than 2% of normal in leukocytes and cultured skin fibroblasts (manuscript in preparation). Amplification and sequencing of all exonic regions of an affected monkey resulted in the identification of the deletion of the AC dinucleotide corresponding to cDNA positions 387 and 388 (Fig. 2). The affected monkeys were homozygous for this mutation, as expected for this inbred colony of monkeys. This mutation, located in exon 4, results in a frame shift leading to a stop codon 46 bp after the deletion. Figure 3 shows the nucleotide sequence and deduced amino acid sequence in the region of the AC deletion. This deletion also was found
gnma
322
LUZI ET AL.
TABLE 2 Sizes and Locations of Exons and Introns and Sequences at Exon–Intron Boundaries Sequences at exon–intron boundaries Exon
Exon size (bp)
Location of introna
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
ú500 69 64 114 140 39 131 156 125 128 90 87 151 181 164 77 2177b
147 216 280 394 534 573 704 860 985 1113 1203 1290 1441 1622 1786 1863
a b
5* border GGCGGCGGGgtgagcggcg. CTCTTTAAGgtaatgaaaa. AGACAACAGgtaggaggat. CACTCATTGgtaagaaatg. TATATTGGAgttagtaata. TACATTAAGgtgtgtacaa. TGTTATAGGgtaaggcatg. TATGACTTCgtaagttatt. GGGTGTCAGgtatggttca. GAAACCATGgtaaactttt. GGATCTTTTgtaagtaaat. TCTCTATGGgtaattttaa. TCAATGTTGgtgagtattt. CTACAACTGgtaagattga. GGGATTTAGgtaagtgact. ACTATTAAGgtaggtattg.
3* border . . . . . . . . . . . . . . . .
.atttttttagGCAACCTCC .cttttcacagCCGAATTTT .ctctattcagATGGCACTG .ctctctgcagGGTTGCCAT .tgttttgcagATTTGGAAT .actccaaaagATATTAAGA .tttttcctagGGCTCATTA .catcttttagCACAATCGC .ttttctatagCTCATACCA .tttttttcagAGTCATAAA .ttctttacagAGTGAAATA .tctttttcagCTCCTCGAC .ttctgaacagATTACCCAT .tattttgcagGACGAATCT .tgtgttacagCTGGATGGA .tctactccagGGTCGTTTT
Intron size (kb) 4.3 0.246 1.5 1.8 2.1 5.8 7.4 3.0 1.9 9.0 0.7 1.9 2.0 3.9 1.4 4.8
Counting from the A of the initiation codon in cDNA. To the second polyadenylation signal.
by RT-PCR amplification and sequencing of RNA from the cultured skin fibroblasts of an affected monkey. Rapid Method to Detect the Mutation in the Rhesus Monkey Colony To screen the other members of this colony rapidly, and to identify affected fetuses and infants for therapy trials, a simple test to identify this mutation was developed. Samples of genomic DNA were amplified using the primers presented under Materials and Methods, followed by digestion with ScaI. The normal 120-bp fragment was not cut by this enzyme; however, the 118-bp amplification product from the mutant allele was cut into 20- and 98-bp fragments (Fig. 4). Using this method, 45 rhesus monkeys were screened; 22 were found to be heterozygous for this mutation and 23 were found to be homozygous normal.
FIG. 2. Partial sequence of genomic DNA from a normal monkey and a monkey affected with GLD. The two asterisks denote the two nucleotides missing in the affected monkey.
