Chondroprotective and anti-inflammatory effects of sesamin

Phytochemistry 80 (2012) 77–88

Contents lists available at SciVerse ScienceDirect

Phytochemistry journal homepage: www.elsevier.com/locate/phytochem

Chondroprotective and anti-inflammatory effects of sesamin Thanyaluck Phitak a, Peraphan Pothacharoen a, Jongkolnee Settakorn b, Wilart Poompimol c, Bruce Caterson d, Prachya Kongtawelert a,⇑ a

Thailand Excellence Center for Tissue Engineering and Stem Cells, Department of Biochemistry, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand Department of Pathology, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand c Faculty of Science, Lampang Rajabhat University, Lampang, Thailand d Cardiff School of Biosciences, Biomedical Sciences Building, Museum Avenue, Cardiff CF10 3AX, Wales, UK b

a r t i c l e

i n f o

Article history: Received 19 January 2011 Received in revised form 7 August 2011 Available online 14 June 2012 Keywords: Sesamum indicum Pedaliaceae Sesamin Proteoglycan Collagen Papain-induced OA rat Interleukin-1beta

a b s t r a c t Osteoarthritis (OA) is a major disability of elderly people. Sesamin is the main compound in Sesamun indicum Linn., and it has an anti-inflammatory effect by specifically inhibiting D5-desaturase in polyunsaturated fatty acid biosynthesis. The chondroprotective effects of sesamin were thus studied in a porcine cartilage explant induced with interleukin-1beta (IL-1b) and in a papain-induced osteoarthritis rat model. With the porcine cartilage explant, IL-1b induced release of sulfated-glycosaminoglycan (s-GAG) and hydroxyproline release, and this induction was significantly inhibited by sesamin. This ability to inhibit these processes might be due to its ability to decrease expression of MMP-1, -3 and -13, which can degrade both PGs and type II collagen, both at the mRNA and protein levels. Interestingly, activation of MMP-3 might also be inhibited by sesamin. Moreover, in human articular chondrocytes (HACs), some pathways of IL-1b signal transduction were inhibited by sesamin: p38 and JNK. In the papain-induced OA rat model, sesamin treatment reversed the following pathological changes in OA cartilage: reduced disorganization of chondrocytes in cartilage, increased cartilage thickness, and decreased type II collagen and PGs loss. Sesamin alone might increase formation of type II collagen and PGs in the cartilage tissue of control rats. These results demonstrate that sesamin efficiently suppressed the pathological processes in an OA model. Thus, sesamin could be a potential therapeutic strategy for treatment of OA. Crown Copyright Ó 2012 Published by Elsevier Ltd. All rights reserved.

1. Introduction Osteoarthritis (OA) is the most common form of arthritis affecting millions of people worldwide and is a major cause of disability in elderly people (Goldring, 2006). In this regard, the chondrocyte is of clinical importance in the context of pathogenesis of OA, which results from a failure to maintain a balance between synthesis and degradation of the cartilage extracellular matrix (ECM). The association of increased production of proteinases, including matrix metalloproteinases (MMPs), MMP-1, MMP-3, MMP-8 and MMP-13 and the aggrecanases, A Disintegrin And Metalloproteinase with ThromboSpondin (ADAMTS)-4 and -5, with cartilage damage has now been well established. Localized degradation of proteoglycans and type II collagen occurs initially at the cartilage surface resulting in an increase in water content and loss of tensile strength in the cartilage matrix as the lesion progresses (Struglics et al., 2006). Collagenase-3 (i.e. MMP-13) from chondrocytes selectively enhances cleavage and denaturation of type II collagen in OA cartilage as well as aggrecan at the specific protease cleavage sites ⇑ Corresponding author. Tel.: +66 53 894199; fax: +66 53 894188. E-mail address: [email protected] (P. Kongtawelert).

(Mitchell et al., 1996; Billinghurst et al., 1997). MMP-13 levels are also high in remodeling rabbit synovial connective tissues (Hellio Le Graverand et al., 2000). Human OA cartilage has an elevated expression of MMP-13 RNA and protein that can be induced by interleukin-1 (IL-1) and tumor necrosis factor-alpha (TNF-a) through c-fos signaling in chondrocytes (Borden et al., 1996; Reboul et al., 1996; Shlopov et al., 1997). Thus, MMP-13 is and has been a major target for developing cartilage-protective drugs; i.e. the specific blocking of either IL-1 induced MMP-13 enzymes or their gene expression by novel physiological and pharmacological inhibitors is an important therapeutic approach for arthritis (Chen et al., 2001). IL-1 is a major pro-inflammatory cytokine implicated in arthritic joint damage. IL-1b activates four signaling cascades upon binding to its cell surface receptor IL-1RI. The best-characterized subsequent signaling cascade involves NFjB, the three other cascades activate the terminal MAPKs, JNK, p38, and ERK pathways that transmit signals from extracellular stimuli to activate transcription factors (Chen et al., 2001; Johnson and Lapadat, 2002). Activation of the MAPK cascade finally results in the expression of a number of genes, including MMPs, TNF-a and cyclooxygenase-2 (COX-2) (Pendas et al., 1997; Pahl, 1999; Allport et al., 2000; Pelletier

0031-9422/$ - see front matter Crown Copyright Ó 2012 Published by Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.phytochem.2012.05.016

78

T. Phitak et al. / Phytochemistry 80 (2012) 77–88

et al., 2001; Benderdour et al., 2002; Liacini et al., 2002; Paik et al., 2002; Ramsay et al., 2003). Sesame lignans from Sesamun indicum seeds are potent antioxidants and sesamin (1) is the most abundant lignan in sesame seed oil (Jeng et al., 2005). Past studies found that sesamin (1) enhances hepatic detoxification, reduces incidence of chemically induced mammary tumors and protects against oxidative stress (Hirose et al., 1992; Akimoto et al., 1993). However, this present study found that in clinical trials, sesamin (1) could not improve cardiovascular disease risk markers in overweight men and women (Wu et al., 2009a,b). Many potential pathways for sesamin (1) bioactivity were proposed including inhibiting delta-5 desaturase activity in fatty acid metabolism, resulting in an accumulation of dihomo-linolenic acid (DGLA) that can displace arachidonic acid and decrease formation of pro-inflammatory mediators, such as prostaglandin E2 and leukotriene B4 (Iversen et al., 1992; Chavali et al., 1998) and it can inhibit cytochrome P450 enzyme leading to reduction of 20-hydroxyeicosatetraenoic acid synthesis (Wu et al., 2009a,b). Moreover, sesamin (1) and sesamolin (2) (chemical structures were shown in Fig. 1) suppress lipopolysaccharide (LPS)-induced nitric oxide (NO) production in microglia and macrophages through inhibition of signal transduction pathways or nuclear transcription factors (Wang et al., 2002; Hou et al., 2003). In this study, using porcine cartilage explant culture systems, it was found that sesamin (1) has the ability to reverse IL-1b induced effects on both degradation of type II collagen and proteoglycans (PGs) by causing a reduction of hydroxyproline (HPR) and sulphated-glycosaminoglycan (s-GAG) release, respectively. The chondroprotective effect of sesamin (1) was further studied, and it was found that it could also inhibit expression of MMP-1, -3 and -13 and possibly inhibition of MMP-3 activation. These results may be due to sesamin (1) inhibiting IL-1b induced phosphorylation of p38 and JNK in the MAPK pathway. Furthermore, in the

