Characterization of two genes encoding a fifth so far unknown pheromone of Euplotes octocarinatus

Europ. J. Protisto!. 35, 225-230 (1999) June 21, 1999 http://www.urbanfischer.de/journalslejp

European Journal of

PROTISTOLOGY

Characterization of Two Genes Encoding a Fifth so Far Unknown Pheromone of Euplotes octocarinatus Matthias M611enbeck and Klaus Heckmann Institut fur AllgemeineZoologie und Genetik, universitat MOnster, SchloBplatz 5, D-48149 MOnster, Germany; Fax: +49-251-8324723; e-mail: [email protected]

Summary Two new stocks of the hypotrichous ciliate Euplotes octocarinatus isolated in Pennsylvania and Florida/USA were identified as members of a new mating type XI (mt'rnt") secreting a so far unknown pheromone 5. As deduced from their pheromone encoding genes, the pheromones secreted by the two stocks differ from each other by 14 amino acids and a few silent mutations. Their 5'-non-coding sequences are almost identical with the 5'-non-coding sequences of the pheromone genes 1 to 4. This holds also true for the prepro-sequences which contain a 16 amino acids long ERimport signal. The 3'-non-coding sequences are also highly conserved. Like the other pheromone encoding genes the two rnt" alleles contain in-frame TGA stop codons, probably encoding cysteines. Both genes are interrupted by three introns in positions which are homologous to those in the other pheromone genes. Intron 1 of the stock from Florida is 143bp longer than intron 1 of the stock from Pennsylvania. Indirect evidence suggests that the two stocks do not belong to E. octocarinatus syngen 1. In this respect the two stocks resemble two other stocks isolated in North America which we have previously investigated. Whether the two stocks belong to the same syngens as the other two North American stocks is unclear. Key words: Euplotes octocarinatus; Hypotrichous ciliate; Pheromone genes; Mating type system; UGA encoded cysteines.

Introduction We reported recently that the morphological species Euplotes octocarinatus is composed of reproductively isolated mating groups or syngens and that the stocks and their progeny with which our previous work on mating types and pheromones has been performed were assigned to a syngen 1 of this species complex [3J. The stocks of syngen 1 were isolated from two freshwater fish aquariums in Germany and may have been © 1999 by Urban & FischerVerlag

imported from Central America with the fish [8]. From Europe, E. octocarinatus has never been reported. Ef. forts from our side to find members of this species complex in Germany have been unsuccessful. 10 mating types are distinguished in E. octocarinatus syngen 1. They are determined by four codominant alleles (mt', me, mt', me), six mating types by the heterozygous combinations of these alleles, and four mating types by their homozygous combinations. Each of these alleles governs the production of another pheromone or gamone (Phd, Phr2, Phr3, Phr4) [7, 8J. The pheromones attract potential mates and induce cells of other mating types to prepare for conjugation [10, 13]. The fact that mature cells of the 10 mating types respond to all pheromones except to those they secrete themselves is rationalized by assuming that mating competence is specified by pheromone-specific receptors and that cells express receptors only for those pheromones which they do not synthesize themselves [8, 9J. All four pheromones have been isolated [16, 19J. They are cysteine-rich polypeptides with an average length of about 100 amino acids [2, 11, 12, 18]. Recently, several new stocks of the E. octocarinatus species complex were collected in North America and two of them (FI-12 and CC-Jrwere analyzed in more detail [3J. Although these tWo stocks turned out not to belong to syngen 1, their ~ells nevertheless reacted like cells of syngen 1 to the pheromones secreted by the 10 standard tester lines of E. octocarinatus syngen 1, each of them representing another mating type. This allowed us to determine the mating types of the newly collected stocks. It was found that the cells of stock CC-4 express mating type VII which is determined by the mating type allele mt" for which this mating type is homozygous (the asterisk indicates that the allele is slightly different from the corresponding one in syngen 1). Cells of stock FI-12 were found to express mating type VI which is determined by the allele combination me' 0932-4739/99/35/02-225 $ 12.00/0

226

M. Mollenbeck and K. Heckmann

me'. The isolation and sequencing of the three mating type alleles of the North American stocks showed that the pheromones encoded by them were very similar to the pheromones 1,2 and 3 known from syngen 1. To indicate the differences they are marked by an asterisk

(Phrl ", Phrz", Phr.I").