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
DISCUSSION
This paper describes the cloning of the monkey GALC cDNA, characterization of the GALC gene, and identification of the mutation causing GLD in this colony of rhesus monkeys. The sequence of the 2007 nucleotide GALC cDNA and the deduced amino acid sequence are 97% identical to human (Fig. 1). Except for the additional potential glycosylation site, the monkey GALC is nearly identical to human. As the monkey GALC has not been purified, it is not known if the 80kDa precursor is processed into 50- to 52-kDa and 30kDa subunits like human GALC (Chen and Wenger, 1993). However, the GALC activity measured in leukocytes and cultured skin fibroblasts is very similar in these two species. The monkey GALC gene was characterized, and in almost all respects it resembles the human GALC gene (Luzi et al., 1995a). As in humans, intron 10 is the largest (approximately 12 kb in humans and 9 kb in monkeys), and intron 2 is the smallest. The 5* UTR is GC-rich and is highly conserved in the first 180 nucleotides preceding the initiation codon, where moderately strong promoter activity was detected in the human gene (Luzi et al., manuscript in preparation). Before the recent birth of affected monkeys, an attempt was made to find the disease-causing mutation in this colony. Initially, RNA was isolated from cultured skin fibroblasts from the obligate carrier mother and sequenced following RT-PCR. Only normal sequence was obtained, indicating that the mutation probably resulted in low GALC mRNA. After the birth of an affected monkey, RNA and DNA could be isolated from tissue samples and cultured skin fibroblasts. Using primers generated from sequences in the introns of
gnma
MONKEY GALC GENE AND GLD-CAUSING MUTATION
323
FIG. 3. Partial nucleotide sequences and deduced amino acid sequences of a normal monkey and a monkey affected with GLD showing the effect of the deletion of the AC at cDNA positions 387 and 388 (underlined). The deletion results in 15 different amino acids followed by a stop codon (double underlined).
the human GALC gene, all exonic regions were amplified and sequenced and compared to the sequence from a normal, noncarrier monkey. The affected monkey was found to have a deletion of two nucleotides in exon 4 (Fig. 2). The carrier mother was found to be heterozygous for this mutation. This mutation results in a frame shift and a stop codon after 15 different amino acids. Due to the unstable nature of mRNAs not fully translated, it is not surprising that we detected no mutant GALC mRNA in the RT-PCR products of the obligate carrier mother. Her normal mRNA may be present in much higher concentration than the mutant mRNA. Using our test for the mutation we have identified 22 carriers within the colony. It would be interesting to determine if this mutation is present in any other colony of rhesus monkeys or in the wild. Using the simple method presented here, DNA samples from any monkey could be easily tested. Clinically these monkeys resemble human patients with the infantile form of Krabbe disease who have onset of symptoms within the first 3–6 months of life and die by about 1 year of age. This is not surprising since the AC deletion in exon 4 results in a premature stop codon and inactive, shortened GALC. About 40% of the mutant alleles in human patients consist of a 30-kb deletion starting within intron 10 and continuing beyond the polyadenylation signal (Rafi et al., 1995; Luzi et al., 1995b). This deletion results in the production of no active enzyme due to the loss of the coding region for the 30-kDa subunit and 15% of the 50-kDa subunit. Over 40 disease-causing mutations have been identified in human patients with GLD (for review see Wenger et al., 1997). Five mutations have been identified in exon 4, 4 are missense mutations, and 1, at cDNA position 382, is the deletion of an A leading to a frame shift and premature stop codon. The deletion mutation was found in one allele, along with a known ‘‘mild’’ allele (G809A, G270D), in a patient with juve-
nile Krabbe disease. It is obvious from mutation analysis in human patients that both subunits, derived from the 80-kDa precursor, are needed to produce active enzyme. Severe mutations in either subunit can produce GLD, although the clinical presentation will vary with the nature of the mutations in both alleles. The characterization of the GALC gene in a nonhuman primate, and the identification of the disease-causing mutation in rhesus monkeys with GLD, opens the way to their use in therapy trials. There is no other primate model of a metabolic disorder available for study. At this time more than 10 human patients with GLD have undergone BMT, and, while some have died due to complications, some have demonstrated a stabilization of their clinical course (Shapiro et al., 1991; unpublished data). One attempt at in utero BMT in a fetus predicted to be affected with Krabbe disease resulted in fetal death. However, there was evidence for engraftment in fetal liver tissue (Bambach et al., 1997). Bone marrow transplantation of the twitcher mouse model has demonstrated prolonged survival of mice transplanted early in life (Yeager et al., 1984; Ichioka et al., 1987; Hoogerbrugge et al., 1988a,b). However, these mice eventually die with biochemical and pathological features of GLD, indicating that therapy must be instituted earlier in development, possibly in utero, or that a higher level of donated GALC activity must be provided from the donor cells. The rhesus monkey model could be used to investigate in utero BMT following early prenatal diagnosis and heterologous BMT early in life. In addition, the monkeys will be used in studies to investigate gene therapy, initially using hematopoietic stem cells transduced with our retroviral construct containing the human GALC cDNA (Rafi et al., 1996). Similarities between the human and the monkey hematopoietic systems make this study possible in the near future. Transduced cells overexpressing GALC activity have been shown to donate GALC actively to neighboring cells, where it is rapidly taken up (Rafi et al., 1996). These studies on the rhesus monkey model of GLD provide the foundation for future attempts at treating this severe genetic disease.