papain-induced OA model in rats, the pathological progression of cartilage degradation was reduced by sesamin (1) in a dose-dependent manner. Collectively, these data suggest that sesamin (1) may be a natural drug of choice for treatment of arthritic diseases. 2. Results 2.1. Chondroprotective effects of sesamin (1) in porcine cartilage explant cultures In order to determine any potential chondroprotective effects of sesamin (1), porcine cartilage explant cultures, in the presence or absence of IL-1b, were used as a model test system. Thirty to 35 mg cartilage discs were cultured in 24-well plates and then co-treated with ±10 ng/ml IL-1b to induce inflammation and ±10 lM sesamin (1) for 28 days. Conditioned media were collected and changed at days 4, 7, 14, 21 and 28 of the experimental period. The degradation of PGs and type II collagen in cartilage tissue was investigated by measurement of sulfated glycosaminoglycans and hydroxyproline release into the conditioned media. Exposure to IL-1b significantly induced release of sulfated glycosaminoglycan at days 4 and 7 by approximately 1.8- and 2-fold, respectively, when compared with controls and these increases were significantly inhibited by 1.0 lM sesamin (1) (Fig. 2A). The ability of sesamin (1) to inhibit this IL-1b induced PGs degradation was confirmed by measurement of uronic acid remaining in cartilage tissue explants at the end of experimentation (Fig. 2B). These results showed that the uronic acid remaining in the explants was decreased by exposure to IL-1b, and this effect was also inhibited by sesamin (1) indicating that it inhibited PG degradation in cartilage treated with IL-1b. IL-1b exposure alone did not induce degradation of collagen as shown with the unchanged release of hydroxyproline from these explant cultures (Fig. 3A). However, there have been published reports which described that oncostatin M (OSM) has been observed in inflammatory diseases such as arthritis and multiple sclerosis. Its role in arthritis is its capacity to synergize the action of other inflammatory cytokines: e.g. IL-1, TNF-a, IL-17 and LPS (Koshy et al., 2002). Thus, co-treatment of cartilage with IL-1b and OSM was also investigated. In these experiments, it was found that the combination of IL-1b with OSM (IL-1b/OSM) could induce release of hydroxyproline at days 21 and 28 (Fig. 4A). However, the presence of sesamin (1) had the ability to reverse this IL-1b/OSM effect on release of hydroxyproline into the explant media (Fig. 4A). This inhibition of hydroxyproline release in the presence of sesamin (1) was confirmed with the analyses of the hydroxyproline remaining in the cartilage explant tissue (Fig. 4B). Collectively, these results show that exposure to sesamin (1) has a chodroprotective effect on cartilage metabolism through its inhibition of IL1b-induced PG degradation and inhibition of IL-1b/OSM-induced collagen degradation. 2.2. Sesamin (1) decreases MMP-1, -3 and -13 expression, but does not involve aggrecanase activity

Fig. 1. The chemical structure of sesamin (1), and sesamolin (2).

As described above, exposure to sesamin (1) inhibited degradation of PGs (s-GAG) and type II collagen (hydroxyproline, HRP) in cartilage explant tissue treated with IL-1b or IL-1b/OSM. Aggrecan, which is the main PG found in cartilage tissue, is degraded by a number of proteinases including MMPs, ADAMTS species, neutrophil elastase, as well as cathepsin G and B, respectively (Takaishi et al., 2008). Many MMPs, including MMP-1, -2, -3, -7, -8, -9, -13 and MT1-MMP preferentially cleave the Asn341-Phe342 bond (the MMP site) of aggrecan in its IGD (Fosang et al., 1992) and ADAMTS-4 (Tortorella et al., 1999) and -5 (Abbaszade et al.,

T. Phitak et al. / Phytochemistry 80 (2012) 77–88

79

Fig. 2. Sulfated GAG release (A) and uronic acid remaining in porcine cartilage tissue. Porcine cartilage discs had been cultured with IL-1b and/or 1 lM sesamin (1) for 28 days. The conditioned media were collected and changed at days 4, 7, 14, 21 and 28. The release of s-GAG was measured in media using dye-binding assay and the remaining of uronic acid were measured in papain-digested cartilage discs. ,  denote p value in t-test is lower than 0.05 and than 0.01, respectively.

1999) clip the Glu373–Ala374 bond (the aggrecanase site) in this IGD domain. For collagen, fibrillar type II collagen is the major collagen found in cartilage. Only MMPs including the classical collagenases (MMP-1, -8 and -13) and MT1-MMP can degrade fibrillar collagens (Fosang et al., 1996). Thus, the effect of sesamin (1) on aggrecanase activity and MMP expression was investigated. The activities of aggrecanases were studied using the reaction of the BC-3 antibody, which recognizes the aggrecanase-generated N-terminal neoepitope cleavage site on the aggrecan core protein. The conditioned media of cartilage explants (at day 4) was used to investigate the potential involvement of aggrecanases, and it was found that IL-1b could induce degradation of aggrecan by aggrecanases in these explant culture systems as indicated from the appearance of the BC-3 neoepitope (Fig. 5). Sesamin (1) could not inhibit IL-1b-induced-aggrecanase activities (Fig. 5). Thus, in order to study the effect of sesamin (1) on MMP activity, HACs were co-treated with IL-1b and various concentrations of sesamin (1) for 24 h and the mRNA and protein expression of MMP-1, -3 and -13 were studied. IL-1b significantly induced MMP-1, -3 and -13 expression at both the mRNA and protein levels (Figs. 6 and 7). Interestingly, exposure to sesamin (1) reversed effects of IL-1b on MMP-1, -3 and -13 expression (Figs. 6 and 7). Moreover, activation of MMP-1, -3 and -13 was increased by

IL-1b (indicating presence in their active forms). However, the activation of MMP-1 and -13 may not be influenced by exposure to sesamin (1), but MMP-3 activation was significantly reduced when it was present in the culture media (Fig. 7). Collectively, these data demonstrate that sesamin (1) had a chondroprotective effect that may be due to its ability to repress MMP-1, -3 and -13 expression in this IL-1b induced HAC culture model. 2.3. Sesamin (1) inhibited IL-1b signal transduction in HAC cultures The best characterized cascade of IL-1b signaling involves NFjB and the three others which activate the terminal MAPKs, JNK, p38, and ERK, that transmit signals from extracellular stimuli to activate transcription factors in cells (Chen et al., 2001; Johnson and Lapadat, 2002). Thus, whether sesamin (1) exposure could inhibit these types of activation of the MAPK family was next examined. Thus, HACs were co-treated with 10 ng/ml IL-1b and sesamin (1) for 15 min. The phosphorylation of p38, ERK1/2, and JNK was then studied using an immunoblotting analysis approach. For the MAPK pathway, IL-1b significantly induced p38 and JNK phosphorylation. ERK1/2 was normally phosphorylated and it phosphorylation was increased when IL-1b was present. Sesamin (1) exposure inhibited IL-1b signals through p38 and JNK but did not act through ERK1/2 (Fig. 8).