The purpose of this investigation was to analyze the pheromone genes of two other stocks (DM-5 and EG20-11) also collected in North America. When cells of these stocks were mixed with the standard testers of E. octocarinatus syngen 1 pair formation was observed in all 10 combinations but not when cells of these two stocks were mixed with each other, indicating that the new stocks express a new so far unknown mating type, tentatively designated as mating type XI. Like the two previously studied stocks, isolated in North America, the stocks DM-5 and EG20-11 do not belong to syngen 1. The mating type allele determining this new mating type is named mt" and the corresponding pheromone, Phrfi", Since the new type of pheromone secreted by the two new stocks is recognized by cells of syngen 1, it appears likely that a mating type allele mt" occurs also in E. octocarinatus syngen 1.

Material and Methods Cells and culture conditions: Stock DM-5 was collected by C. Quinn in Pennsylvania and kindly provided to us by T. Kosaka. Stock EG20-11 was isolated by one of us (K. H.) in the Everglades, Florida. Both stocks belong to the E. oetocarinatus species complex but not to syngen 1. For mating type tests the following cell lines of E. octocarinatus syngen 1 were employed: 25(15)-1, 11-11, 27(11)-III, 5(20)-IV, 15(28)-Y, 1(6)-VI, 69(1)-VII, 68(2)-VIII, 3(58)-IX, 71(2)-X (the roman number indicates the mating type of a cell line). All cells were grown in Fernbach flasks in SME medium as described by Freiburg [5], using the photosynthetic flagellate Chlorogonium elongatum as food source. Escherichia coli was grown in Luria-Bertani medium. E. coli strain DH-5a (Promega, Heidelberg, Germany) was used for plasmid propagation. Mating type test: Cells were concentrated by gentle centrifugation (300 x g; 30 s) two days after the last feeding and then suspended in new medium at a density of 1-2 x 103 cells per ml, Pair formation was induced by mixing cells of two different mating types (about 500 cells of each mating type in 0.5 ml) or by adding cell free fluid of one mating type to cells of the other mating type. These mixtures were incubated at 26°C for at least 5-6 h. Experiments analyzing the chemoattraction between cells of the stock DM-5 and different standard cell lines were carried out as described elsewhere [10]. Evaluation of the plates took place after 5, 6, 8 and 24 h. Isolation of RNA: Total RNA was isolated from 2 x 107 cells of stock DM-5 with an mRNA isolation system (BRL, Eggenstein,Germany). Polyf A)" RNA was prepared by affinity chromatography on oligo(dT)-cellulose (BRL) as described by Aviv and Leder [1], with the exception that morpholinopropanesulfonic acid (MOPS) was used as buffer instead of Tris.

