Chicken IL-7 as a potent adjuvant enhances IBDV VP2 DNA vaccine immunogenicity and protective efficacy

Veterinary Microbiology 193 (2016) 145–155

Contents lists available at ScienceDirect

Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic

Chicken IL-7 as a potent adjuvant enhances IBDV VP2 DNA vaccine immunogenicity and protective efficacy Shanshan Huoa,b,1, Yuzhu Zuoa,b,1, Nan Lia , Xiujin Lic, Yonghong Zhanga,d , Liyue Wanga , Hao Liub,e, Jianlou Zhanga,b , Dan Cuia , Pingyou Heb,e, Jian Xua,c, Yan Lia,b , Xiutong Zhub,e,** , Fei Zhonga,b,* a

Laboratory of Molecular Virology and Immunology, College of Veterinary Medicine, Agricultural University of Hebei, Baoding 071000, China Hebei Engineering and Technology Research Center of Veterinary Biotechnology, Baoding 071000, China c Department of Biotechnology, College of Environmental and Chemical Engineering, Yanshan University, Qinhuangdao 066004, China d Department of Dermatology, PLA Army General Hospital General Hospital, Beijing 100700, China e Rinpu (Baoding) Biological Pharmaceutical Co., LTD, Baoding 071004, China b

A R T I C L E I N F O

Article history: Received 8 April 2016 Received in revised form 15 August 2016 Accepted 16 August 2016 Keywords: Chicken interleuckin-7 VP2 DNA vaccine Immunogenicity enhancement Infectious bursal disease virus Bicistronic vector

A B S T R A C T

Our previous work has demonstrated that the mammalian interleukin-7 (IL-7) gene can enhance the immunogenicity of DNA vaccine. Whether chicken IL-7 (chIL-7) possesses the ability to enhance the immunogenicity of VP2 DNA vaccine of infectious bursal disease virus (IBDV) remained unknown. To investigate this, we constructed a VP2 antigenic region (VP2366) gene and chIL-7 gene vectors, coimmunized chicken with these vectors and analyzed the effects of the chIL-7 gene on VP2366 gene immunogenicity. Results showed that co-administrated chIL-7 gene with VP2 DNA vaccine significantly increased specific serum antibody titers against IBDV, and enhanced lymphocyte proliferation and IFN-g and IL-4 productions. More importantly, chIL-7 gene significantly increased VP2366 gene-induced protection against virulent IBDV infection, indicating that the chIL-7 gene possessed the capacity to enhance VP2366 DNA vaccine immunogenicity, and therefore might function as a novel adjuvant for IBDV VP2 DNA vaccine. Mechanically, chIL-7 could stimulate the common cytokine receptor g chain (gc) expressions in vitro and in vivo, which might be involved in chIL-7 enhancement of the immunogenicity of VP2 DNA vaccine. ã 2016 Elsevier B.V. All rights reserved.

1. Introduction Infectious bursal disease (IBD) is an acute and highly contagious chicken infectious disease caused by IBD virus (IBDV), characterized by virus-induced immunosuppression in young chickens by destruction of antibody-producing B cells in the bursa of Fabricius. The IBDV can replicate rapidly in developing B cells causing the destruction of the precursors of antibody-producing B cells in the bursa, resulting in immunosuppression which leads to vaccination

* Corresponding authors at: Laboratory of Molecular Virology and immunology, College of Veterinary Medicine, Agricultural University of Hebei, Baoding 071000, China. ** Corresponding author at: Rinpu (Baoding) Biological Pharmaceutical Co., LTD, Baoding 071004, China. E-mail addresses: [email protected] (X. Zhu), [email protected] (F. Zhong). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.vetmic.2016.08.016 0378-1135/ã 2016 Elsevier B.V. All rights reserved.

failure and susceptibility to other infections (Balamurugan and Kataria, 2006). Therefore, IBD has been considered one of the most important viral disease threatening the poultry industry worldwide. IBDV is a member of the genus Avibirnavirus of the family Birnaviridae, and its genome contains two segments of double stranded RNA, A and B (Brown and Skinner, 1996). The larger segment A (3.2 kb) has two partially overlapping open reading frames (ORFs). The first ORF of the segment A encodes VP5 (17 kDa), a nonstructural protein being considered to be essential for viral release (Lombardo et al., 2000). The second ORF encodes a 110 kDa-precursor polyprotein (110 kDa), which is self-cleaved by its protease (VP4) to form three viral proteins: VP2 (48 kDa), VP3 (33–35 kDa) and VP4 (24 kDa) (Müller and Becht, 1982). VP2 and VP3 are the major capsid proteins constituting 51% and 40% of the viral proteins, respectively (Balamurugan and Kataria, 2006). Moreover, VP2 is also a major host-protective antigen of IBDV and contains major epitopes responsible for inducing viral neutralizing

146

S. Huo et al. / Veterinary Microbiology 193 (2016) 145–155

antibodies against IBDV (Azad et al., 1991). The small segment B (2.9 kb) contains one ORF encoding VP1 (90 kDa) which has RNAdependent RNA polymerase activity (Spies et al., 1987). So far, IBD has not been completely controlled although vaccination programs have been extensively implemented worldwide using live attenuated or inactivated IBDV vaccines. Outbreaks of IBD still occur (Mardassi et al., 2004), and are often accompanied by the emergence of highly virulent and variant strains, probably due to selection pressure from the administration of live attenuated IBDV vaccine (Snyder, 1990). In addition, the live IBDV vaccine has often caused chicken immunosuppression and subclinical infection (Fussell, 1998). Therefore, development of a safe and efficacious vaccine for IBD is imperative. In recent years, IBDV VP2-based DNA vaccine has been extensively investigated as a potential candidate for developing an effective IBDV vaccine (Gao et al., 2013; Pradhan et al., 2014) since VP2 DNA vaccine can induce both humoral and cellular immune responses (Pradhan et al., 2014). IBDV VP2 contains major epitopes responsible for inducing viral neutralizing antibodies (Azad et al., 1991), and its truncated fragment (VP2 52-417) containing epitopes has been identified to possess potent antigenicity (Pradhan et al., 2012). However, VP2 vaccines, either in full-length or truncated constructs, have not completely protected chickens from IBDV infection. Therefore, to increase the immunogenicity of VP2 DNA vaccines, many cytokines have been investigated as biological adjuvants, including IL-2 (Hulse and Romero, 2004; Kumar et al., 2009), IL-12 (Su et al., 2011), IL-18 (Li et al., 2013) and IFN-g (Roh et al., 2006; Park et al., 2010), with varying potencies. IL-7 is a pleiotropic cytokine produced by bone marrow and thymic stromal cells, which was originally discovered as a pre-B cell growth factor (Namen et al., 1988) playing a crucial role in initiating and maintaining activities of the immune and hematopoietic systems (Chazen et al., 1989; Schluns and Lefrançois, 2003). IL-7 is essential for B cell differentiation, proliferation, maturation and maintenance (Komschlies et al., 1995; Namen et al., 1998). IL-7 also possesses the ability to stimulate T cell development, proliferation and homeostatic regulation (Hickman et al., 1990; Fry and Mackall, 2001). Due to its potent immunity-stimulating property, IL-7 has been used in humans to treat certain immunosuppression diseases (Leone et al., 2009; Hou et al., 2015) and to enhance vaccine immunogenicity as a biological adjuvant (Park et al., 2010; Chen et al., 2016). Our previous work showed that the canine IL-7 gene can enhanced the immunogenicity of canine parvovirus VP2 DNA vaccine (Sun et al., 2012; Chen et al., 2012). Whether chicken IL-7 (chIL-7) gene possesses the ability to enhance the immunogenicity of IBDV VP2 DNA vaccine to increase protective efficiency against IBDV infection remained unknown. In this study, we constructed a dicistronic expression vector for synchronously expressing the IBDV VP2 epitope gene and chIL-7 gene to evaluate the chIL-7 gene enhancement for VP2 DNA vaccine in chickens. Our results showed that the chIL-7 gene possesses

