- Email: [email protected]
Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family
Biochemical and Biophysical Research Communications xxx (2017) 1e8
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family ne Bouguila c, Samia Tilouche c, Senda Majdoub d, Marwa Maalej a, b, *, Amel Tej c, Jihe b Boudour Khabou , Mouna Tabbebi b, Rahma Felhi a, Marwa Ammar a, Emna Mkaouar-Rebai a, Leila Keskes b, Lamia Boughamoura c, Faiza Fakhfakh a, ** a
Laboratory of Molecular and Functional Genetics, Faculty of Science of Sfax, University of Sfax, Tunisia Laboratory of Human Molecular Genetics, Faculty of Medicine of Sfax, University of Sfax, Tunisia c Service de p ediatrie, C.H.U. Farhat Hachad de sousse, University of Sousse, Tunisia d Service de Radiologie, CHU Farhat Hached, Sousse, University of Sousse, Tunisia b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 21 November 2017 Accepted 2 December 2017 Available online xxx
Deficiency of the mitochondrial enzyme succinyl COA ligase (SUCL) is associated with encephalomyopathic mtDNA depletion syndrome and methylmalonic aciduria. This disorder is caused by mutations in both SUCL subunits genes: SUCLG1 (a subnit) and SUCLA2 (b subnit). We report here, two Tunisian patients belonging to a consanguineous family with mitochondrial encephalomyopathy, hearing loss, lactic acidosis, hypotonia, psychomotor retardation and methylmalonic aciduria. Mutational analysis of SUCLG1 gene showed, for the first time, the presence of c.41T > C in the exon 1 at homozygous state. In-silico analysis revealed that this mutation substitutes a conserved methionine residue to a threonine at position 14 (p.M14T) located at the SUCLG1 protein mitochondrial targeting sequence. Moreover, these analysis predicted that this mutation alter stability structure and mitochondrial translocation of the protein. In Addition, a decrease in mtDNA copy number was revealed by real time PCR in the peripheral blood leukocytes in the two patients compared with controls. © 2017 Elsevier Inc. All rights reserved.
Keywords: SUCLG1 mtDNA copy number Succinyl COA ligase
1. Introduction Mitochondrial encephalomyopathies constitute a heterogeneous group of neurodegenerative disorders characterized by biochemical deficiency leading to the alteration of the functioning of the oxidative phosphorylation system. This mitochondrial disease can be caused by mutations in either nuclear or mitochondrial genes, coding for structural proteins of the respiratory chain complexes, or other genes implicated in the biogenesis, activity of the respiratory chain and in the maintenance and stability of mitochondrial genome [1]. Among them, the SUCLG1 and SUCLA2 genes
* Corresponding author. Laboratory of Molecular and Functional Genetics, Faculty of Science of Sfax, Route Soukra. Km 3, Sfax, Tunisia. ** Corresponding author. Laboratory of Molecular and Functional Genetics, Faculty of Science of Sfax, Route Soukra. Km 3, Sfax, Tunisia. E-mail addresses: [email protected] (M. Maalej), faiza.fakhfakh02@ gmail.com (F. Fakhfakh).
were previously described on chromosome 2p11.3 and 13q12.2q13.3 [2,3]. These genes have been reported to cause mitochondrial encephalomyopathy and methylmalonic aciduria associated with a deficiency of succinate-CoA ligase [4]. SUCL is a matrix mitochondrial enzyme which catalyzes the conversion of succinylCoA to succinate within the citric acid cycle. It is a heterodimer constituted of an a-subunit, SUCLG1, and one of two b-subunit isoforms SUCLA2 or SUCLG2 in, the ADP forming SUCL (A-SUCL) and the GDP-forming SUCL (GSUCL) complex respectively [5]. SUCLG1 is ubiquitously expressed but with high level in heart, brain, kidneys and liver [6] while the expression of SUCLA2 is mainly observed in the brain and skeletal muscle and SUCLG2 in liver [7]. The succinyl coA ligase deficiency is responsible of a particular phenotype characterized by a multisystemic disease and the association of three typical signs: the first is encephalomyopathy demonstrated by cerebral MRI showing bilateral basal ganglia lesions, cerebral atrophy and white matter abnormalities; the second
https://doi.org/10.1016/j.bbrc.2017.12.011 0006-291X/© 2017 Elsevier Inc. All rights reserved.