80

T. Phitak et al. / Phytochemistry 80 (2012) 77–88

Fig. 3. Hydroxyproline release (A) and remaining in porcine cartilage explant (B). Porcine cartilage discs had been cultured with IL-1b and/or 1 lM sesamin (1) for 28 days. Conditioned media were collected and changed at days 4, 7, 14, 21 and 28. The release and remaining of hydroxyproline were measured in HCl hydrolyzed-media and cartilage disc, respectively, as described in experimental procedures. ,  denote p value in t-test is lower than 0.05 and than 0.01, respectively.

2.4. Sesamin (1) inhibits pathological cartilage degradation and pathology progression in a papain-induced rat model of osteoarthritis (OA) Rat knee joints were induced to express OA-like cartilage degradation by means of a papain injection into their right knees. Histochemical analyses using hematoxylin and eosin staining of cartilage sections from control rats showed that they had a normal thickness with well-organized zones and columns of chondrocytes (Fig. 9A); the test group given 10 lM sesamin (1) exhibited similar results (Fig. 9B). However, the cartilage sections in the papain-induced OA group showed significant pathological changes including thinning articular cartilage and disorganized chondrocyte morphology (Fig. 9C). Interestingly, the OA group treated with 1 and 10 lM sesamin (1) showed thicker cartilage and better organization of chondrocytes when compared with untreated OA rats (Fig. 9D and E). The PGs present in cartilage tissue matrix were also examined after safranin O staining. The 10 lM sesamin (1)-treated group showed the strongest intensity of safranin O staining (Fig. 10B) and the safranin O staining had the lowest intensity in the OA group (Fig. 10C). Interestingly, treatment of the OA group with 1 and 10 lM sesamin (1) demonstrated a stronger intensity of safranin O staining (in a dose-dependent manner) when compared with the untreated OA group (Fig. 10D and E). An immunohistochemical analysis for the presence of type II collagen was also performed. Here the OA group showed weak

and focal collagen staining intensities (Fig. 11C). However, the OA rats treated with 1 and 10 lM sesamin (1) showed strong and diffuse collagen intensity in the extracellular matrix of the cartilage tissue sections, as well as in the control groups (Fig. 11A, D and E). Again, interestingly, the 10 lM sesamin (1) group exhibited a stronger type II collagen staining intensity than that observed in the control group (Fig. 11B). These results support the conclusion that sesamin (1) exposure can inhibit the pathological progression of papain-induced OA in this rat model. Moreover, sesamin (1) alone may actually increase the content of PGs and type II collagen in the cartilage extracellular matrix of non-treated rats. 3. Discussion OA is a multifactorial degenerative joint disease in which the cartilaginous matrix of the articular joint is slowly but progressively destroyed. Disruption of the balance between cytokine-induced catabolic and anabolic processes leads to cartilage erosion that can reach the levels of eburnation to the subchonal bone (Pelletier et al., 1997). There is considerable published evidence that IL-1b is a key mediator in joint cartilage breakdown, through its ability to induce expression of several MMPs (Pujol et al., 1984; Pujol and Loyau, 1987; Pelletier and Martel-Pelletier, 1989) and also the aggrecanases. Syntheses of extracellular matrix component are also down-regulated by IL-1b exposure, including type II collagen, limiting the potential repair of articular cartilage (Benton and Tyler, 1988; Goldring et al., 1988). IL-1b has also attracted

T. Phitak et al. / Phytochemistry 80 (2012) 77–88

81

Fig. 4. Hydroxyproline release (A) and remaining in porcine cartilage explant (B). Porcine cartilage discs had been cultured with IL-1b OSM and/or 1 lM sesamin (1) for 28 days. Conditioned media were collected and changed at days 4, 7, 14, 21 and 28. The release and remaining of hydroxyproline were measured in HCl hydrolyzed-media and cartilage disc, respectively, as described in experimental procedures. ,  denote p value in t-test is lower than 0.05 and than 0.01, respectively.

considerable interest as a potential target for OA disease modification. There have also been many studies investigating the effects of IL-1 receptor antagonist (IL-1Ra) where it was shown that addition of IL-1Ra to OA explants inhibits inflammatory mediators, MMP production and increases type II collagen and aggrecan synthesis (Caron et al., 1996; Zhang et al., 2004). There were some reports describing anti-inflammatory effects of sesamin (1) and showing that it had its anti-inflammatory effects by specifically inhibiting D5 desaturase in unsaturated fatty acid biosynthesis (Iversen et al., 1992; Chavali et al., 1998). Hence, whether or not sesamin (1) had other anti-inflammatory effect, especially inhibition of IL-1b, was the subject of this study. The porcine cartilage explant was our first screening model where it was shown that sesamin (1) exposure could inhibit IL-1b increases in PG degradation as shown by inhibition of s-GAG released to the media and abrogation of uronic acid loss from the cartilage tissue. Moreover, it was found that IL-1b alone could not induce collagen degradation as shown by lack of changes in hydroxyproline release levels. However, the co-treatment of IL-1b and OSM in this explant culture system lead to degradation of collagen. This result supports earlier publications describing the synergistic effect of OSM and IL-1b (Koshy et al., 2002). In our studies, sesamin (1) had the ability to inhibit degradation of collagen in the cartilage tissue that had been induced with IL-1b/OSM. The collagen content in cartilage explants at the end of experiment was measured to confirm this result, the level of collagen remaining in cartilage explant disc

being significantly reduced by IL-1b/OSM but this effect was reversed by exposure to sesamin (1). Again, these results show that in the pathology of OA, in which there is the degradation of PGs

Fig. 5. Aggrecanase activities. Conditioned media of cartilage explant treated with IL-1b and/or 1 lM sesamin (1) for 4 days were used to inject into SDS–PAGE and transferred to membrane. BC-3 was used to probe the membrane. Alkaline phosphatase conjugated anti-mouse IgG was used as secondary antibody. The reaction was developed using alkaline phosphatase substrate.

82

T. Phitak et al. / Phytochemistry 80 (2012) 77–88

Fig. 6. MMP-1, -3 and -13 mRNA expressions in HAC treated with IL-1b and with or without sesamin (1). Eighty percent confluent of HACs were co-treated with 10 ng/ml IL1b and various concentrations of sesamin (1) (0.25, 0.5 and 1.0 lM) for 24 h. Cells were harvested and mRNA was isolated. Complementary DNA was generated by reverse transcription PCR. The mRNA of these genes were investigated using real-time PCR using primer as described in experimental and procedures. ,  denoted p value in the ttest between indicated and control IL-1b group (with IL-1 and without sesamin) is lower than 0.05 and than 0.01, respectively.