Table 1 Groups of the chickens and dosages of plasmids and IBDV vaccine used in immunization. Groups

Number Plasmids used for immunization Doses of plasmids(mg)

1 2 3 4 5 6 7 8 9

28 28 28 28 28 28 28 28 28

Mock pcDNA-IRES (empty vector) pcDNA-chIL7 pcDNA-VP2366 pcDNA-VP2366 + pcDNA-chIL7 pcDNA-VP2366 + pcDNA-chIL7 pcDNA-VP2366 + pcDNA-chIL7 pcDNA-VP2366 -IRES-chIL7 Attenuated IBDV vaccine

0 100 100 100 100 + 50 100 + 100 100 + 200 100 2  103 TCID50

strong ability to enhance VP2 DNA vaccine-induced chicken immune response and protection against IBDV infection, indicating that chIL-7 could function as a potent biological adjuvant for the VP2 DNA vaccine. 2. Materials and methods 2.1. Plasmids, cells, viruses and chickens The pcDNA3.1A plasmid, as a eukaryotic expression vector, was purchased from Invitrogen. The pcDNA3.1A-IRES plasmid vector, containing an internal ribosome entry site (IRES), was constructed as described previously (Zhang et al., 2015). The chIL-7 expression vector pcDNA-chIL-7/H plasmid was constructed as previously described (Huo et al., 2016). Human embryo kidney (HEK) 293T cells were from the American Type Culture Collection (ATCC). A virulent IBDV strain was kindly provided by Dr. Zandong Li in China Agricultural University. An attenuated IBDV vaccine was purchased from Rinpu (Baoding) Biological Pharmaceutical Co., LTD. Specific pathogen–free (SPF) chickens were purchased from Jinan Sais Poultry Company and maintained in an isolator in an environmentally controlled room with a 12/12 h light/dark cycle. Animal experiments were approved by the Animal Ethics Committee of the Agricultural University of Hebei. 2.2. Proteins and antibodies Recombinant IBDV VP2 protein was prepared in our laboratory Briefly, IBDV VP2 gene was amplified from IBDV genome by RT-PCR and inserted into pcDNA3.1A plasmid to generate His-tag-fused VP2 expression vector pcDNA-VP2/H. The expression vector was transfected into HEK293T cells for expressing the recombinant VP2. The expressed VP2 was purified from the culture medium with Ni-NTA Agarose beads (Qiagen). Mouse anti-His antibody and Horseradish peroxidase-conjugated goat anti-mouse IgG (IgGHRP) (sc-2031) were purchased from Santa Cruz Biotechnology. 2.3. Construction of DNA vaccine vectors Antigenic region (AA52-417) of VP2 (called VP2366) was chosen as a DNA vaccine, as previously described (Pradhan et al., 2014). The VP2366 gene was codon-optimized using chicken preferred codons, and a potent signal peptide, human CD5 (CD5sp) (Zakhartchouk et al., 2007), was added to the 50 terminus of VP2366 gene for its secretory expression. The CD5sp-VP2366 fused gene was synthesized by Shanghai Sangon Biological Engineering and inserted into pcDNA-IRES plasmid upstream of the IRES element by EcoR I and EcoR V sites to generate His-tagged VP2366 expression vector pcDNA-VP2366/H-IRES. The chIL-7 gene in the pcDNA-chIL-7/H vector was transferred downstream of IRES in pcDNA-VP2366/HIRES by 50 -blunt and 30 -sticky (Sfu I) end ligation to generate a dicistronic expression vector of VP2366 and chIL-7 (pcDNA-VP2366/ H -IRES-chIL-7/H), in which the chIL-7 was also fused with a Histag. To construct their His-tag-free vectors (including pcDNA-chIL7, pcDNA-VP2366-IRES and pcDNA-VP2366-IRES-chIL-7), the stop codons in the corresponding vectors were generated using the QuickChange Site-Directed Mutagenesis Kit (Strategene). Large scale preparation of DNA vaccine plasmids was performed using the EndoFree Plasmid Maxi Kit (Qiagen) and plasmid concentration was measured in a Nano-Drop ND-1000 spectrophotometer (Thermo Scientific). 2.4. Expression in HEK293T cells His-tag-fused gene vectors were used to transfect HEK293T cells to confirm the expression of gene-encoded proteins (VP2366

S. Huo et al. / Veterinary Microbiology 193 (2016) 145–155

147

Fig. 1. Codon-optimization of VP2366 gene and expression vector constructions of VP2366, chIL-7 and VP2366/chIL-7 genes. (a) Comparison of wild-type and codon-optimized VP2366 gene sequences fused with human CD5 signal peptide (underlined): WT, wild-type; Opt, codon-optimized; AA, amino acids. (b) Vector constructs of VP2366 and chIL-7 genes: CMV, human cytomegalovirus promoter; H, 6  Histidine-tag; IRES, internal ribosome entry site. (c) Identification of pcDNA-VP2366 plasmid by restriction digestion: M, DL-2000 DNA markers; Lane 1, undigested plasmid; Lane 2, digested by EcoR I and EcoR V. (d) Identification of pcDNA-VP2366-IRES-chIL-7 plasmid by restriction digestion: M, DL-2000 DNA markers; Lane 1, undigested plasmid; Lane 2, digested by EcoR I (there is an EcoR I site at 66 bp in the chIL-7 gene).