Polymerase chain reaction: DNA was amplified enzymatically based on the method of Saiki et al. [f4] with thermostable Taq DNA polymerase in a DNA thermal cycler (Perkin Elmer, Uberlingen, Germany). Amplifications were performed using 50 ng of genomic DNA prepared from Euplotes cells as described previously [6, 12]. PCRs were carried out in a total volume of 100 pi containing 10 mM Tris-HCI, pH 8.3, 50 mM KCl, 2.5-3 mM MgCI 2, 100 pM of each dNTP, 0.25 pM of two pheromone specific oligonucleotides or of one pheromone specific in combination with a telomere specific oligonucleotide and 2.5 U of Taq DNA polymerase. For amplification the reaction mixtures were denatured at 94°C for 4 min, followed by 30 cycles of 1 min at 94 DC, 1 min at 55°C,2 min at 72 DC and finally 5 min at 72 DC. PCR products were analyzed by agarose gel electrophoresis. The following primers were used for amplification: Te: 5' CCCCAAAACCCCAAAACCCCAAAAC 3' (phr5'H and phr5'f'2) D1: 5' CGGAATTCATGAAAGCCATTTTCAT 3' (phr5'~'l and phr5'~'Z) D2: 5'TGATGCTCATATGTTGGTCC 3' tpbri":' and phr5"-'Z) D3: 5' TTGAACTGAGTTAGTAC 3' (phrY·l) D4: 5' GCAATTGAGGATACGAGTTTGGC 3' (phrY'l and phr5"--2) D5: 5' CTTCAGACAGACAAGTA 3' (phrY'l and phr5'~·2) Ul: 5' GGGATCCTTACTTGTCTGTCTGAAG 3' (phr5':'·1 and phr5""2) U2: 5' GATACAAAGCATGAAGCC 3' (phr5"--1 and phr5'f'2) Sl: 5'TAAGCTCCAGTCTCAGATCC 3' (phr5'f.l) AP: 5' GGCCACGCGTCGACTAGTAC(T)17 3' (phr5'H) UAP: 5' CUACUACUACUAGGCCACGCGTCGACTAGTAC 3' (phr5'H) Synthesis of pheromone eDNA by reverse transeriptase (RT)-PCR: For RT-PCR the 3'-RACE system for Rapid Amplification of £DNA Ends (BRL) was used. One pg of poly(A)+-RNA of stock DM-5 was transcribed reversely using an oligo dT-primer and reverse transcriptase as suggested by the manufacturer. Two pi of this first-strand eDNA were subjected to PCR using pheromone specific primers. Water instead of first -strand DNA was used for the control reaction. SubcIoning and sequencing: All PCR products were cloned into the double-stranded 'plasmid-vector pGEM-T 52f( +) (Promega). Preparation of the plasmid DNA was carried out with a Qiagen (Dusseldorf, Germany) plasmid kit. Positive clones were sequenced by the dideoxy chain-termination method [15]. Southern hybridization: Total DNA of stock DM-5 (about 8 pg) was separated on 0.8% (w/v) native agarose gels and blotted onto nylon membranes by the method of Southern [17]. Filters were incubated for at least 2 h at 68 DC in prehybridization solution (0.25 M Na2HP04, pH 7.2, 1 mM EDTA, 20% (w/v) SDS and 0.5% (w/v) blocking reagent for nucleic acid hybridization from Boehringer Mannheim, Mannheim, Germany). The pheromone specific probe was labeled with digoxigenin (DIG)-dUTP (DNA Labeling and Detection Kit Nonradioactive, Boehringer Mannheim). Hybridizations were carried out at 68 DC for about 16 h. The hybridization filters were washed three times in washing buffer (20 mM Na2HP0 4 , 1 mM EDTA and 1% (w/v) SDS) at 68 DC for 20 min each. Detection was done by enzyme-catalysed chemiluminescence using CSPD as substrate [4].

A fifth E. octocarinatus pheromone

Materials: Restriction enzymes were from Boehringer Mannheim, BRL and Promega. The sequenase version 2.0 DNA sequencing kit was purchased from USB (Bad Homburg, Germany). E. colistrain DH-5a was also obtained from Promega. All chemicals used were of analytical grade and were supplied by Boehringer Mannheim, Pharmacia LKB (Freiburg, Germany) and Sigma (Deisenhofen, Germany).