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
2
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
is a methylmalonic aciduria (MMA) [2,8] and the third is an increase of the C4-dicarboxylic carnitine (C4DC) in the blood and urine linked to the accumulation of succinyl CoA [10,11]. Patients with SUCL deficiency usually present a severe global hypotonia within the first months, lactic acidosis, psychomotor retardation, failure to thrive and feeding problems. They could also develop growth retardation and muscular atrophy. Some patients also develop dystonia and sensorineural hearing impairment, hepatopathy and cardiomyopathy [8]. To date, under than 30 patients have been described with mutations in SUCLG1 gene with clinical spectrum ranging from severe lactic acidosis and death during the first days of life [3,9] to encephalomyopathy with mild methylmalonic acidemia and mtDNA depletion [12]. Furthermore, it seems that clinical phenotype of SUCLG1 patients, in whom death is generally occurring prior to the age of three years, is more severe than that of SUCLA2 patients [8,13]. In the present study, we report two Tunisian patients belonging to a consanguineous family with clinical features of mitochondrial encephalomyopathy, severe lactic acidosis, and elevated MMA. The result of mutational analysis of the SUCLG1 gene revealed the presence of c.41T > C (p.M14T) mutation at homozygous state. Moreover, in silico analysis were performed to predict the effects of this mutation on stability structure and translocation of SUCLG1 protein. 2. Patients and methods 2.1. Patients In this study, we report two patients belonging to a Tunisian consanguineous family. They were born at term after normal pregnancies and their parents were healthy. Clinical features of patients P1 and P2 were summarized in (Table 1). 2.1.1. Patient 1 (P1) The first subject was a 3years old female who was the first child of her parents. At birth, she had 2.270 g of weight, 48 cm of length,
31 cm of head circumference and 9e10 of the apgar scores. She was hospitalized in the neonatal period (H12) for respiratory distress, a global hypotonia with hepatomegaly, bilateral ptosis bilateral and abolished ROT. Laboratory analysis revealed hypoglycemia, elevated liver enzymes activities (AST: 78; ALAT: 78) and lactic acidosis (lactate levels: 9.7 mmol/l, ammonia levels: 60 mmol/l). When she had 9 month she did not balance her head, she followed objects with her eyes but did not try to grasp them and hypotonia and hepatomegaly were also noticed. Laboratory analyses showed compensated metabolic acidosis (pH 7.41, PCO2: 27.8 mmHg; HCO3-: 18 mmol/l). Liver function tests revealed moderate hepatic cytolysis (2e3 times) compared to normal range (AST/ALAT130/108 IU/L) without signs of hepatic failure. Renal function and blood electrolytes were normal (urea/creatinine: 4.1/41; Na þ/K þ 136/3.8). Total and free plasma carnitine levels were normal while plasma acylcarnitines showed elevations in C3 and C4DC. In addition, plasma vitamine B12 level was normal. At the age of 3 years, brain MRI examination showed a bilateral hyperintensity of basal ganglia (Fig. 1).
2.1.2. Patient 2 (P2) The second patient is a male who was investigated at the age of 14 months. At birth, he had 3350 g of weight, 50 cm of length, 35 cm of head circumference and 9e10 of the apgar scores. He was hospitalized at H18 of life for neurological distress, hypoglycemia and lactic acidosis. He was intubated and ventilated for 18 days. Clinical examination showed a global hypotonia with hepatomegaly. The patient did not balance his head. He followed objects with his eyes but did not grasp them. Laboratory investigations revealed a lactic acidosis (blood pH 7.2. normal 7.4; HCO3_8 mmol/l, normal >18 mmol/l; plasma lactate concentration of up to 2.5 mmol/l, normal<2.20 mmol/l) and a high lactate/pyruvate ratio. Lactate concentration in cerebrospinal fluid was elevated but the measurement of acyl carnitine in plasma was not available. In addition, the electrocardiogram was normal and the cerebral MRI was not performed. The patient was also hospitalized at age of 14 months and laboratory investigations revealed a moderate increased level of lactate in blood (3.1 and 4.1 mmol/L) and increased levels of creatinine aminotransferases (AST 124 U/L, ALT 76 U/L), creatine
Table 1 Clinical features of studied patients. Patient
Patient1
Patient2
Age at onest Age at death
H12 39 months
H18 21months
þ þ þ þ þ e e e e þ þ þ e þ
þ þ þ þ þ e e e e þ þ þ e þ
e þ þ
NA NA NA
Clinical characteristics Hypotnia Failture to thrive Psychomotor retardation Motor retardation Muscular atrophy Epilepsy Voming Hyperkinesia/distonia Hyperhisdrosis Hearing impairment Growth retardation Feeding problems Cardiomyopathy Hepatopathy Neuroimaging Cerebellar atrophy Cerebral atrophy Basal ganglia lesions
Abbreviation: þpresent/eabsent/NA: not available.