148

S. Huo et al. / Veterinary Microbiology 193 (2016) 145–155

and chIL-7) in a secretory manner in the eukaryotic cells. Briefly, the HEK293T cells were cultured in DMEM complete medium and incubated in a T25 flask for 24 h prior to transfection. The 80–90% confluent cells were transfected with 10 mg DNA vector using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturers’ instructions. At the same time, the cells were transfected with the pcDNA3.1-IRES empty vector as a negative control. The cells and medium were separately harvested at 48 h posttransfection. The expressed VP2366 and chIL-7 proteins in the medium were detected by Western blot, and their mRNAs in the cells by RT-PCR. 2.5. Western blot The recombinant VP2366 and chIL-7 in the medium were purified with Ni-NTA Agarose beads and detected by Western blot. The purified products were separated by 10% SDS-PAGE and electropheretically transferred onto a nitrocellulose membrane (Hybond-C, Amersham Pharmacia). After blocking with 5% nonfat milk in PBST for 2 h at room temperature, the membrane was incubated with mouse anti-His antibody (1: 1000 dilution) for 2 h at 37  C, followed by goat anti-mouse IgG-HRP (1: 1000 dilution) for 1.5 h at 37  C. The blotting bands were developed using ImmobilonTM Western Chemiluminescent HRP substrate (Millipore), and the signals were detected using a Gel Documentation and Image Analysis System (Sage Creation). 2.6. Expression of VP2366 and chIL-7 in vivo detected by RT-PCR In vivo expression of VP2366 and chIL-7 in injected chicken muscle tissues, mediated by different vectors, was detected with RT-PCR. Freshly collected 100 mg aliquots of injected muscle tissue taken on days 1, 8, 14, 21, 28 and 35 after immunization were homogenized and total RNA was isolated using Trizol reagent (Invitrogen). The cDNA was synthesized with M-MLV-reverse transcriptase and the VP2366 and chIL-7 mRNA were detected by PCR using following primers: VP2366-F: 50 AGCGGCCTGATCGTGTTCTTCC, VP2366-R: 50 GCGGCTCA CCAGGCGGCAGTAG (153 bp); chIL-7-F: 50 CTGCCACTTCTCCTTGTTCTG, chIL-7-R: 50 GACTAATGCTGCTTTCCTTCTAA (300 bp). House-keeping gene, glyceraldehyde-3- phosphate dehydrogenase (GAPDH) mRNA was detected using following primers: GAPDH-F:

50 GTGGTGCTAAGCGTGTTATCATC, 50 GGCAGCACCTCTGCCATC (269 bp).

GAPDH-R:

2.7. Chicken immunization Two hundred and fifty-two SPF chickens (21-day old) were randomly divided into 9 groups of 28 birds each (Table 1). Each group was further subdivided into three sub-groups, namely antibody tracing (8 birds), cellular immunity evaluation (8 birds) and challenge groups (12 birds). The chickens in group 1 remained unimmunized as a negative control. The chickens in group 9 were immunized orally with attenuated IBDV vaccine as a positive control. The chickens in groups 2–8 were immunized intramuscularly with the different vector combinations: pcDNA-IRES, pcDNAchIL-7, pcDNA-VP2366, pcDNA-VP2366 + pcDNA-chIL-7(50 mg), pcDNA-VP2366 + pcDNA-chIL-7(100 mg), pcDNA-VP2366 + pcDNAchIL-7(200 mg), and pcDNA-VP2366-IRES-chIL-7, respectively (Table 1), and boosted with the same vectors at the same doses twice, one week apart for DNA vaccination, and with the same IBDV vaccine at the same titers once, ten day apart for IBDV vaccine vaccination. Blood samples were collected by a wing vein from the chickens in antibody tracing subgroups (8 birds each) at 2 d before immunization, then at 0, 14, 28, 42, 56 d after the 1 st immunization. Titers of specific antibody against IBDV were determined by ELISA. At 35 d post-immunization, the chickens in the cellular immunity evaluation subgroups (8 birds each) were euthanized. Splenic lymphocytes were aseptically isolated by Ficoll density gradient centrifugation for proliferation index measurements by MTT, and IFN-g and IL-4 productions by ELISA. At 35 d post-immunization, the chickens in the challenge subgroups (12 birds each) were orally challenged with virulent IBDV. The chicken mortality, bursal/body ratios (B/B ratios), bursal lesion scores and protection efficiency were evaluated with the corresponding methods (see below). 2.8. Antibody titer to IBDV Antibody titers were measured by ELISA. Plastic 96-well plates were coated overnight at 4  C with 100 mL VP2 protein (10 mg/mL) in sodium carbonate buffer (0.05 mol/L, pH9.6). After blocking with 3% non-fat milk in PBST, the plates were incubated with 100 mL of

Fig. 2. In vitro expression of VP2366 and chIL-7 in HEK293T cells. (a) RT-PCR detection of transfected cells with different vectors (pcDNA3.1 empty vector, pcDNA-VP2366/H, pcDNA-VP2366/H-IRES-chIL-7/H and pcDNA-chIL-7/H) with VP2366 primers. GAPDH, glyceraldehyde-3-phosphate dehydrogenase, was included as a house-keeping gene. (b) RT-PCR detection of transfected cells with the different vectors with chIL-7 primers. (c) Immunoblotting for detecting VP2366 and chIL-7 proteins in the culture medium of the cells transfected with different vectors: M, prestained protein markers; Lane 1–4, transfected with pcDNA-VP2366/H, pcDNA-chIL-7/H, pcDNA-VP2366/H-IRES-chIL-7/H and pcDNA3.1 empty vector.

S. Huo et al. / Veterinary Microbiology 193 (2016) 145–155

200-fold diluted chicken sera at 4  C for 1 h. After washing with PBST, wells were incubated with 100 mL HRP-conjugated goat antichicken IgG (Sigma) at 37  C for 1 h, then for 1 h at 37  C with 100 mL freshly-prepared TMB solution for color development. Fifty mL of 2 mol/L H2SO4 were then added to each well to stop the reaction and OD450 values were read using a microplate reader. 2.9. Neutralization titers to IBDV IBDV were propagated in DF-1 chicken embryonic fibroblast cells as previously described by Kibenge (Kibenge et al., 1997). The virus neutralization (VN) titer measurement was performed using the methods described previously (Hsieh et al., 2006; RodriguezChavez et al., 2002). Briefly, serum from each chicken was two-fold serially diluted (1:8–1:128) in a final volume of 75 mL of DMEM medium supplementing with 10% (v/v) fetal bovine serum (FBS), 2 mM L-glutamine, 0.1 mM non-essential amino acids, 1 mM sodium pyruvate, 0.04 mM b-mercaptoethanol, 10 units/mL penicillin, 10 mg/mL streptomycin and mixed with 25 mL of volume of 2.5  102 TCID50 IBDV. After incubation at 37  C for 60 min, the mixtures (100 mL) were used to infect DF-1 chicken embryo fibroblasts in 96-well plates. The cells were continued to culture at 37  C and 5% CO2 for 5–7 days. In the late stage of this culture period, wells were scored for the presence of a CPE. The VN titer was determined to be the reciprocal of the highest dilution in which there was no visible CPE. 2.10. Lymphocyte proliferation assay Lymphocyte proliferation was assessed by MTT method. The immunized chickens were euthanized on day 35 and the spleens were removed aseptically. Spleen lymphocytes were separated by density gradient centrifugation with Ficoll Paque and washed twice with fresh RPMI 1640 medium (Invitrogen). The cells were resuspended at a density of 2  106 cells/mL in RPMI 1640 medium with 10% fetal bovine serum (FBS), 100 units/mL penicillin, 100 mg/ mL streptomycin, and 2 mM L-glutamine, added to 96-well plates and stimulated in vitro for 72 h at 37  C in a 5% CO2 incubator with either concanavalin (Con A, 5 mg/mL, Sigma) as a positive control, or recombinant VP2 protein (5 mg/mL) as specific antigen. An untreated culture served as a negative control. Twenty mL of MTT (5 mg/mL) were then added to each well and incubation was continued for 4 h. The cells were collected by centrifugation and incubated with 150 mL dimethylsulphoxide (DMSO) to solubilize