Fig. 7. MMP-1, -3 and -13 protein expression in HAC treated with IL-1b and with or without sesamin. Eighty percent confluent of HACs were co-treated with 10 ng/ml IL-1b and various concentrations of sesamin (1) (0.25, 0.5 and 1.0 lM) for 24 h. Conditioned media were collected and concentrated using centrifugal filter column (cut off = 10 kDa). Filtrated-media were used to inject into SDS–PAGE and transfer to membrane. MMP-1, -3 and -13 protein levels were investigated using specific antibodies as described in experimental and procedures.,  denote p value in t-test is lower than 0.05 and than 0.01, respectively.

and collagen in ECM of tissue, sesamin (1) might reduce these catabolic mechanisms and thus slow the destruction of cartilage in the progression of OA. From the results above, using the porcine cartilage explant culture model it was next hypothesized that sesamin (1) directly inhibited proteinases, which degrade PGs and collagens in cartilage. Aggrecan, which is the main PG found in cartilage tissue, is degraded by a number of proteinases including MMPs, ADAMTS

species, neutrophil elastase, cathepsin G and B (Takaishi et al., 2008). Many MMPs, including MMP-1, -2, -3, -7, -8, -9, -13 and MT1-MMP preferentially cleave the Asn341-Phe342 bond (the MMP site) of aggrecan (Fosang et al., 1992) and ADAMTS-4 (Tortorella et al., 1999) and -5 (Abbaszade et al., 1999) cleave the Glu373-Ala374 bond (the aggrecanase site). For collagen, fibrillar type II collagen is the major type found in cartilage. Only MMPs including the classical collagenases (MMP-1, -8 and -13) and

T. Phitak et al. / Phytochemistry 80 (2012) 77–88

Fig. 8. The effects of sesamin (1) on the phosphorylation of MAPK protein families. HAC were co-treated with 10 ng/ml IL-1b and with or without sesamin (1) for 15 min for investigation of the activations of MAPK pathways. Cells were extracted using lysis buffer. Cell extracts were analyzed using western blot analysis as described in experimental and procedures.

MT1-MMP can degrade fibrillar collagen (Fosang et al., 1996). Thus, the potential mechanism of sesamin (1) in which it might protect PGs and collagen from excessive degradation was studied. The activities of aggrecanases were evaluated using the BC-3 mAb that specifically recognizes the neoepitope generated at the

83

N-terminal aggrecanase cleavage site on the aggrecan core protein. The investigations established that IL-1b exposure indeed induced aggrecanase activities as expected, but sesamin (1) exposure could not reverse this effect. MMP expression and activity was then examined. The expression of MMP-1, -3 and -13 was studied in a HAC culture system, where chondrocytes were treated with IL-1b. Our results showed that IL-1b induced both mRNA and protein levels of these MMPs. In the study of protein levels of these enzymes, it was also found that not only latent (zymogen) forms of these enzymes could be induced by IL-1b but active forms of these MMPs were also induced. Interestingly, sesamin (1) exposure was able to inhibit expression of these three MMPs at both the mRNA and protein levels. Furthermore, activation of MMP-3 may also be inhibited by sesamin (1) exposure. Intracellular signaling pathways in HAC cultures induced with IL-1b were also studied. Here it was found that IL-1b induced phosphorylation of all three MAPK protein families (p38, ERK1/2 and JNK). The activation of p38 and JNK was significantly inhibited by sesamin (1), but ERK1/2 was not. Collectively, these results indicate that the chondroprotective effects of sesamin (1) may be due to its ability to reverse some IL-1b signaling in HAC cultures leading to inhibition of MMP-1, -3 and -13 expression. An in vivo study was also performed to investigate the effect of sesamin (1) on rats where OA-like conditions were induced using papain injection into the knee. After an appropriate induction period, sesamin (1) was injected directly into the OA rats’ knee to establish whether its presence had any chondroprotective effects. Papain injection in untreated rat knees lead to progression of an OA-like pathology shows as disorganized cell zonal column morphology and thinner cartilage tissue when compared with normal rat knee cartilage. In addition, cartilage from papain-induced OA rats showed increased loss of PGs and type II collagen, as indicated in safranin O staining and type II collagen immunohistochemical

Fig. 9. H&E staining in cartilage of normal rats (A), mornal rats + 10 lM sesamin (1) (B), papain-induced OA rats (C), OA rats + 1 lM sesamin (1) (D) and OA rats + 10 lM sesamin (1) (E). Rats were induced to be OA using papain injection into the knees. After induction period, 1 or 10 lM sesamin (1) was injected into the knees of rats every 5 days for 25 days. Rats were sacrificed at the end of experiment and sections of knees’ rats were performed. Some sections were stained with H&E to investigate cell morphology.

84

T. Phitak et al. / Phytochemistry 80 (2012) 77–88

Fig. 10. Safranin O staining in cartilage of normal rats (A), mornal rats + 10 lM sesamin (1) (B), papain-induced OA rats (C), OA rats + 1 lM sesamin (1) (D) and OA rats + 10 lM sesamin (1) (E). Rats were induced to be OA using papain injection into the knees. After induction period, 1 or 10 lM sesamin (1) was injected into the knees of rats every 5 days for 25 days. Rats were sacrificed at the end of experiment and sections of knees’ rats were performed. Some sections were stained with safranin O to investigate the content of PGs in cartilage matrix.

Fig. 11. Type II collagen immunohistochemical staining in cartilage of normal rats (A), mornal rats + 10 lM sesamin (1) (B), papain-induced OA rats (C), OA rats + 1 lM sesamin (1) (D) and OA rats + 10 lM sesamin (1) (E). Rats were induced to be OA using papain injection into the knees. After induction period, 1 or 10 lM sesamin (1) was injected into the knees of rats every 5 days for 25 days. Rats were sacrificed at the end of experiment and sections of knees’ rats were performed. Some sections were immunohistochemical stained with anti-type II collagen antibody to investigate the content of type II collagen in cartilage matrix.

T. Phitak et al. / Phytochemistry 80 (2012) 77–88

staining, respectively. However, exposure to sesamin (1) appeared to reverse this OA-like pathology and progression of cartilage destruction in a dose-dependent manner. Interestingly, exposure to sesamin (1) alone at a dose of 10 lM appeared to have the ability to induce increased PGs and type II collagen deposition in the normal control rat cartilage tissue. However, the ability of sesamin (1) for induction of PGs and type II collagen was not found in any vitro model. Thus, these observed abilities, inductions of PGs and type II collagen contents in vivo model, might be due to some degradation of cartilage tissue in the control group. In the latter, rats were injected with normal saline solution in which this intra-articular injection might lead to slight progression of OA. Due to the ability of sesamin (1), the PGs and collagen deposition in the sesamin (1) control group was found to increase when compared with the control. Collectively, these combined results suggest that sesamin (1) administration may be a good choice for future treatment of OA diseases in humans. However, the dosage used in this experiment for injection into the knee was rather high. Thus, the route to apply sesamin (1) into the joint which results in a high dose and does not damage the cartilage, is interesting to study further e.g. using nanosome particle to deliver sesamin (1) through the skin into the joint space. 4. Concluding remarks Previous studies found advantages of sesamin (1) such as enhancing of hepatic detoxification, reducing of incidence of chemically induced mammary tumors and protects against oxidative stress (Hirose et al., 1992; Akimoto et al., 1993) but there is no report about the effect of sesamin (1) on cartilage degradation. Our study established the novel effect of sesamin (1) on cartilage degradation both in vivo and in vitro model. However, further study should be include in clinical trials for the evaluation as an anti-arthritic or anti-inflammatory treatment.