Fig. 1. Magnetic resonance imaging of the patient P1 brain showing bilateral hyperintensity of basal ganglia.
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
kinase (469, U/L), ammonia (217/mmol/L). Serum and urine amino acids analysis showed generalized hyper aminoacidemia. After the second year of life, a bilateral hearing loss was detected and laboratory analysis showed a compensated metabolic acidosis (pH 7.45, PCO2: 25 mmHg; HCO3-: 17.7 mmol/l; BE: 6.4). Liver function tests revealed a moderate liver enzymes (AST/ALT: 130/ 85UI/L) without signs of hepatic failure (glucose: 6.2 mmol/l TP: 88%). Muscle enzymes dosage showed a restrained rise of LDH and aldolase (CPK: 35 IU/L, LDH: 563UI/L, Aldolase: 13.85UI/l). The rest of the laboratory tests were unremarkable. At this age, clinical presentation of this patient was similar to his sister. At the age of 21 months, he was hospitalized for septic shock with pulmonary starting point with a fatal outcome. 2.1.3. Controls In addition, 200 Tunisian healthy individuals from the same ethnocultural group and having neither personal nor family history of disorder were tested as controls. 2.2. Methods 2.2.1. DNA extraction from peripheral blood After getting informed consent from all the participating family's members, DNA was extracted from peripheral blood leucocytes using standard procedures [14]. But, no biological tissue of the proband was available for genetic analysis. 2.2.2. Direct sequencing of the SUCLG1 gene All coding exons, of SUCLG1 gene and their flanking intronic were amplified using specific primers previously described [6]. The reaction was carried out in a total volume of 50 mL, with 50 ng of genomic DNA, 8 pmol of each primer, 0.5 mM of each dNTP, 2 mM MgCl2, 1 PCR buffer, and 1 U Taq DNA polymerase (Promega). The PCR reaction was performed in GeneAmp PCR System 9700; (AppliedBiosystem). PCR products were then purified and sequenced with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (ABI PRISM/Biosystems). 2.2.3. Long-range PCR amplification Two fragments of a 12.182 bp and 10,162 bp were amplified by PCR reaction in a thermal cycler (GenAmp PCR System 9700; Applied Biosystem) using the following primers: 50 TGGCTCCTTTAACCTCTCCA30 and 50 GAGGCCTAACCCCTGTCTTT30 for forward primers and 50 AGCTTTGGGTGCTAATGGTG 30 for a common reverse. PCR amplification was performed using the long-range PCR enzyme mix (Mix #K0182, Fermentas). The conditions for the PCR reaction were: initial denaturation at 93 _C for 3 min, followed by 10 cycles: 30 s at 93 _C, 30 s at 58.5 _C and 12 min at 68 _C and then 25 cycles at 93 _C for 30 s, 58,5 _C for 30 s, 68 _C for 12 min and 10 s, and a final extension at 68 _C for 11 min. Products were separated on 0.8% agarose gel and visualized with ethidium bromide. 2.2.4. MtDNA quantification in blood leucocytes The relative mtDNA copy number in blood leucocytes were measured by real time polymerase chain reaction (StepOne™ RealTime PCR System) using complementary primers to ND4 gene and corrected by simultaneous measurement of the nuclear DNA using complementary primers to GAPDH gene. PCR was performed in a final volume of 20 ml containing 2 ml of DNA (10 ng) which was mixed with 10 ml SYBR green MASTER mix (TAKARA), 0.4 ml of each primer (10mM), 0.4 ml ROXI and 6.8 ml H2O. The PCR conditions were divided into 3 steps. The first one was the hold step, 10 min at 95 C, followed by 40 cycles of denaturation at 95 C for 5 s, annealing at 52 C for 34 s and a final step of dissociation at 95 c at 15s followed
3