149

intracellular MTT. Supernatants were then transferred to another 96-well plate and OD490 values were read in a microplate reader. 2.11. Cytokine production Isolated spleen lymphocytes were stimulated with VP2 protein as above. Chicken IL-4 and IFN-g concentrations in the culture medium were measured by sandwich ELISA using commercially available chicken ELISA kits (Elabscience) following the manufacturer’s instructions. 2.12. Common cytokine g -chain receptor detection Chicken common cytokine g-chain receptor detection was performed with RT-PCR. Briefly, the total RNA was extracted using Trizol reagent (Invitrogen) from either spleen lymphocytes of immunized chickens or spleen lymphocytes stimulated by IL-7 (100, 200 and 500 ng/mL) of unimmunized chickens. The cDNA was synthesized with M-MLV-reverse transcriptase and the g-chain receptor mRNA were detected by PCR using following primers (GenBank: DQ852357.1): primers for g-chain receptor, sense 50 GGCTTCGCTCGTGCACATCCTTC, antisense 0 5 GTTGACGGGCGCCTCTGGTTTC (367 bp), and primers for housekeeping gene (GAPDH) as above. 2.13. Viral challenge study At 35 d post-immunization, the chickens in the challenge subgroups (12 birds each) were orally challenged with 1 103 ELD50 virulent IBDV (amplified using chicken embryo). The challenged chickens were observed clinically for 8 d and mortalities were recorded. Chickens and bursae were weighed and B/B ratios were calculated by (bursal weight/body weight)  1000. Bursal lesion scores were evaluated based on the histopathological severity of bursae (Gao et al., 2013). Protection was defined by the number of chickens with histopathological BF lesion scores of 0 and 1 divided by the number of chickens in the group. 2.14. Statistics The significance of differences between groups was evaluated by one-way analysis of variance (ANOVA) with Dunnett's postcomparison test for multiple groups to control group, or by Student's t test for two groups.

Fig. 3. VP2366 and chIL-7 expressions mediated by DNA vaccine vectors in injected chicken muscle tissues at different time points, detected by RT-PCR. (a) pcDNA-VP2366 vector-mediated VP2366 expression. (b) pcDNA-chIL-7 vector-mediated chIL-7 expression. (c) pcDNA-VP2366-IRES-chIL-7 vector-mediated VP2366 and chIL-7 expressions.

150

S. Huo et al. / Veterinary Microbiology 193 (2016) 145–155

3. Results 3.1. VP2 immunodominant epitope determination, codon optimization and vector constructions VP2366 antigenic epitope of VP2 has been identified as having strong antigenicity (Pradhan et al., 2012). To evaluate chIL-7 enhancement on the immunogenicity of VP2 DNA vaccine, we optimized VP2366 gene (Fig. 1a) using chicken prefered codons based on Codon Usage Database (Nakamura et al., 2000) and constructed its eukaryotic expression vector (Fig. 1b) by fusing human CD5 signal peptide for secretory expression. To have VP2366 and chIL-7 expressed synchronously, we generated a dicistronic expression vector for these two genes mediated by an IRES element. For convenient detection of their expression by immmunoblotting, vectors of His-tag-fused genes were generated (Fig. 1b). His-tag-free vectors for chicken immunization were generated from their corresponding His-tag-fused vectors (Fig. 1b) by site-

directed mutagenesis. All constructs were confirmed by restriction digestion (Fig. 1c and 1d) and sequencing to be correct. 3.2. DNA vaccine vector-mdiadted VP2366 and chIL-7 expressions in HEK293T cells To confirm whether the VP2366 and chIL-7 vectors can mediate VP2366 and chIL-7 expression in eukaryotic cells in a secretory manner, we transfected HEK293T cells with His-tag-fused VP2366 and chIL-7 gene vectors (pcDNA-VP2366/H, pcDNA-chIL-7/H and pcDNA-VP2366/H -IRES-chIL-7/H) to detect gene expressions at the mRNA level in the cells by RT-PCR and protein levels in the culture media by immunoblotting using anti-His-tag antibody. The cells were also transfected with the empty pcDNA3.1 vector as a negative control. The specific VP2366 DNA fragment (153 bp) was amplified from the cells transfected with pcDNA-VP2366/H and pcDNA-VP2366/H-IRES-chIL-7/H plasmids (Fig. 2a) while chIL-7 DNA fragment (300 bp) was amplified from the cells transfected

Fig. 4. Titers of antibodies against IBDV in the sera of immunized chickens with the different vectors at the different time. (a) IBDV antibody titers in chickens detected at different times post-immunization by ELISA. (b) IBDV neutralizing antibody titers in the immunized chickens measured by virus neutralization test. Values are expressed as mean  SD. **P < 0.01, *P < 0.05, NS, no significance.

S. Huo et al. / Veterinary Microbiology 193 (2016) 145–155

with pcDNA-chIL-7/H and pcDNA-VP2366/H-IRES-chIL-7/H plasmids (Fig. 2b) but not pcDNA3.1 plasmid (Fig. 2a and 2b). Immunoblotting showed that the specific protein bands of VP2366 (about 21 kDa) and chIL-7 (about 25 kDa) were detected in pcDNA-VP2366/H and pcDNA-chIL-7/H plasmid-transfected cell media, respectively. Both VP2366 and chIL-7 were also detected in pcDNA-VP2366/H-IRES-chIL-7/H plasmid-transfected cell media. The sizes of both VP2366 and chIL-7 were larger than theoretically calculated, indicating that both were glycosylated during expression in HEK293T cells, there being 2 and 4 N-glycocylation sites in VP2366 and chIL-7, respectively. All the above indicates that the vectors constructed in this study, either their individual or dicistronic vector, could mediate the corresponding gene expressions in a secretory manner. 3.3. DNA vaccine vector-mediated VP2366 and chIL-7 expressions in injected muscle tissues To determine whether the constructed vectors can mediate VP2366 and chIL-7 expressions in vector-injected muscle tissues in vivo, the SPF chicken were immunized with different vectors and boost immunized at 7 d after the primary immunization, and total RNA was extracted from the injected muscle tissues at different times (1, 8, 14, 21, 28 and 35 d) after immunization. RT-PCR detection showed that both the 153 bp fragment of VP2366 mRNA and 300 bp fragment of chIL-7 mRNA were amplified from the tissues at all the time points analyzed (Fig. 3a-3c). High-level expression of both VP2366 and chIL-7 mRNAs was observed the day following primary immunization. No DNA fragment was amplified in empty vector-injected chicken tissues, showing that it was the vectors that mediated VP2366 and chIL-7 expressions in vivo. 3.4. IL-7 enhanced VP2366 DNA vaccine-induced chicken humoral immune response against IBDV To determine if chIL-7 has the enhancement on chicken humoral immune response induced by VP2366 DNA vaccine, the sera were collected from chickens immunized with the different vectors and the attenuated IBDV vaccine (Table 1) at the different time points. Antibody titers were measured by ELISA and showed