Results and Discussion Mating types of the new stocks To determine the mating types expressed by stocks DM-5 and EG20-11 we mixed cells of these stocks with cells of the 10 standard tester strains of E. octocarinatus syngen 1. We observed pair formation in all combinations. This indicated that both stocks expressed a new, so far not observed mating type. Since no mating reaction could be observed when we mixed cells of stock DM-5 with those of stock EG20-11 we had to conclude that both stocks express the same mating type. We tentatively call it mating type XI. We also tested whether the pheromones released by the cells of stocks DM-5 and EG20-11 were able to induce homotypic pairs in cells of the 10 mating types of syngen 1 and whether cells of the new stocks were attracted by pheromones released by our standard tester lines. Both was found to be the case. At this stage it was not possible to decide whether the two stocks are homozygous for a new mating type allele or whether they carry in addition another new allele. It was only certain that they both express the same new mating type and that they release at least one new pheromone. The number of pairs formed in mixtures of cells of the new stocks with cells of our standard testers was found to be smaller than in controls performed by mixing cells of different mating types of E. octocarinatus

227

syngen 1 and the time interval from mixing of the cells to the onset of pair formation lasted longer than in mixtures of cells of syngen 1. In addition we observed premature separation in many of the pairs formed after mixing cells of stock DM-5 or stock EG20-11 with cells of the various mating types of syngen 1. This, together with experiences from trying to cross breed other stocks collected in North America with cells of our standard lines [3] suggests that stocks DM-5 and EG2011 do not belong to E. octocarinatus syngen 1 as had been found for the other stocks. We have not tested whether the stocks DM-5 and EG20-11 belong to one of the syngens of the other North American stocks. Here we are only concerned with the question whether the two new stocks secrete new pheromones and in which respect they differ from the pheromones known so far.

Isolation of the pheromone genes Sequencing of the genes encoding the pheromones 1 to 4 of E. oetocarinatus syngen 1 had shown that they are located on macronuclear chromosomes with an average length of 1700 bp and that their 5'-non-coding sequences are highly conserved. Well conserved between the different types of pheromones known so far are also the prepro-sequences and the first introns [12, 18]. The same was found to be the case when we sequenced the three pheromone genes present in two previously studied North American stocks [3]. Assuming that the pheromone genes of our new stocks did not deviate in this respect from the so far known pheromones, we used primers for their amplification which were specific for these conserved regions in combination with telomere specific primers. After sequencing of the peR products obtained in this way, oligonucleotides specific for the new pheromone gene were synthesized. With

Phr 5*-1

.. I

Te

01

tm{l

..

[Xl

D2

..

51

R${${~ 12

II

...

D4

D5

..

..

wa 131Wda

I

Te

U1

U2

Phr 5*,"2

..

• Te

D1

rg~

..

D2

..

U2

...

D4

II

mS~12~I3~

...

D5

..

U1

•.. Te

Fig. 1. The macro nuclear chromosomes carrying the pheromones of stocks DM -5 (Phr5 "'-I) and EG20-11 (Phr5 "-Z). The black boxes refer to the telomeres (Te). Areas filled with pattern ind icate the coding sequences of the pheromones. Stippled boxes stand for the prepro-sequences; striped boxes stand for the sequences encoding the secreted pheromones. The open boxes refer to 5'- and 3'-non-coding areas and introns (I). The arrows indicate the primers used for PCRs.

228

M . M ollenbeck and K. Heckmann

their help further PCR fragments were isolated and also sequenced. From genomic DNA of stock DM-S two PCR products were obtained with the primer combinations Te-U2 and DS-Te (Fig. 1). These fragments represented the 5'- and 3'-ends of the pheromone encoding macronuclear chromosome of stock DM-5. Further PCR products containing parts of the coding region, the 3'-non-coding region and the introns of the pheromone gene were amplified using the primer combinations DI-Vl, D1-U2, D2 -Ul, D3-Vl, 51-VI and D4- Te. The total macronuclear chromosome was then constructed from overlapping PCR products. The same procedure was used to isolate and sequence the pheromone encoding macro nuclear chromosome of stock EG2 0-11 (Fig. 1). No evidence for the existence of a second pheromone gene was found neither in stock DM-S nor in stock EG20-11. We therefore assume that