by 1 min at 60 C. According VENEGAS et al., the mtDNA content was measured using the formula: 2 2Dct where T is the difference of CT values between GAPDH gene and the ND4 gene [15]. The relative mtDNA of a patient was calculated by dividing mtDNA content of the patient by mtDNA content of the pooled control (%). The control sample is an age-matched pooled control (1e4 years) made up of ten patients with normal mtDNA content. 2.2.5. Computational analysis The sequence alignment of the SUCLG1 protein was performed using the ClustalW program (http://bioinfo.hku.hk/services/ analyseq/cgi-bin/clustalw_in.pl). The pathogenicity was investigated using Polyphen2 software available at: (http://genetics.bwh. harvard.edu/pph2/). The assessment of the possible impact of the mutation on the protein transport by predicting the mitochondrial presequence, and its cleaved position, was performed with MitoFates software available at: (http://mitf.cbrc.jp/MitoFates/cgi-bin/ top.cgi). ProtParam (http://web.expasy.org/protparam/) was used to allow the computation of various physical and chemical parameters of the studied protein. The computed parameters include the molecular weight, theoretical pI, amino acid composition, extinction coefficient, aliphatic index and grand average of hydropathicity (GRAVY). ProtScale (http://web.expasy.org/protscale/) was used for computing and representing the profile produced by amino acid scale on the protein. The prediction of the secondary structure of the studied protein was performed by using EXPASYCFSSP (http://cho-fas.sourceforge.net/) and STRIDE (http:// webclu.bio.wzw.tum.de/stride/). Generation of three dimensional protein structures was performed using the RaptorX software (http://raptorx.uchicago.edu/). In addition the Swiss PDB VIEWER software was used to display and compare models. 3. Results 3.1. Mutational analysis In the present study, we reported two patients from the same consanguineous family with clinical features of mitochondrial encephalomyopathy and lactic acidosis. Furthermore, additional biochemical and histological investigations revealed increased levels of blood lactate and C3-carnitine and C4-dicarboxylic acylcarnitine, which reflect an elevated excretion of methylmalonic acid and the liver biopsy examination showed a centrilobular macrovascular steatosis. These data suggested mitochondrial abnormalities with Succinyl-CoA deficiency. As candidate gene responsible of Succinyl-CoA deficiency, the SUCLG1 gene, encoding the subunit of Succinyl-CoA ligase was analyzed. The results of mutational screening of the 9 exons of SUCLG1 gene and their flanking regions showed the presence of a novel mutation c.41T > C in the exon 1 at homozygous state in the two patients and at heterozygous state in the parents. This mutation substitutes a conserved methionine residue to a threonine at position 14 (p.M14T) (Fig. 2). As the c.41T > C mutation abolishes a FatI restriction site, PCR/RFLP was performed to search the mutation in controls and results revealed its absence in 100 chromosomes in healthy controls from the same region. 3.2. Mitochondrial DNA analysis For mtDNA deletions analysis, we performed a Long Range PCR of two fragments of the major arc of mitochondrial DNA extracted from blood leukocytes of P1, P2 and a healthy individual. The results revealed the absence of a mitochondrial deletion since we observed the same bands in the tested patients compared to the wild-type. Besides, the quantification of mtDNA in the peripheral blood
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
4
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
Fig. 2. A. Pedigree of the studied family and sequence chromatograms showing the mutation c.41T > C in SUCLG1 gene in homozygous state in patients and in heterozygous state in parents. Generations are indicated on the left in Roman numerals and the number under the individuals represent identification numbers for each generation. B. Global alignment of the amino acid sequences of SUCLG1 protein in 6 different eukaryotic organisms. Amino acid change of interest is framed and indicated with arrow.