151

that the high-level antibody against IBDV in chickens immunized with IBDV vaccine and VP2366/chIL-7 genes, either with their individual vectors or their dicistronic vectors (Fig. 4a), significantly higher than with VP2366 DNA vaccine alone; however, the chIL-7 gene in the dicistronic vector showed more potent enhancement on VP2366 gene-induced antibody titers than did the individual vectors. High-level neutralizing antibodies against IBDV were also detected in the chickens co-immunized with VP2366 and chIL-7 genes and showed a chIL-7-dose-dependent manner. The dicistronic vector-mediated chIL-7 gene also showed more potent enhancement of neutralizing antibody generation than the individual vectors (Fig. 4b). All these results indicate that the chIL-7 gene possesses the ability to enhance VP2366 DNA-induced humoral immune response against IBDV. It can be seen that antibody titers both the total antobody titers (Fig. 4a) and neutralizing antibody titers (Fig. 4b) reached the high levels at 42 d post-immunization, but significantly decreased at 56 d postimmunization with VP2366 DNA vaccine. 3.5. IL-7 promoted VP2366 DNA vaccine-induced lymphocyte proliferation and IFN-g and IL-4 production To quantify the enhancement of the chIL-7 gene on VP2366 DNA vaccine-induced chicken cellular immune responses, lymphocyte proliferation and cytokine production of immunized chickens were analyzed at 35 d post-immunization. Lymphocyte proliferation assay showed that the lymphocyte stimulation indexes in pcDNAVP2366 plus pcDNA-chIL-7, pcDNA-VP2366-IRES-chIL-7-co-immunized chickens and in IBDV vaccine-immunized chickens were significantly higher than in chickens immunized with pcDNAVP2366 alone (P < 0.01). Moreover, the lymphocyte stimulation index in pcDNA-VP2366-IRES-chIL-7-co-immunized chickens was higher than that in pcDNA-VP2366 plus pcDNA-chIL-7 coimmunized chickens (Fig. 5), indicating that the chIL-7 gene has the ability to dose-dependently stimulate VP2366 gene-induced lymphocyte proliferation. To further test chIL-7 gene enhancement on cellular immune responses, IFN-g and IL-4 productions in spleen lymphocytes from immunized chickens were analyzed with ELISA upon stimulation with VP2 protein in vitro. Results showed that the chIL-7 gene in

Fig. 5. Lymphocyte proliferative responses of immunized chickens with different vectors at 35 d post-immunization. Lymphocytes isolated from the spleens of immunized chicken were separately stimulated with VP2 protein for 72 h and Con A (positive control) for 2 h. The stimulation indexes for each group immunized with different vectors were measured by the MTT method. Data are presented as mean  SD. **P < 0.01, *P < 0.05, NS, no significance.

152

S. Huo et al. / Veterinary Microbiology 193 (2016) 145–155

both individual and dicistronic vectors significantly enhanced IFNg expression in VP2366 gene-immunized chickens (Fig. 6a), by about 77% with the individual vectors and >150% with the dicistronic vector. However, the chIL-7 gene did not show the same potency in enhancing IL-4 production (Fig. 6b), with increases of only 27% and 37% with the individual and dicistronic vectors, respectively, indicating that chIL-7 tends to enhance the VP2366-induced Th1 T cell response. 3.6. IL-7 increased the protection of VP2366 DNA vaccine-immunized chickens against virulent IBDV challenge To evaluate the protective efficiency of the different combination of VP2366 DNA vaccines, the chickens in the challenge subgroups of all except Group 1 were challenged with virulent

IBDV. Clinical symptoms were observed and mortalities were recorded after the challenge. B/B ratios, bursal lesion scores (based on bursal histopathological characteristics in Fig. 7), protection and IBDV titers in bursal tissues and nasal secretions are presented in Table 2. During the experimental period, chickens in Group 1 (unchallenged) remained healthy and had normal sizes of bursae (0 score in Fig. 7) whereas those in other control groups (unimmunized, empty vector- and chIL-7 vector-immunized) showed typical clinical symptoms, with only 8 percent survival rates. However, chickens immunized with pcDNA-VP2366, pcDNAVP2366 plus different levels of pcDNA-chIL-7 and pcDNA-VP2366IRES-chIL-7 had 58, 75–83 and 92 percent survival rates, respectively, significantly higher than those immunized with empty or pcDNA-chIL-7 vectors. Moreover, the chIL-7 dicistronic vector-immunized chickens displayed higher survival rates

Fig. 6. Cytokine productions of the lymphocytes from immunized chickens. Lymphocytes were isolated from individual immunized chickens at 35 d post-immunization and stimulated with VP2 protein for 72 h and Con A for 2 h in vitro. IFN-g (a) and IL-4 (b) concentrations were measured by ELISA. Data are presented as mean  SD. **P < 0.01, *P < 0.05, NS, no significance.

S. Huo et al. / Veterinary Microbiology 193 (2016) 145–155

153

Fig. 7. Bursal lesion score criteria based on bursal histopathological characteristics. Picture a, b, c, d, e and f peresent bursal lesion score 0, 1, 2, 3, 4 and 5, respectively.

3.7. IL-7 promotes common cytokine receptor g chain (g c) expression in chicken splenic lymphocytes

compared with their individual vectors. Importantly, chickens immunized with pcDNA-VP2366 plus pcDNA-chIL-7 and pcDNAVP2366-IRES-chIL-7 had higher B/B ratios, lower bursal lesion scores, low IBDV titers in bursal tissues and nasal secretions than chickens immunized with pcDNA-VP2366 alone. Protection of pcDNA-VP2366-IRES-chIL-7-immunized chickens was 83% based on bursal lesion scores (Fig. 7), significantly higher than pcDNAVP2366 plus pcDNA-chIL-7-immunized (75%) and pcDNA-VP2366immunized chickens (58%). All results indicate that the chIL-7 gene can dose-dependently increase the survival rates and protection efficiency of the chickens immunized with VP2366 DNA vaccine.