ACKNOWLEDGMENTS FIG. 4. A 3% Metaphore gel showing the results of PCR amplification and ScaI digestion of the amplified fragments of a normal monkey (NI), a carrier monkey (Het), and an affected monkey (Aff). U, the uncut fragment; C, the cut fragment; M, size marker.
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
This research was supported in part by grants from the National Institutes of Health (D.A.W., DK38795 and G.B.B., RR-00164). The authors gratefully acknowledge the excellent technical assistance of H. Zhi Rao, H. Xian Shen, Caren Dubell, and Maryam Shahinfar.
gnma
324
LUZI ET AL.
REFERENCES Bambach, B. J., Moser, H. W., Blakemore, K. J., Corson, V. L., Griffin, C. A., Noga, S. J., Perlman, E. J., Zuckerman, R., Wenger, D. A., and Jones, R. J. (1997). Engraftment following in utero bone marrow transplantation for globoid cell leukodystrophy. Bone Marrow Transplant. 19: 399–402. Baskin, G., Alroy, J., Li, Y-T., Dayal, Y., Raghavan, S. S., and Sharer, L. (1989). Galactosylceramide-lipidosis in Rhesus monkeys. Lab. Invest. 60: 7A. Chen, Y. Q., and Wenger, D. A. (1993). Galactocerebrosidase from human urine: Purification and partial characterization. Biochim. Biophys. Acta 1170: 53–61. Chen, Y. Q., Rafi, M. A., deGala, G., and Wenger, D. A. (1993). Cloning and expression of cDNA encoding human galactocerebrosidase, the enzyme deficient in globoid cell leukodystrophy. Hum. Mol. Genet. 2: 1841–1845. Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162: 156–159. Fankhauser, R., Luginbuhl, H., and Hartley, W. J. (1963). Leukodystrophie vom typus Krabbe beim hund. Schweiz Arch Tierheilkd. 105: 198–207. Fletcher, T. F., Kurtz, H. J., and Low, D. G. (1966). Globoid cell leukodystrophy (Krabbe type) in the dog. J. Am. Vet. Med. Assoc. 149: 165–172. Hoogerbrugge, P. M., Poorthuis, B. J., Romme, A. E., van de Kamp, J. J., Wagemaker, G., and van Bekkum, D. W. (1988a). Effect of bone marrow transplantation on enzyme levels and clinical course in the neurologically affected twitcher mouse. J. Clin. Invest. 81: 1790–1794. Hoogerbrugge, P. M., Suzuki, K., Suzuki, K., Poorthuis, B. J. H. M., Kobayashi, T., Wagemaker, G., and Bekkum, D. W. V. (1988b). Donor derived cells in the central nervous system of twitcher mice after bone marrow transplantation. Science 239: 1035–1038. Ichioka, T., Kishimoto, Y., Brennan, S., Santos, G. W., and Yeager, A. M. (1987). Hematopoietic cell transplantation in murine globoid cell leukodystrophy (the twitcher mouse): Effects on levels of galactosylceramidase, psychosine, and galactocerebrosides. Proc. Natl. Acad. Sci. USA 84: 4259–4263. Johnson, K. J. (1970). Globoid cell leukodystrophy in the cat. J. Am. Vet. Med. Assoc. 157: 2057–2064. Kobayashi, T., Yamanaka, T., Jacobs, J. M., Teixera, F., and Suzuki, K (1980). The twitcher mouse: An enzymatically authentic murine model of human globoid cell leukodystrophy (Krabbe disease). Brain Res. 202: 479–483. Kozac, M. (1989). The scanning model for translation: An update. J. Cell Biol. 108: 229–241. Louie, E., Rafi, M. A., and Wenger, D. A. (1991). Leukocyte sonicates as a source for both enzyme assay and DNA amplification for mutational analyses of certain lysosomal disorders. Clin. Chim. Acta 199: 7–16. Luzi, P., Rafi, M. A., and Wenger, D. A. (1995a). Structure and organization of the human galactocerebrosidase (GALC) gene. Genomics 26: 407–409.