85

5.2. Porcine cartilage explant cultures The metacarpo- and metatarso-phalangeal joints from 20– 24 week-old pigs were dissected for articular cartilage. Cartilage slices were then incubated in serum-free Dulbecco’s modified Eagle’s medium (DMEM) containing 200 U/ml of penicillin and 200 lg/ml of streptomycin with 5% CO2 for 24 h at 37 °C. Recombinant human interleukin-1b (10 ng/ml) (R&D systems, Inc) and/or Oncostatin M (OSM) (R&D systems, Inc) (10 ng/ml) were used to induce cartilage degradation, and explants were also co-treated with IL-1b/OSM and 1 lM sesamin (1). Media were collected and changed on days 4, 7, 21 and 28 of experimentation and stored at 20 °C for further analyses. Explants were collected at the end of experiment and subjected to further analyses. All experiments were performed in triplicate using tissue from one animal donor and also experimentation was repeated three times independently. 5.3. Human articular chondrocyte (HAC) culture Normal (non-diseased) human articular cartilage was obtained with full informed patient consent from the arthroscopic diagnosis of a flat pad syndrome patient at Maharaj Nakorn Chiang Mai Hospital, (Department of Orthopedic, Faculty of Medicine, Chiang Mai University, Thailand (the Ethical approval code was 070CT111016). Chondrocytes were isolated by overnight trypsin digestion at 4 °C and a subsequent 3 h digestion with collagenase (Sigma–AldrichÒ, type IA) at 37 °C. The cells were washed with PBS and then cultured in DMEM containing 10% FCS as high-density primary monolayer cultures until confluence. The HACs at Passage 4 were maintained in serum free DMEM for 24 h prior to co-treatment with various concentrations of sesamin (1) (0.25, 0.5 and 1.0 lM) together with 10 ng/ml IL-1b (R&D systems, Inc) for 24 h to investigate expression of MMP-1, -3 and -13 at both mRNA and protein levels, for 15 min in order to study the activation of MAPK pathways, respectively.

5. Experimental

5.4. Cytotoxicity assays

5.1. Isolation of sesamin

The viability of chondrocytes in explants was investigated using the MTT assay (Denizot and Lang, 1986). At the end of each experiment, explants were washed with PBS and new culture media containing 10% of 5 mg/ml MTT (3,[4,4-dimethythiazol-2-yl]-2,5diphenyl-tetrazolium bromide) and were cultured for a further 4 h. Dimethylsulfoxide (DMSO) was then added (1 ml/explant) and shaking was performed overnight at room temperature (25 °C). The purple colored solution was measured for absorbance at 450 nm using a micro-plate reader. Similarly, HAC viability was also tested using the MTT assay. Cells (1  104) were plated in triplicate in a 96-well plate and incubated overnight. Cells were treated with different concentrations of sesamin (1) for 24 h. After incubation, culture media were discarded, and new culture media added containing 10% of 5 mg/ml MTT, and further treated by adding DMSO (0.2 ml) to each well to solubilize the formed formazane crystals. The absorbance was measured at 540 nm using a micro-plate reader spectrophotometer. Percent of cell survival was calculated as follows:

Seeds of S. indicum Linn. were collected from the Lampang Province of Thailand and voucher specimens (BKF No. 138181) were deposited at the National Park, Wildlife and Plant Conservation Department, Ministry of Natural Resources and Environment, Bangkok, Thailand. Air-dried and finely powdered seed (460 g) from S. indicum was percolated 6 times with 4 liters of hexane for 3 days at room temperature. The liquid extract was evaporated under reduced pressure to prepare a crude hexane extract. The latter was used for purification of sesamin (1). The crude extract was fractionated by silica gel column chromatography (CC) (Merck No. 7734, 500 g). Elution of subcomponents began using hexane, and then gradually enriched with EtOAc in hexane up to 20% v/v. Fractions were collected, analyzed by thin layer chromatography (TLC) and subcomponents combined. The fraction containing sesamin (1) which contained mainly colorless crystals, was re-applied to a silica gel column (Merck No. 7734, 120 g). The specific subfraction was further purified by crystallization with EtOH to yield colorless needle crystals, this being identified as sesamin (1) using nuclear magnetic resonance spectroscopy and mass spectrometry (430 mg, 0.11% yield) and confirmed with comparison to an authentic standard (Sigma–AldrichÒ) by co-chromatography using high performance liquid chromatography (column: Hypersil ODS25, 250  4.6 mm (ThermoHypersil Co.; eluted with linear gradient system comprising CH3CN and H2O (50:50 to 70:50 v/v) at the flow rate of 1.0 ml/min. Eluent was monitored at wavelength of 280 nm.)

% survival ¼ ðOD: of sample=OD: of controlÞ  100

5.5. Measurement of s-GAG levels The level of glycosaminoglycan released into the culture medium of explants was determined using the dimethylmethylene blue (DMMB) assay for sulfated glycosaminoglycan (Farndale et al., 1986) where shark cartilage chondroitin sulfate C (Sigma–Al-