To explore the molecular mechanism underlying chicken IL-7 enhancement on DNA vaccine immunogenicity, we conducted a preliminary analysis of the expression of common cytokine (IL-2, 4, 7, 9, and 15) gc receptor mRNAs by splenic lymphocytes from immunized chickens in vivo and by chIL-7-treated lymphocytes from unimmunized chickens in vitro using RT-PCR. Results showed that co-administration of the VP2366 gene with the chIL-7 gene, either in individual or in dicistronic vectors, significantly increased

Table 2 Protective efficiency of the different DNA vaccines in the immunized chickens upon challenge with virulent IBDV. Groups

Mortalitya Survival rate (%)b

B/B ratiosc

Control unchallenged Control challenged Empty vector pcDNA-chIL-7 pcDNA-VP2366 pcDNA-VP2366 plus pcDNA-chIL-7(50 mg) pcDNA-VP2366 plus pcDNA-chIL-7 (100 mg) pcDNA-VP2366 plus pcDNA-chIL-7 (200 mg) pcDNA-VP2366-IRES-chIL-7 Attenuated IBDV vaccine

0/12 12/12 11/12 11/12 5/12 3/12

100 0 8 8 58 75

7.13  0.135 1.54  0.331 1.59  0.134 1.90  0.218 5.02  0.137 6.41  0.190

2/12

83

6.79  0.208 5

2/12

83

6.81  0.214

a

1/12 0/12

92 100

7.23  0.184 7.62  0.197

Protectione (%)

IBDV in BTf (TCID50)/g

&9619; IBDV in NSg (TCID50)/mL

N/A 0 0 17 58 67

– 8.08  108 7.92  108 2.08  107 6.83  103 1.92  102

– 2.08  104 1.83  104 2.83  103 5.08  101 7.83  100

4 1 1 1 0 75

4.92  101

–

4 2 1 0 0 75

4.92  101

–

1

– –

Histopathological BF lesion scoresd 0

1 2 3 4 5

12 0 0 1 3 4

0 0 0 1 4 4

5

0 0 0 1 1 1

0 3 2 3 1 2

0 2 2 2 2 1

0 7 8 6 0 0

6 4 2 0 0 0 83 10 2 0 0 0 0 100

1.92  10 3.92  100

Mortality was recorded during a 10-day-period after virus challenge and presented as number of dead/total number of chickens in each group. Survival rate is was defined as the number of chickens surviving viral challenge/the number of chickens in the group. c B/B ratio is calculated by (bursal weight/body weight)  1000 and presented as the mean  SD from each group. d Bursal gross lesions are scored from 0 to 5 based on the severity of bursal involvement at time of euthanasia (0: no lesion; 1: slight change, 2: scattered or partial bursal damage, 3: 50% or less follicle damage, 4: 51–75% follicle damage and 5: 76–100% bursal damage). e Protection is defined by the number of chickens with a histopathological BF lesion score of 0 and 1/the number of chickens in the group. f IBDV titers in the bursal tissues (BT) of the immunized chickens measured by the 50% Tissue culture infective dose (TCID50) method in DF-1 cells. g IBDV titers in the nasal secretions (NS) of the immunized chickens measured by TCID50 method in DF-1 cells. b

154

S. Huo et al. / Veterinary Microbiology 193 (2016) 145–155

Fig. 8. Common cytokine receptor gc mRNA levels of chicken lymphocytes detected by RT-PCR. (a) Levels of gc in chicken lymphocytes isolated from individual immunized chickens. (b) The Levels of gc in chicken lymphocytes isolated from unimmunized chickens and stimulated with recombinant chIL-7 at different doses for 4 h. (c) Levels of gc in chicken lymphocytes isolated from unimmunized chickens and stimulated with BSA as a negative control.

the gc expression in chicken splenic lymphocytes in vivo (Fig. 8a). Recombinant chIL-7-treated splenic lymphocytes from unimmunized chickens also showed high-level gc expression (Fig. 8b and 8c), indicating that chIL-7 can stimulate gc expression of common cytokine receptors, and suggesting that chIL-7 induced gc expression might be involved in its enhancement on DNA vaccine immunogenicity.

4. Discussion In recent years, the IL-7 as a biological adjuvant for enhancing the immunogenicity of human and animal vaccines against viral infectious diseases has been closely studied, mainly due to its broad stimulation of precursor B- and T-cell maturation (Napolitano et al., 2001; Milne et al., 2004) and maintenance of peripheral T-cell homeostasis (Azevedo et al., 2009). Here, we found that the chIL-7 gene possessed potent adjuvant activity for the IBDV VP2 DNA vaccine. Co-administration of the chIL-7 gene with IBDV VP2 DNA vaccine significantly increased VP2-induced specific antibody levels and neutralizing antibody titers against IBDV, and promoted VP2-induced lymphocyte proliferation and IFN-g and IL-4 production, indicating that the chIL-7 gene can enhance both humoral and cellular immune responses to IBDV VP2 DNA vaccine. More importantly, the chIL-7 gene significantly increased protection in chickens immunized with VP2 gene against virulent IBDV infection, indicating that it might be developed as a novel and potent adjuvant for IBDV VP2 DNA vaccine. It has been observed that chickens vaccinated with inactivated IBDV vaccines are not fully protected against IBDV infection, even though high levels of antibodies were induced upon vaccination. Attenuated live IBDV vaccines have generally been considered to be potent IBDV vaccines for induction of protective immunity; however, they can also induce moderate bursal atrophy (Tsukamoto et al., 1995; Tsukamoto et al., 2000) and subclinical infection, since the virulence of the vaccine virus tends to be increased after passage in chickens (Tsukamoto et al., 2000). DNA vaccines have been considered to be the ideal vehicle for vaccination against many infectious diseases (Ulmer et al., 1993; Chang et al., 2001), since they not only induce both antibody and broad T cell responses (Pertmer et al., 1996), but also generate protective immunity against various pathogens (Fynan et al., 1993). However, since the immunogenicity of DNA vaccines is relatively weak compared with conventional vaccines, it is necessary to develop effective adjuvants to overcome this barrier. One of the most common strategies used in DNA vaccination is co-delivery of cytokine adjuvants (Choi et al., 2009). Thus, immunostimulatory cytokines