Table 1. Comparison of homologous regions of the macro nuclear chromosomes of E. oetocarinatus carrying the pheromone genes phr5 ~'-1 and phT5 ~·-2 . length degree of identity phr5 'H phr5',-2 phrY -I/ phr5 *-2 macronuclear 1616 bp chromosome" 5'-non-coding region 162 bp 3'-non-coding region 505 bp prepro-sequence 52 aa intron 1 371 bp intron 2 48bp intron 3 47bp exon 1 66 bp exon2 283 bp exon 3 48 bp exon 4 86 bp 108 aa mature pheromone

1765 bp

89% [97%]

162 bp 508 bp 52 aa 514 bp 50bp 45 bp 66 bp 286 bp 48 bp 86 bp 109 aa

99% 96% 100% 67% [93%] 94% 89% 100% 95% 100% 100% 96%

including telomere sequences identities in square brackets tak e into account the deviating lengths of the first intron

+

the two stocks are homozygous with respect to their macronuclear pheromone genes and that they both secrete the same new type of pheromone which we name Phrfi" (the asterisk indicates that the pheromone is produced by cells not belonging to syngen 1). To be able to distinguish between the pheromones of the two stocks we name the pheromone produced by stock DM-S, PhrS 'H and the one produced by stock EG20-11, Phr5'~-2. The pheromone encoding gene of stock DM-s is called pbrs":', the gene encoding the pheromone in stock EG20-11 is called phrS';·-z. Comparison of the sequences of the two pheromone encoding macronuclear chromosomes (Table 1) revealed a total length of 1616 bp for the chromosome of stock DM-S and a length of 176S bp for the chro mosome of stock EG20-11. The two macro nuclear chromosomes show nearly identical non-coding regions (S'non-coding: 99% identity, 3'-non-coding: 96% identity). Like the previously sequenced pheromone genes (see Table 2 for the genes encoding pheromones 1 to 4) the two new ones consist of four exons flanked by S'and 3' -non-coding regions which end in C 4A4 telorneric repeats. Each pheromone sequence is preceded by a pre-sequence coding for a typical Ell-signal of 16 amino acids and a pro-sequence which may become cleaved off during secretion. Di sregarding 143 bp which are missing in intron 1 of the gene encoding PhrS ::--t even the introns of the two genes are very similar (Table 1). Analysis of the amino acid sequences deduced from the pheromone genes of the two stocks and their com parison with the known pheromones of E. octocarinatus syngen 1 [3, 11, 12, 18] showed that the two pheromones indeed belong to a new type of pheromone (Fig. 2). They have an identical prepro-sequence. In the sequences encoding the mature pheromones in po sition 168 a cytosine in phrS,:·-t is replaced by a thymine in phrS'~-2. This change has no effect on the encoded amino acid. Further downstream, in position 2S0, an adenine in phrS,:·-t is changed in a

Table 2. Degree of identity of regions of the genes encoding pheromones Phrl-4 with the corresponding regions of pheromone Phr5~·-t .

5'-non-coding region 3'-non -coding region prepro-sequence intron 1 intron 2 intron 3 mature pheromone

Phrl

Ph r2

Phr3

Phr4

99% 89% 95% (90%) 67% [93%] 43% 36% 45% (26% )

99% 89% 95% (90%) 69% [96%] 47% 22% 41% (21% )

99% 78% 95% (90%) 66% [91%] 48% 43% 34% (18%)

99% 15% 60% (58% ) 40% 35% 28% 31% (13%)

in parentheses: identities on the amino acid level identities in square brackets tak e int o account the deviating lengths of the first intron

A fifth E. octocarinatus pheromone pllCS lI - 1

Affif:f:AGCCATITTCATTATTITAGCCATITTTATC-OTTAcccAAr..ccTTCAb.GltTGACA

60

phrS' -a " " " " " ' ' F' ' ' 'I ' ' 'I ' ' 'L ' ' A, ' ' ' 'I ' ' [,' ' ' M ' ' ' 'V' ' 'T' ' '0 ' ' 'A' ' 'E' ' 'K' ' 'M' ' 'T ' ' PhrS ll - 1 M K A I