86

T. Phitak et al. / Phytochemistry 80 (2012) 77–88

drichÒ, USA) was used as the standard. The DMMB solution was added to the diluted sample, standards and appropriate blank solutions prior to absorbances being read at 525 nm by micro-plate reader spectrophotometer. 5.6. Quantitation of uronic acid remaining in explants The uronic acid levels remaining in explants were measured after papain-digestion of the cartilage discs using m-hydroxydiphenyl in a colorimetric assay (Blumenkrantz and Asboe-Hansen, 1973). Glucuronic acid lactone was used as the standard. Concentrated sulfuric acid-borate reagent (300 ll) was added into both sample and a standard and incubated at 100 °C for 10 min and then cooled down to room temperature. A 12 ll aliquot of carbazole solution (50 mg carbazole in 40 ml EtOH) was then added and the samples further incubated at 100 °C for 10 min. Samples were cooled to room temperature and the absorbance of the pink color was read at 540 nm. 5.7. Measurement of hydroxyproline released into the media and that remaining in the explants Papain-digested cartilage or conditioned media were hydrolyzed with 6 N HCl for 24 h at 110 °C. After hydrolysis, samples were freeze-dried and resolubilized with distilled H2O. The hydroxyproline in each sample was oxidized to a pyrrole with chloramine T at pH 6. This intermediate gave a pink color with 4-dimethylaminobenzaldehyde. Samples were added with diluent solution (67% propan-2-ol) and oxidant solution (50 mM chloramine T), and color reagent (7.5% dimethylamino benzadehyde in propan-2-ol) (Kolar, 1990). The reaction was performed at 70 °C for 10–20 min. The absorbance of a peach color was read at 540 nm using a microtitre plate reader. 5.8. Western blot analyses for detection of aggrecannase activity Conditioned media were digested with 10–3 U chondroitinase ABC, keratinase and keratanase II overnight at 37 °C. The sample was then dialyzed against H2O, freeze-dried, reconstituted in SDS–PAGE buffer containing b-mercaptoethanol and subjected to 10% SDS–PAGE then transferred to nitrocellulose membrane with a glycine-transferring buffer [20 mM Tris base, 0.2 M glycine, 20% v/v MeOH (pH 8.5)]. After blocking non-specific sites with 5% non-fat dried milk, the membrane was probed with monoclonal antibody (mAb) BC-3 at 4 °C overnight. The BC-3 mAb recognizes the 374ARGSVI neoepitope sequence that is generated by aggrecanase cleavage of the aggrecan core protein in its interglobular domain (IGD) (Tortorella et al., 1998). The primary antibody BC-3 (diluted 1:100) and secondary antibody consisting of alkaline phosphatase conjugated anti-mouse IgG (diluted 1:7500) were used for detection of bound antigen. Immuno-positive bands were visualized using the alkaline phosphatase chromogen (BCIP/NBT) (AbcamÒ). 5.9. Gene expression analysis RNA was extracted from monolayer cells using an Aurum total RNA purification kit (Bio-Rad Laboratories, Hercules, CA, USA) according to the manufacture’s guidelines. Total RNA (500 ng) of each sample was reverse-transcribed into complementary DNA (cDNA) using a RevertAidTM First Stand cDNA synthesis kit (MBI Fermentas, Germany). Primer and probe sets were designed using Primer Express 2.0 software (Applied Biosystems, Foster City, CA, USA) to meet TaqmanÒ requirements and were designed to bind to separate exons to avoid false positive results arising from amplification of contaminating genomic DNA. Quantitative real-time

PCR was performed using SYBRÒ GreenERTM SuperMix Universal (InvitrogenÒ). The nucleotide sequences of primers were: MMP1; 5CTGTTCAGGGACAGAATGTGCT3, 3TCGATATGCTTCACAGTTCTA GGG 5, MMP-3; 5TTTTGGCCATCTCTTCCTTCA3, 3TGTGGATGCCTCT TGGGTATC5, MMP-13; 5TCCTCTTCTTGAGCTGGACTCATT3, 3CGCT CTGCAAACTGGAGGTC5, GAPDH; 5GAAGGTGAAGGTCGGAGTC3, 3GAAGATGG TGATGGGATTTC5. Real-time PCR experiments were performed three times and each with duplicates using the ABI7500 model. Gene expression was calculated using the following formula: 2Dct where Dct is the difference of threshold cycle of sample and its GAPDH reference (Livak and Schmittgen, 2001). 5.10. Protein extraction and Western blot analysis After co-treatment of HAC cultures with different concentrations of sesamin (1) and IL-1b, the cells were harvested for investigation of MAPK pathway activation. Cells were washed with ice-cold PBS, then lysis buffer (300 ll) containing 5% mercaptoethanol was added and the samples kept on ice for 10 min, then vortexed every few minutes before centrifugation at 15,000g for 10 min at 4 °C. Supernatants were transferred to new tubes and the debris in the pellets was discarded. For MMPs expression analyses, conditioned media was collected and concentrated using a 10 kDa centrifugal filter column (MilliporeÒ). Aliquots of lysates or concentrated media were heated for 5 min at 95 °C and then subjected to 10% SDS–PAGE and transferred to a nitrocellulose membrane with a glycine-transferring buffer [20 mM Tris base, 0.2 M glycine, 20% v/v MeOH (pH 8.5)]. After blocking non-specific sites with 5% non-fat dried milk, the membrane was probed with rabbit anti-b-actin, mouse anti-MMP-1, mouse anti-MMP-3, mouse anti-MMP-13 (CalbiochemÒ), rabbit anti–phosphorylated-p44/42 MAPK antibody, rabbit anti-phosphorylated-SAPK/JNK antibody, rabbit anti-phosphorylated-p38 MAPK antibody, rabbit anti p44/ 42 MAPK antibody, rabbit anti-SAPK/JNK antibody and rabbit anti-p38 MAPK antibody (Cell signaling technologyÒ) at 4 °C overnight. The primary antibodies (diluted 1:1000) and secondary antibody consisting of horse-radish peroxidase-conjugated anti-rabbit IgG or anti-mouse IgG (diluted 1:2000) were used for the detection of immuno-positive bands that were visualized using an ECL detection system (KPLÒ system). The relative intensities of the immunopositive bands were calculated using Scion image analysis software. 5.11. In vivo rat animal model experiments The use of animals conformed with international and national guidelines for ethical conduct on the care and use of animals. Animal use was also ethically approved by the Ethics Committee in the Faculty of Medicine, Chiang Mai University. Fifteen Wistar rats (8 week-old rats were obtained from the National Laboratory Animal Center, Mahidol University, Thailand) were randomly separated into 5 groups: (1) a control group of normal rats; (2) a sesamin (1) group of normal rats with 10 lM sesamin (1); (3) an OA group of rats in which OA was induced using papain injection to the knee joint; (4) OA rats treated with 1 lM sesamin (1); (5) OA rats treated with 10 lM sesamin (1). The OA rat model using papain injections was performed as previously described (Lin et al., 2006). A solution of 4% (w/v) papain solution in saline was sterilized and then injected into the right knee of rats on days 1, 4 and 7 of the experimental period. As a control, the same volume (20 ll) of sterile saline was injected into the right knee of rats in the control group at the same time intervals. Five days after the last injection of papain, rats were intra-articularly injected with 1 lM or 10 lM sesamin (1) (20 ll) every 5 days for 5 weeks after cessation of the papain injections. Animals in the sesamin (1) groups were injected with 10 lM sesamin (1) (20 ll). The Control groups