such as interleukin (IL)-2, IL-7, IL-12, IL-15 and IL-18 have been investigated as genetic adjuvants (Barouch et al., 2004). As a multifunctional cytokine, IL-7 has been considered seriously as an effective vaccine adjuvant. However, details of the molecular mechanisms underlying IL-7 enhancement of DNA vaccine immunogenicity remain elusive. Thus, it is highly worthwhile to perform a detailed analysis regarding the immunomodulatory effects of IL-7 as a novel DNA vaccine adjuvant. In this study, we found that the chIL-7 gene significantly increased expression of the common receptor gc on splenic lymphocytes from IBDV VP2-immunized chickens, and the chIL-7 protein significantly increased gc expression in unimmunized chicken lymphocytes. The gc is a common receptor subunit shared by a common-cytokine-receptor gc family, including IL-2, IL-4, IL-7, IL-9 and IL-15. All cytokines in this family are immunostimulatory, therefore, promotion of gc expression suggests an increase in these cytokine functions, which might be related to chIL-7 enhancement on the immunogenicity of IBDV VP2 DNA vaccine. Our previous work on the IL-7 gene as an OVA DNA vaccine adjuvant in a mouse model showed that mouse IL-7 could increase mouse IL-2 receptor a chain expression (Zhang et al., 2015) in lymphocytes, suggesting that IL-7 can increase IL-2 function, which might also contribute to IL-7 enhancement of DNA vaccine immunogenicity. Using a chicken model to investigate chicken cytokine adjuvant activity for chicken virus vaccines is superior to using mouse models since the phylogenetic relationship between mammals and poultry is distant, and the corresponding cytokines and cytokine receptors bear also significant differences in amino acid sequences and molecular structures. Therefore, using an animal model of the same species to investigate the biological adjuvant activity of cytokines is likely to reflect the real life situation. Thus, our study has not only shown that the chIL-7 gene possesses potent adjuvant activity for the IBDV VP2 DNA vaccine, but has also provided important experimental data for chIL-7 gene application in chicken clinics as a biological adjuvant for IBDV VP2 DNA vaccine as well as for other chicken virus vaccines. Conflict of interest The authors declare that there is no conflict of interest with respect to the content of the manuscript. Acknowledgements This study was supported by the Natural Science Foundation of Hebei (C2013204130), the Research Project of Hebei University Science and Technology (ZD20131056).

S. Huo et al. / Veterinary Microbiology 193 (2016) 145–155

References Azad, A.A., McKern, N.M., Macreadie, I.G., Failla, P., Heine, H.G., Chapman, A., Ward, C.W., Fahey, K.J., 1991. Physicochemical and immunological characterization of recombinant host-protective antigen (VP2) of infectious bursal disease virus. Vaccine 9, 715–722. Azevedo, R.I., Soares, M.V., Barata, J.T., Tendeiro, R., Serra-Caetano, A., Victorino, R. M., Sousa, A.E., 2009. IL-7 sustains CD31 expression in human naive CD4+ T cells and preferentially expands the CD31+ subset in a PI3K-dependent manner. Blood 113, 2999–3007. Balamurugan, V., Kataria, J.M., 2006. Economically important non-oncogenic immunosuppressive viral diseases of chicken–current status. Vet. Res. Commun. 30, 541–566. Barouch, D.H., Letvin, N.L., Seder, R.A., 2004. The role of cytokine DNAs as vaccine adjuvants for optimizing cellular immune responses. Immunol. Rev. 202, 266– 274. Brown, M.D., Skinner, M.A., 1996. Coding sequences of both genome segments of a European ‘very virulent’ infectious bursal disease virus. Virus Res. 40, 1–15. Chang, H., Lin, T., Wu, C., 2001. DNA-mediated vaccination against infectious bursal disease in chickens. Vaccine 20, 328–335. Chazen, G.D., Pereira, G.M., LeGros, G., Gillis, S., Shevach, E.M., 1989. Interleukin 7 is a T-cell growth factor. Proc. Natl. Acad. Sci. U. S. A. 86, 5923–5927. Chen, H., Zhong, F., Li, X., Wang, L., Sun, Y., Neng, C., Zhang, K., Li, W., Wen, J., 2012. Effects of canine IL-2 and IL-7 genes on enhancing immunogenicity of canine parvovirus VP2 gene vaccine in mice. Wei Sheng Wu Xue Bao 52, 1392–1399 (In Chinese). Chen, J., Li, Z.Y., Petersen, E., Liu, W.G., Zhu, X.Q., 2016. Co-administration of interleukins 7 and 15 with DNA vaccine improves protective immunity against Toxoplasma gondii. Exp. Parasitol. 162, 18–23. Choi, S.Y., Suh, Y.S., Cho, J.H., Jin, H.T., Chang, J., Sung, Y.C., 2009. Enhancement of DNA vaccine-induced immune responses by influenza virus NP Gene. Immune Netw. 9, 169–178. Fry, T.J., Mackall, C.L., 2001. Interleukin-7: master regulator of peripheral T-cell homeostasis? Trends Immunol. 22, 564–571. Fussell, L.W., 1998. Poultry industry strategies for control of immunosuppressive diseases. Poultry Sci. 77, 1193–1196. Fynan, E.F., Webster, R.G., Fuller, D.H., Haynes, J.R., Santoro, J.C., Robinson, H.L., 1993. DNA vaccines: protective immunizations by parenteral, mucosal, and gene-gun inoculations. Proc. Natl .Acad. Sci. U. S. A. 90, 8–11482. Gao, H., Li, K., Gao, L., Qi, X., Gao, Y., Qin, L., Wang, Y., Wang, X., 2013. DNA prime– protein boost vaccination enhances protective immunity against infectious bursal disease virus in chickens. Vet. Microbiol. 64, 9–17. Hickman, C.J., Crim, J.A., Mostowski, H.S., Siegel, J.P., 1990. Regulation of human cytotoxic T lymphocyte development by IL-7. J. Immunol. 145, 2415–2420. Hou, L., Jie, Z., Liang, Y., Desai, M., Soong, L., Sun, J., 2015. Type 1 interferon-induced IL-7 maintains CD8+ T-cell responses and homeostasis by suppressing PD-1 expression in viral hepatitis. Cell. Mol. Immunol. 12, 213–221. Hsieh, M.K., Wu, C.C., Lin, T.L., 2006. The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination. Vaccine 24, 6955–6965. Hulse, D.J., Romero, C.H., 2004. Partial protection against infectious bursal disease virus through DNA-mediated vaccination with the VP2 capsid protein and chicken IL-2 genes. Vaccine 22, 1249–1259. Huo, S., Wang, L., Zhang, Y., Zhang, J., Zuo, Y., Xu, J., Cui, D., Li, X., Zhong, F., 2016. Molecular cloning and characterization of chicken IL-7 and its antiviral activity against IBDV in vivo. Poult. Sci. (pii: pew251. [Epub ahead of print]). Kibenge, F.S., Qian, B., Cleghorn, J.R., Martin, C.K., 1997. Infectious bursal disease virus polyprotein processing does not involve cellular proteases. Arch. Virol. 142, 2401–2419. Komschlies, K.L., Grzegorzewski, K.J., Wiltrout, R.H., 1995. Diverse immunological and hematological effects of interleukin 7: implications for clinical application. J. Leukoc. Biol. 58, 623–633. Kumar, S., Ahi, Y.S., Salunkhe, S.S., Koul, M., Tiwari, A.K., Gupta, P.K., Rai, A., 2009. Effective protection by high efficiency bicistronic DNA vaccine against infectious bursal disease virus expressing VP2 protein and chicken IL-2. Vaccine 27, 864–869. Leone, A., Picker, L.J., Sodora, D.L., 2009. IL-2, IL-7 and IL-15 as immune-modulators during SIV/HIV vaccination and treatment. Curr. HIV Res. 7, 83–90. Li, K., Gao, H., Gao, L., Qi, X., Gao, Y., Qin, L., Wang, Y., Wang, X., 2013. Adjuvant effects of interleukin-18 in DNA vaccination against infectious bursal disease virus in chickens. Vaccine 31, 1799–1805. Lombardo, E., Maraver, A., Espinosa, I., Fernandez-Aris, A., Rodriguez, J.F., 2000. VP5, the nonstructural polypeptide of infectious bursal disease virus, accumulates within the host plasma membrane and induces cell lysis. Virology 277, 345–357.