60 20 20

PhrS .. - 2

:

:

:

:

:

::

::::::

:::::

phrS 11- 1 TCCMGGTCMCACTAAr..cTCCAGTCTCAGATCCAGTCAMG'M'C'CAGTCCA AAMCAM

120

PhrS'-' PhrS",-l PhrS.,.-2

SKy

N

T

K

[,

0 SOl

Q

120

:

:

:

:

:

:

::

phIS*-1

CTTGCITCTACCTTIATGActMTTTAMGACMMGACGCTCCAGACTGTTATAGTCAA

ph.r5 11 - 2 PhrS,.-l

L

"""""""""""""""""""""""""""""" :

:::::::::::;

b

PhrS'-'

phrS,.-l phrS,.-2 PhrS,.-l Phr5,.-2

:

S

T

:

:

:

5

K

F

M

T

....

N

L

1< T

K

D

5

K

N

K

::::::

. : ; : : : : : : ::: :: : : : ; : ; : : :

F

0

A

P

"""

::

:T::: : : : :: : : ::

Dey

S

Q

40

40

180 lBO 60

60

"'"

ACATATCTAACAGGATGAAATACTAATCCAGATAAATG'I"I'GGTACAATTCAAATGGATGA

::::;::::::::::: ;:::::::::::;::;:::::::::::::::::;:::::::;; Y L T G .. N T N P 0 K C \'1 Y N S N G '" : : : : : ,. : : : : : : : :::::,.

T

240 240 BO 80

phrS·- 1 GGATCTACAAATGGATCTACT-GACA-TGCTATACTATATGACCC-GTAAATCCT-GAGTI phr5 11 - 2 r : : : : : : : : G: : : ; : ; ; : TrGG: ; GAA: : : : : : : : ; : - : : ; : : : ; T: A: : : : : : : G: : : : : PhrS",-l G S T N G S T D M L Y Y M T R K S '" V PhrS,.-2: : : D : : L GEe Y T N D PEN P G:

300 99

phrS·- 1 GGAGATAATATAGCACAGGTTATATTCGATAGATGGATGCTAGGATGCTATGAGGATGTA phrS,.-2 ::::::::::;::::::::::: :C: :T:::::::;::::;:::::::;;:::::::::::

3S7

Phrs·- 1 FhrS*-J

G :

D :

N :

I :

A Q ::

V

I F D R VI :::::

M

L

G C Y E D V ::::::

phrS·- 1 AGTAATIGAGTAGTAGATGCTGGTGCAATGTATGCCATATITICAAGCCAATATCTATGC

PhrS'-'l Phrs·-

PhrS",-2

phrS",-l phrS*-2 FhrS·- l

Phrs·-2

""''''''''''''''''''''''''''''''''''''''''''''''''''''''''

S

N

,.

V

V

D

A

GAM

Y

A

I

F

S

S

Q

Y

L

C

.....

M'M'GAGGATACGAGTTTGGCAATGTAAATGATTTCAC'ITATGGTTTCTGAGGTGTATAT :;:::::::::::::::::::::::::::::::::::::::::::::::::::::::::: N .. G Y E F G N V N 0 F T Y G F G V Y

"..

phrs·- l CCATM phrs·- 2 Phrs·- l P stop pr.rS".-2 : stop

:

:

:

:

:

:

297

100

360 119

120

417 420

139 140

477 4BO 159 160 4B3

486 160 161

Fig. 2. The codingsequences of the genes phrS"---t and phrS'H and the amino acid sequences deduced from them (EMBL

databank accession No. Y17S0S and Y18433). Only those nucleotidesand those amino acidsof phrS'H that differfrom the sequenceof phrS'H are shown. Double-dots indicateidentity of the nucleotides and amino acids with those shown in the line above.The prepro-sequenceis underlined.TGA encoded cysteinesare indicatedby asterisks.