T. Phitak et al. / Phytochemistry 80 (2012) 77–88

were injected with 20 ll of sterile saline. Animals were sacrificed at the end of each experimental time point, and cartilage samples were removed from the tibial plateau in the right knee. These samples were fixed in 4% paraformadehyde overnight, embedded in wax and then cut into 5 lm thick sections perpendicular to the articular cartilage surface. Sections were stained with hematoxylin-eosin (H&E), Safranin O and immunohistochemically stained with anti-type II collagen. All stained-sections were examined with the aid of a qualified pathologist. 5.12. Immunohistochemical analysis For type II collagen staining, after deparaffinization and dehydration, sections were digested with 0.25 U chondroitinase ABC, 1.45 U testicular hyaluronidase and 0.25% trypsin for 15 min. Then sections were incubated in 3% H2O2 for 5 min and after being washed with PBS, sections were blocked with 5% bovine serum albumin in PBS for 30 min. Anti-mouse anti-type II collagen mAb (CalbiochemÒ) (diluted 1:250 in PBS) was added into the sections and incubated at 4 °C overnight. Horse-radish peroxidase-conjugated Anti-mouse IgG antibody (diluted 1:250) was added and incubated at room temperature for 1 h. The colored precipitate was developed using peroxidase substrate (DAB reagent kit, KPLÒ systems) followed by rehydration. 5.13. Statistical analysis Each indicator value from individual experiments were expressed as the Mean and Standard Deviation (SD). These values from each sample were compared with IL-1b treated controls using the Student’s t-test to show whether or not exposure to the compound would inhibit IL-1b-generated effects. Significance was assumed at p < 0.05. Acknowledgements The Royal Golden Jubilee Ph.D. Program (Grant No. PHD/0155/ 2548 to T.P.). The Graduate School of Chiang Mai University, Center of Excellence Chiang Mai University Fund, The National Research Council of Thailand, PERCH-CIC and Cerebos Awards (2006) provided financial support for this study. References Abbaszade, I., Liu, R.Q., Yang, F., Rosenfeld, S.A., Ross, O.H., Link, J.R., Ellis, D.M., Tortorella, M.D., Pratta, M.A., Hollis, J.M., Wynn, R., Duke, J.L., George, H.J., Hillman Jr., M.C., Murphy, K., Wiswall, B.H., Copeland, R.A., Decicco, C.P., Bruckner, R., Nagase, H., Itoh, Y., Newton, R.C., Magolda, R.L., Trzaskos, J.M., Burn, T.C., et al., 1999. Cloning and characterization of ADAMTS11, an aggrecanase from the ADAMTS family. J. Biol. Chem. 274, 23443–23450. Akimoto, K., Kitagawa, Y., Akamatsu, T., Hirose, N., Sugano, M., Shimizu, S., Yamada, H., 1993. Protective effects of sesamin against liver damage caused by alcohol or carbon tetrachloride in rodents. Ann. Nutr. Metab. 37, 218–224. Allport, V.C., Slater, D.M., Newton, R., Bennett, P.R., 2000. NF-kappaB and AP-1 are required for cyclo-oxygenase 2 gene expression in amnion epithelial cell line (WISH). Mol. Hum. Reprod. 6, 561–565. Benderdour, M., Tardif, G., Pelletier, J.P., Di Battista, J.A., Reboul, P., Ranger, P., Martel-Pelletier, J., 2002. Interleukin 17 (IL-17) induces collagenase-3 production in human osteoarthritic chondrocytes via AP-1 dependent activation: Differential activation of AP-1 members by IL-17 and IL-1beta. J. Rheumatol. 29, 1262–1272. Benton, H.P., Tyler, J.A., 1988. Inhibition of cartilage proteoglycan synthesis by interleukin I. Biochem. Biophys. Res. Commun. 154, 421–428. Billinghurst, R.C., Dahlberg, L., Ionescu, M., Reiner, A., Bourne, R., Rorabeck, C., Mitchell, P., Hambor, J., Diekmann, O., Tschesche, H., Chen, J., Van Wart, H., Poole, A.R., 1997. Enhanced cleavage of type II collagen by collagenases in osteoarthritic articular cartilage. J. Clin. Invest. 99, 1534–1545. Blumenkrantz, N., Asboe-Hansen, G., 1973. New method for quantitative determination of uronic acids. Anal. Biochem. 54, 484–489. Borden, P., Solymar, D., Sucharczuk, A., Lindman, B., Cannon, P., Heller, R.A., 1996. Cytokine control of interstitial collagenase and collagenase-3 gene expression in human chondrocytes. J. Biol. Chem. 271, 23577–23581.

87

Caron, J.P., Fernandes, J.C., Martel-Pelletier, J., Tardif, G., Mineau, F., Geng, C., Pelletier, J.P., 1996. Chondroprotective effect of intraarticular injections of interleukin-1 receptor antagonist in experimental osteoarthritis. Suppression of collagenase-1 expression. Arthritis Rheum. 39, 1535–1544. Chavali, S.R., Zhong, W.W., Forse, R.A., 1998. Dietary alpha-linolenic acid increases TNF-alpha, and decreases IL-6, IL-10 in response to LPS: Effects of sesamin on the delta-5 desaturation of omega6 and omega3 fatty acids in mice. Prostaglandins Leukot. Essent. Fatty Acids 58, 185–191. Chen, Z., Gibson, T.B., Robinson, F., Silvestro, L., Pearson, G., Xu, B., Wright, A., Vanderbilt, C., Cobb, M.H., 2001. MAP kinases. Chem. Rev. 101, 2449–2476. Denizot, F., Lang, R., 1986. Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J. Immunol. Methods 89, 271–277. Farndale, R.W., Buttle, D.J., Barrett, A.J., 1986. Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim. Biophys. Acta 883, 173–177. Fosang, A.J., Last, K., Maciewicz, R.A., 1996. Aggrecan is degraded by matrix metalloproteinases in human arthritis. Evidence that matrix metalloproteinase and aggrecanase activities can be independent. J. Clin. Invest. 98, 2292–2299. Fosang, A.J., Neame, P.J., Last, K., Hardingham, T.E., Murphy, G., Hamilton, J.A., 1992. The interglobular domain of cartilage aggrecan is cleaved by PUMP, gelatinases, and cathepsin B. J. Biol. Chem. 267, 19470–19474. Goldring, M.B., 2006. Update on the biology of the chondrocyte and new approaches to treating cartilage diseases. Best Pract. Res. Clin. Rheumatol. 20, 1003–1025. Goldring, M.B., Birkhead, J., Sandell, L.J., Kimura, T., Krane, S.M., 1988. Interleukin 1 suppresses expression of cartilage-specific types II and IX collagens and increases types I and III collagens in human chondrocytes. J. Clin. Invest. 82, 2026–2037. Hellio Le Graverand, M.P., Eggerer, J., Sciore, P., Reno, C., Vignon, E., Otterness, I., Hart, D.A., 2000. Matrix metalloproteinase-13 expression in rabbit knee joint connective tissues: influence of maturation and response to injury. Matrix Biol. 19, 431–441. Hirose, N., Doi, F., Ueki, T., Akazawa, K., Chijiiwa, K., Sugano, M., Akimoto, K., Shimizu, S., Yamada, H., 1992. Suppressive effect of sesamin against 7,12dimethylbenz[a]-anthracene induced rat mammary carcinogenesis. Anticancer Res. 12, 1259–1265. Hou, R.C., Chen, H.L., Tzen, J.T., Jeng, K.C., 2003. Effect of sesame antioxidants on LPSinduced NO production by BV2 microglial cells. Neuroreport 14, 1815–1819. Iversen, L., Fogh, K., Kragballe, K., 1992. Effect of dihomogammalinolenic acid and its 15-lipoxygenase metabolite on eicosanoid metabolism by human mononuclear leukocytes in vitro: Selective inhibition of the 5-lipoxygenase pathway. Arch. Dermatol. Res. 284, 222–226. Jeng, K.C., Hou, R.C., Wang, J.C., Ping, L.I., 2005. Sesamin inhibits lipopolysaccharideinduced cytokine production by suppression of p38 mitogen-activated protein kinase and nuclear factor-kappaB. Immunol. Lett. 97, 101–106. Johnson, G.L., Lapadat, R., 2002. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 298, 1911–1912. Kolar, K., 1990. Colorimetric determination of hydroxyproline as measure of collagen content in meat and meat products: NMKL collaborative study. J. Assoc. Off. Anal. Chem. 73, 54–57. Koshy, P.J., Lundy, C.J., Rowan, A.D., Porter, S., Edwards, D.R., Hogan, A., Clark, I.M., Cawston, T.E., 2002. The modulation of matrix metalloproteinase and ADAM gene expression in human chondrocytes by interleukin-1 and oncostatin M: A time-course study using real-time quantitative reverse transcriptionpolymerase chain reaction. Arthritis Rheum. 46, 961–967. Liacini, A., Sylvester, J., Li, W.Q., Zafarullah, M., 2002. Inhibition of interleukin-1stimulated MAP kinases, activating protein-1 (AP-1) and nuclear factor kappa B (NF-kappa B) transcription factors down-regulates matrix metalloproteinase gene expression in articular chondrocytes. Matrix Biol. 21, 251–262. Lin, Y.S., Huang, M.H., Chai, C.Y., 2006. Effects of helium-neon laser on the mucopolysaccharide induction in experimental osteoarthritic cartilage. Osteoarthritis Cartilage 14, 377–383. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Mitchell, P.G., Magna, H.A., Reeves, L.M., Lopresti-Morrow, L.L., Yocum, S.A., Rosner, P.J., Geoghegan, K.F., Hambor, J.E., 1996. Cloning, expression, and type II collagenolytic activity of matrix metalloproteinase-13 from human osteoarthritic cartilage. J. Clin. Invest. 97, 761–768. Pahl, H.L., 1999. Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene 18, 6853–6866. Paik, J., Lee, J.Y., Hwang, D., 2002. Signaling pathways for TNFa-induced COX-2 expression: Mediation through MAP kinases and NFkB, and inhibition by certain nonsteroidal anti-inflammatory drugs. Adv. Exp. Med. Biol. 507, 503–508. Pelletier, J.P., Martel-Pelletier, J., 1989. Evidence for the involvement of interleukin 1 in human osteoarthritic cartilage degradation: Protective effect of NSAID. J. Rheumatol. Suppl. 18, 19–27. Pelletier, J.P., Martel-Pelletier, J., Howell, D.S., 1997. Etiopathogenesis of osteoarthritis. In: Koopman, W.J. (Ed.), Arthritis and Allied Conditions: A Textbook of Rheumatology, 13th ed. Williams and Wilkins, Baltimore, p. 1969. Pelletier, J.P., Fernandes, J.C., Jovanovic, D.V., Reboul, P., Martel-Pelletier, J., 2001. Chondrocyte death in experimental osteoarthritis is mediated by MEK 1/2 and p38 pathways: Role of cyclooxygenase-2 and inducible nitric oxide synthase. J. Rheumatol. 28, 2509–2519. Pendas, A.M., Balbin, M., Llano, E., Jimenez, M.G., Lopez-Otin, C., 1997. Structural analysis and promoter characterization of the human collagenase-3 gene (MMP13). Genomics 40, 222–233.