155

Müller, H., Becht, H., 1982. Biosynthesis of virus specific proteins in cells infected with infectious bursal disease virus and their significance as structural elements for infectious and incomplete particles. J. Virol. 44, 384–392. Mardassi, H., Khabouchi, N., Ghram, A., Namouchi, A., Karboul, A., 2004. A very virulent genotype of infectious bursal disease virus predominantly associated with recurrent infectious bursal disease outbreaks in Tunisian vaccinated flocks. Avian Dis. 48, 829–840. Milne, C.D., Fleming, H.E., Paige, C.J., 2004. IL-7 does not prevent pro-B/pre-B cell maturation to the immature/sIgM(+) stage. Eur. J. Immunol. 34, 2647–2655. Nakamura, Y., Gojobori, T., Ikemura, T., 2000. Codon usage tabulated from the international DNA sequence databases: status for the year 2000. Nucl. Acids Res. 28 292–292. Namen, A.E., Lupton, S., Hjerrild, K., Wignall, J., Mochizuki, D.Y., Schmierer, A., Mosley, B., March, C.J., Urdal, D., Gillis, S., 1988. Stimulation of B-cell progenitors by cloned murine interleukin-7. Nature 333, 571–573. Namen, A.E., Schmierer, A.E., March, C.J., Overell, R.W., Park, L.S., Urdal, D.L., Mochizuki, D.Y., 1998. B cell precursor growth-promoting activity: purification and characterization of a growth factor active on lymphocyte precursors. J. Exp. Med. 167, 988–1002. Napolitano, L.A., Grant, R.M., Deeks, S.G., Schmidt, D., De Rosa, S.C., Herzenberg, L.A., Herndier, B.G., Andersson, J., McCune, J.M., 2001. Increased production of IL-7 accompanies HIV-1-mediated T-cell depletion: implications for T-cell homeostasis. Nat. Med. 7, 73–79. Park, S.H., Song, M.Y., Nam, H.J., Im, S.J., Sung, Y.C., 2010. Codelivery of IL-7 augments multigenic HCV DNA vaccine-induced antibody as well as broad T Cell responses in cynomolgus monkeys. Immune Netw. 10, 198–205. Pertmer, T.M., Roberts, T.R., Haynes, J.R., 1996. Influenza virus nucleoprotein-specific immunoglobulin G subclass and cytokine responses elicited by DNA vaccination are dependent on the route of vector DNA delivery. J. Virol. 70, 6119–6125. Pradhan, S.N., Prince, P.R., Madhumathi, J., Roy, P., Narayanan, R.B., Antony, U., 2012. Protective immune responses of recombinant VP2 subunit antigen of infectious bursal disease virus in chickens. Vet. Immunol. Immunopathol. 148, 293–301. Pradhan, S.N., Prince, P.R., Madhumathi, J., Arunkumar, C., Roy, P., Narayanan, R.B., Antony, U., 2014. DNA vaccination with VP2 gene fragment confers protection against infectious bursal disease virus in chickens. Vet. Microbiol. 171, 13–22. Rodriguez-Chavez, I.R., Rosenberger, J.K., Cloud, S.S., 2002. Characterization of the antigenic, immunogenic, and pathogenic variation of infectious bursal disease virus due to propagation indifferent host systems(bursa,embryo, and cell culture) I. Antigenicity and immunogenicity. Avian Pathol. 31, 463–471. Roh, H.J., Sung, H.W., Kwon, H.M., 2006. Effects of DDA, CpG-ODN, and plasmidencoded chicken IFN-gamma on protective immunity by a DNA vaccine against IBDV in chickens. J. Vet. Sci. 7, 361–368. Schluns, K.S., Lefrançois, L., 2003. Cytokine control of memory T-cell development and survival. Nat. Rev. Immunol. 3, 269–279. Snyder, D.B., 1990. Changes in the field status of infectious bursal disease virus. Avian Pathol. 19, 419–423. Spies, U., Müller, H., Becht, H., 1987. Properties of RNA polymerase activity associated with infectious bursal disease virus and characterization of its reaction products. Virus Res. 8, 127–140. Su, B.S., Chiu, H.H., Lin, C.C., Shien, J.H., Yin, H.S., Long, L.H., 2011. Adjuvant activity of chicken interleukin-12 co-administered with infectious bursal disease virus recombinant VP2 antigen in chickens. Vet. Immunol. Immunopathol. 139, 167– 175. Sun, Y., Zhong, F., Li, X., Wang, X., Wang, L., Jia, Q., Han, D., Li, Z., Zhang, F., Pan, H., 2012. Immune enhancing effects of canine interleukin-7 gene on canine parvovirus DNA vaccine. Sci. Agric. Sin. 45, 2058–2066. Tsukamoto, K., Tanimura, N., Kakita, S., Ota, K., Mase, M., Imai, K., Hihara, H., 1995. Efficacy of three live vaccines against highly virulent infectious bursal disease virus in chickens with or without maternal antibodies. Avian Dis. 39, 218–229. Tsukamoto, K., Sato, T., Saito, S., Tanimura, N., Hamazaki, N., Mase, M., Yamaguchi, S., 2000. Dual-viral vector approach induced strong and long-lasting protective immunity against very virulent infectious bursal disease virus. Virology 269, 257–267. Ulmer, J.B., Donnelly, J.J., Parker, S.E., Rhodes, G.H., Felgner, P.L., Dwarki, V.J., Gromkowski, S.H., Deck, R.R., DeWitt, C.M., Friedman, A., 1993. Heterologous protection against influenza by injection of DNA encoding a viral protein. Science 259, 1745–1749. Zakhartchouk, A.N., Viswanathan, S., Moshynskyy, I., Petric, M., Babiuk, L.A., 2007. Optimization of a DNA vaccine against SARS. DNA Cell Biol. 26, 721–726. Zhang, Y., Liang, S., Li, X., Wang, L., Zhang, J., Xu, J., Huo, S., Cao, X., Zhong, Z., Zhong, F., 2015. Mutual enhancement of IL-2 and IL-7 on DNA vaccine immunogenicity mainly involves regulations on their receptor expression and receptorexpressing lymphocyte generation. Vaccine 33, 3480–3487.