guanine in phr5'f-2 which results in aspartate instead of asparagine. Nine nucleotides further downstream an ACT-codon is replaced by an TTG-codon which leads to a change from a threonine in phr5'f-l to a leucine in phr5'f-2. In the sequence which follows, altogether four nucleotides are inserted and one nucleotide is deleted in phr5';-2. This causes a shift in the reading frame that leads to a change of 12 consecutive amino acids and the gaining of one amino acid for Phr5'H. All these changes occur in exon 2. The shift in reading frame also leads to a new cysteine which replaces a cysteine eight amino acids further downstream which is lost by this shift. Therefore the total number of cysteines remains 10. 10 cysteines were found in six of the seven previously se-

229

quenced pheromones. Only pheromone 4, which is shorter than the other pheromones, has eight cysteines. No differences exist for the third and fourth exon of the two pheromone genes, neither at the amino acid level nor at the nucleotide level. We also cloned and sequenced the eDNA of pbrs":' by RT-coupled PCR. Comparison of the eDNA sequence with the sequence of phr5'f-l allowed the identification of three introns. Intron 1 interrupts the leader sequence and is 371 bp long. Introns 2 and 3 are both relatively short (48 bp and 47 bp, respectively) and located in the sequence coding for the mature pheromone. The coding sequence of phr5'f-l altogether shows a length of 483 nucleotides, 156 bp coding for the leader peptide and 327 bp coding for the native pheromone (Fig. 2). We did not isolate RNA from stock EG20-11 but assume that the location of the introns in the gene encoding pheromone 5'H is identical to the one in the gene encoding pheromone 5'H. The assumption is based on the high degree of similarity between the sequences of pheromone 5'H and pheromone 5'H and on the conservation of the intron splice sites in the two pheromone genes. Intron 1 ui pbrb":' is 143 bp shorter than intron 1 in phr5'f-2. This difference is due to a block of 146 bp missing at the beginning of intron 1 of phr5':--1 and the missing of three scattered bp in phr5*-2 further downstream in intron 1. To exclude the possibility that the block of 146 bp missing in phr5'H was lost by recombination during amplification by PCR, total DNA of cells of stock DM-5 was separated on an 0.8% agarose gel and blotted onto a nylon membrane. The blot was then hybridized with a Digoxigenin-labeled PCR product which contained the conserved region encoding the pre-sequence and the beginning of the first intron of the pheromones of E. octocarinatus syngen 1. As mentioned previously, this part is conserved in all macronuclear chromosomes encoding the pheromones so far isolated. The hybridization signal which was obtained at approximately 1600 b};?/fdata not shown) clearly showed that the entire macronuclear chromosome had been sequenced and that the difference in length between the pheromone genes of stock DM-5 and those of stock EG20-11 was real. It is of interest that the sequence motif GTAAGATITG located at the 5' -splice site of intron 1 of phr5'f-2 occurs a second time at position 147-156. Exactly the part upstream of this sequence is missing in the shorter version of intron 1 of stock DM-5. The same type of deletion was found in the first intron of the gene phr1 'f of stock CC-4 from Maryland [3]. The results presented here show that the two new stocks indeed express an eleventh mating type and that they secrete a new pheromone. Since this pheromone is recognized by our standard tester lines, each one repre-

230

M. M611enbeck and K. Heckmann

senting another one of 10 mating types, it appears likely that a similar pheromone 5 exists also for E. octocarinatus syngen 1. This would raise the number of mating types in this species to 15.

8 9

Acknowledgements: Helpful discussions with Drs Claudia Briinen-Nieweler, Hans-Werner Kuhlmann, Evelyn Pliimper and Gabriele Albers are gratefully acknowledged. This work was supported by a grant of the Deutsche Forschungsgemeinschaft to K. H. (SFB 310) and the Fonds der Chemischen Industrie.