AID
GENO 4744
/
6r36$$$241
05-08-97 23:47:44
Luzi, P., Rafi, M. A., and Wenger D. A. (1995b). Characterization of the large deletion in the GALC gene found in patients with Krabbe disease. Hum. Mol. Genet. 4: 2335–2338. Pritchard, D. H., Napthine, D. V., and Sinclair, A. J. (1980). Globoid cell leukodystrophy in polled Dorset sheep. Vet. Pathol. 17: 399– 405. Rafi, M. A., Luzi, P., Chen, Y. Q., and Wenger, D. A. (1995). A large deletion together with a point mutation in the GALC gene is a common mutant allele in patients with infantile Krabbe disease. Hum. Mol. Genet. 4: 1285–1289. Rafi, M. A., Fugaro, J., Amini, S., Luzi, P., de Gala, G., Victoria, T., Dubell, C., Shahinfar, M., and Wenger, D. A. (1996). Retroviral vector-mediated transfer of the galactocerebrosidase (GALC) cDNA leads to overexpression and transfer of GALC activity to neighboring cells. Biochem. Mol. Med. 58: 142–150. Sakai, N., Inui, K., Tatsumi, N., Fukushima, H., Nishigaki, T., Taniike, M., Nishimoto, J., Tsukamoto, H., Yanagihara, I., Ozono, K., and Okada, S. (1996). Molecular cloning and expression of cDNA for murine galactocerebrosidase and mutation analysis of the twitcher mouse, a model of Krabbe’s disease. J. Neurochem. 66: 1118–1124. Sanger, F., Nickelson, J., and Coulson, A. R. (1977). DNA sequencing with chain termination. Proc. Natl. Acad. Sci. USA 74: 5463–5467. Shapiro, E., Lockman, L., Kennedy, W., Zimmerman, D., Kolodny, E., Raghavan, S., Wiederschain. G., Wenger, D. A., Sung, J. H., Summers, C. G., and Krivit, W. (1991). Bone marrow transplantation as treatment for globoid cell leukodystrophy. In ‘‘Treatment of Genetic Disease’’ (R. J. Desnick, Ed.), pp. 221–236, ChurchillLivingstone, New York. Skoog, W. A., and Beck, W. S. (1956). Studies on the fibrinogen, dextran and phytohemagglutinin methods of isolating leukocytes. Blood 11: 436–454. Suzuki, K., and Suzuki, Y. (1970). Globoid cell leukodystrophy (Krabbe’s disease): Deficiency of galactocerebrosidase b-galactosidase. Proc. Natl. Acad. Sci. USA 66: 302–309. Suzuki, Y., Austin, J., Armstrong, D., Suzuki, K., Schlenker, J., and Fletcher, T. (1970). Studies in globoid cell leukodystrophy: Enzymatic and lipid findings in the canine form. Exp. Neurol. 29: 65– 75. Suzuki, Y., and Suzuki, K. (1971). Krabbe’s globoid cell leukodystrophy: Deficiency of galactocerebrosidase in serum, leukocytes, and fibroblasts. Science 171: 73–75. Victoria, T., Rafi, M. A., and Wenger, D. A. (1996). Cloning of the canine GALC cDNA and identification of the mutation causing globoid cell leukodystrophy in West Highland White and Cairn terriers. Genomics 33: 457–462. Wenger, D. A., and Williams, C. (1991). Screening for lysosomal disorders. In ‘‘Techniques in Diagnostic Human Biochemical Genetics’’ (F. A. Hommes, Ed.), pp. 587–617, Wiley-Liss, New York. Wenger, D. A., Rafi, M. A., and Luzi, P. (1997). Molecular genetics of Krabbe disease (globoid cell leukodystrophy): Diagnostic and clinical implications. Hum. Mutat., in press. Yeager, A. M., Brennan, S., Tiffany, C., Moser, H. W., and Santos, G. W. (1984). Prolonged survival and remyelination after hematopoietic cell transplantation in the twitcher mouse. Science 225: 1053–1054.
gnma