88

T. Phitak et al. / Phytochemistry 80 (2012) 77–88

Pujol, J.P., Brisset, M., Jourdan, C., Bocquet, J., Jouis, V., Beliard, R., Loyau, G., 1984. Effect of a monocyte cell factor (MCF) on collagen production in cultured articular chondrocytes: Role of prostaglandin E2. Biochem. Biophys. Res. Commun. 119, 499–508. Pujol, J.P., Loyau, G., 1987. Interleukin-1 and osteoarthritis. Life Sci. 41, 1187–1198. Ramsay, R.G., Ciznadija, D., Vanevski, M., Mantamadiotis, T., 2003. Transcriptional regulation of cyclo-oxygenase expression: Three pillars of control. Int. J. Immunopathol. Pharmacol. 16, 59–67. Reboul, P., Pelletier, J.P., Tardif, G., Cloutier, J.M., Martel-Pelletier, J., 1996. The new collagenase, collagenase-3, is expressed and synthesized by human chondrocytes but not by synoviocytes. A role in osteoarthritis. J. Clin. Invest. 97, 2011–2019. Shlopov, B.V., Lie, W.R., Mainardi, C.L., Cole, A.A., Chubinskaya, S., Hasty, K.A., 1997. Osteoarthritic lesions: involvement of three different collagenases. Arthritis Rheum. 40, 2065–2074. Struglics, A., Larsson, S., Pratta, M.A., Kumar, S., Lark, M.W., Lohmander, L.S., 2006. Human osteoarthritis synovial fluid and joint cartilage contain both aggrecanase- and matrix metalloproteinase-generated aggrecan fragments. Osteoarthritis Cartilage 14, 101–113. Takaishi, H., Kimura, T., Dalal, S., Okada, Y., D’Armiento, J., 2008. Joint diseases and matrix metalloproteinases: A role for MMP-13. Curr. Pharm. Biotechnol. 9, 47– 54.

Tortorella, M.D., Burn, T.C., Pratta, M.A., Abbaszade, I., Hollis, J.M., Liu, R., Rosenfeld, S.A., Copeland, R.A., Decicco, C.P., Wynn, R., Rockwell, A., Yang, F., Duke, J.L., Solomon, K., George, H., Bruckner, R., Nagase, H., Itoh, Y., Ellis, D.M., Ross, H., Wiswall, B.H., Murphy, K., Hillman Jr., M.C., Hollis, G.F., Newton, R.C., Magolda, R.L., Trzaskos, J.M., Arner, E.C., 1999. Purification and cloning of aggrecanase-1: A member of the ADAMTS family of proteins. Science 284, 1664–1666. Tortorella, M.D., Pratta, M.A., Fox, J.W., Arner, E.C., 1998. The interglobular domain of cartilage aggrecan is cleaved by hemorrhagic metalloproteinase HT-d (atrolysin C) at the matrix metalloproteinase and aggrecanase sites. J. Biol. Chem. 273, 5846–5850. Wang, M.J., Lin, W.W., Chen, H.L., Chang, Y.H., Ou, H.C., Kuo, J.S., Hong, J.S., Jeng, K.C., 2002. Silymarin protects dopaminergic neurons against lipopolysaccharideinduced neurotoxicity by inhibiting microglia activation. Eur. J. Neurosci. 16, 2103–2112. Wu, J.H., Hodgson, J.M., Clarke, M.W., Indrawan, A.P., Barden, A.E., Puddey, I.B., Croft, K.D., 2009a. Inhibition of 20-hydroxyeicosatetraenoic acid synthesis using specific plant lignans: In vitro and human studies. Hypertension 54, 1151–1158. Wu, J.H., Hodgson, J.M., Puddey, I.B., Belski, R., Burke, V., Croft, K.D., 2009b. Sesame supplementation does not improve cardiovascular disease risk markers in overweight men and women. Nutr. Metab. Cardiovasc. Dis. 19, 774–780. Zhang, X., Mao, Z., Yu, C., 2004. Suppression of early experimental osteoarthritis by gene transfer of interleukin-1 receptor antagonist and interleukin-10. J. Orthop. Res. 22, 742–750.