References

2 3

4

5 6

7

Aviv H. and Leder P. (1972): Purification of biologically active globin messenger RNA by chromatography on oligoth ymidylic acid-cellulose. Proc. Nat!. Acad. Sci. (USA) 69,1408-1412. Briinen-Nieweler c., Schmidt H . J. and Heckmann K. (1991):Two introns in the pheromone 3-encoding gene of Euplotes oetocarinatus. Gene 109,233-237. Briinen-Nieweler c., Weiligmann J. c., Hansen B., Kuhlmann H .-W , Mollenbeck M. and Heckmann K. (1998): The pheromones and pheromone genes of new stocks of the Euplotes oetocarinatus species complex. Europ. J. Protistol. 34, 124-132. Engler-Blum G., Meier M., Frank J. and Miiller G. A. (1993): Reduction of background problems in nonradioactive Northern and Southern blot analyses enables higher sensitivity than 32P-based hybridizations. Anal. Biochem.210,235-244. Freiburg M. (1993): Identification of cell surface polypeptides of the hypotrich ciliate Euplotes octocarinatus. Arch. Proti stenkd. 143,311-318. Godiska R., Auf der Heide K. J., Gilley D., Hendrie P., Fitzwater T., Polisky B., Preer L. and Preer ]. R., Jr. (1987):Transformation of Paramecium by microinjection of a cloned serotype gene. Proc. Natl, Acad. Sci. (USA) 84,7590-7594. Heckmann K. and Kuhlmann H.- W. (1982): Mating types

10

11

12 13

14

15 16 17 18

19

and gamones in Euplotes octocarinatus. J. Protozool. 29, 525. Heckmann K. and Kuhlmann H.-W (1986):Mating types and mating inducing substances in Euplotes octocarinatus. ]. Exp. Zool. 237, 87-96. Kuhlmann H .-W. and Heckmann K. (1989): Adolescence in Euplotes oetocarinatus.]. Exp. Zool. 251, 316-328. Kuhlmann H.-W., Briinen-Nieweler C. and Heckmann K. (1997):The pheromones of the ciliate Euplotes octocarinatus not only induce conjugation but also function as chemoattractants. J. Exp. Zool. 277, 38-48. Meyer E, Schmidt H . ]., Pliimper E., Hasilik A., Mersmann G., Meyer H. E., Engstrom A. and Heckmann K. (1991): UGA is translated as cysteine in pheromone 3 of Euplotes octocarinatus. Proc. Narl. Acad. Sci. (USA) 88, 3758-3761. Meyer E, Schmidt H. J. and Heckmann K. (1992): Pheromone 4 gene of Euplotes octocarinatus. Dev. Genet. 13,16-25. Pliimper E., Freiburg M. and Heckmann K. (1995): Conjugation in the ciliate Euplotes oetocarinatus: comparison of ciliary and cell body-associated glycoconjugates of non-mating-competent, mating-competent, and conjugating cells. Exp. Cell Res. 217, 490-496. Saiki R. K., Gelfand D. H., Stoffel S., Scharf S.]., Higuchi R., Horn G. T., Mullis K. B. and Erlich H . A. (1988): Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-491. Sanger E, Nicklen S. and Coulson A. R. (1977):DNA sequencing with chain-termination inhibitors. Proc. Natl, Acad. Sci. (USA) 71, 5463-5467. Schulze Dieckhoff H., Freiburg M. and Heckmann K. (1987): The isolation of gamones 3 and 4 of Euplotes octocarinatus. Europ.J. Biochem. 168,89-94. Southern E. M. (1975): Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. BioI. 98, 503-517. Teckentrup W, Puppe]., Weiligmann]. c, Schmidt H .]. and Heckmann K. (1996): The genes encoding pheromones 1 and 2 of Euplotes octocarinatus. Europ. ]. Proristol. 32, 158-164. Weischer A., Freiburg M. and Heckmann K. (1985) Isolation and partial characterization of gamone 1 of Euplotes octocarinatus. FEBS Lett. 191,176-180.