leukocytes of the two patients by real time PCR showed a decrease of mtDNA content of 89.49% and 47.62% compared to normal controls respectively in P1 and P2. 3.3. Computational analysis 3.3.1. Effect on the protein transport MITOFATES software revealed that c.41T > C (p.M14T) mutation effect an ATG which located at the mitochondrial targeting sequence MTS corresponding to the first 41 amino acids of the SUCLG1 protein. It indicated also that substitution of methionine by threonine at position 14 could lead to the loss of mitochondrial pre sequence where the score was decreased from 0.450 to 0.356 (Fig. 3A) (gray coloration of T14). This result marked a potential effect of the mutation p.M14T on the SUCLG1 protein transport from the cytosol to the mitochondrial matrix. 3.3.2. Effect on structure and stability PolyPhen analysis predicted that the c.41T > C variant is probably damaging with scores of 0.71 and 0.59 on HumDiv and HumVar models, respectively. The characterization of the mutated protein by the ProtoProgram showed that this substitution decreased the grand average of hydropathicity (GRAVY) (0.023 > 0.030) but not the instability index (II). In addition The
KyteeDoolittle algorithm used in ExpacyProscale demonstrated that the c.41T > C replaced the methionine (non-polar, sulfur hydrophobic; with hydropthy index 1.9) by the threonine (polar, uncharged; with hydropthy index 0.7) at position 14 in the mitochondrial leader sequence of the SUCLG1 protein. This substitution decreased the level of hydrophobicity from 0.68 to 0.40 at this position and also in neighboring residues (D10-S18) which could possibly alter the protein flexibility structure (Fig. 3B). 3.3.3. Effect on 2D structure In order to predict the effect of the mutation on the 2D structure, we used the EXPASYCFSSP which demonstrated in the presence of the mutation (p.M14T) a decrease of the percent of helixes from 70 to 67.5 caused by a loss of an helix in the polypeptide signal. Moreover, secondary structure calculated by STRIDE showed that p.M14T had markedly altered backbone angles of the protein suggesting that this substitution could destabilizing the helical conformation of the protein. 3.3.4. Effect on 3D structure To investigate the eventual effect of the non synonymous variation changing methionine residue by a Threonin at position 14 (p.14M > T) of SUCLG1 protein, we modeled and compared the two variants, 14M and 14T. 3D Model revealed that the M14 is involved
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
5
Fig. 3. A. Mitofates prediction in human's wild type (M14) and mutated (T14) SUCLG1 mitochondrial targeting sequence B. Hydrophobicity scale in SUCLG1 MTS (first41 amino acid) is compared in the wild-type (control) and in the mutated p.M14T and p.M14L proteins. Red frames show changes in hydrophobicity scales. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
in a hydrogen bond with the residue T 13, while the T14 variation leads to a new hydrogen bond with the residue 12A and remove all hydrogen bonds in the MTS (first41 residues). The comparison of wild type and mutated 3D model of SUCLG1 MTS demonstrated the removing of seven hydrogen bunds between M1-M2, T4-A6, A9-I11, D10-I11, R29-S30 and R29-F31 and the creation of novel bunds A12T14, V15-S16, D36-G35, D36-P34, and I11-T13 (Fig. 4AeB). Moreover, the rms (root mean square) differences calculated by applying structural superposition of both wide type and mutant 3D model of SUCLG1 MTS valued at 6.53A. 4. Discussion I this work we examined two patients from the same consanguineous family presenting the similar phenotypes of
mitochondrial neonatal encepahlomyopathy and lactic acidosis. The results of mutational screening of the 9 exons of SUCLG1 gene and their flanking regions showed the presence of the mutation c.41T > C in the exon 1 at homozygous state in the two patients. This mutation substitutes a conserved methionine residue to a threonine at position 14 (p.M14T) located within the mitochondrial targeting sequence (MTS) which is composed by the first 41 amino acids of the SUCLG1 protein. In the studied patients, this mutation c.41T > C p.M14T was founded for the first time at homozygous state when it has been previously described in compound heterozygous state with p.S200F mutation in a female patient presenting a neonatal-onset lactic acidosis with urinary excretion of methylmalonic acid and a complex I deficiency [16]. At the same position, the p.M14L mutation was described at homozygous [4] and also at compound
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
6
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
Fig. 4. Generation of the 3-dimensional model showing added hydrogen bonds between the wild type (A) and the mutant model including the p.M14T mutation (B). Model generation of 14M, 14T and 14Lvariants (C).
heterozygous state with p.Q212R [13]. Cases with succinyl-CoA synthase deficiency are not frequent and under than 30 disease-causing mutations were found in the SUCLG1 gene including missense, splice site, and nonsense mutations and also deletions which affect activity, stability and oligomerization of the protein [6,9,17]. In order to investigate the effect of the homozygous p.M14T mutation on SUCLG1 structure, function and translocation to mitochondrial matrix, we used several bioinformatics tools. In fact, ExpacyProscale and Proto Program demonstrated that the c.41T > C p.M14T mutation caused a decrease of hydropathicity at the position of mutated amino acid and also in neighboring residues (D10-S18) which could possibly
alter the protein flexibility structure and the grand average of hydrophobicity (GRAVY) (0.023 > 0.030). In addition, Mitofates software showed that the substitution of residue Methionine to threonine at position 14 decreased the probability of the protein mitochondrial targeting from 0.42 to 0.356. Indeed, protein import into the mitochondrion is a complex process involving specific interactions with several receptors and channels. In a first step, the process is initiated when Tom20, a heterodimer receptor binds to the typical mitochondrial preproteins that carry the cleavable N-terminal mitochondrial targeting sequence (MTS) [18]. This signal is a motif predicted to form an amphipathic helix including ~70 residues, most of which are positively charged basic residues [19]. In a second step, Tom20 transfers the presequence to the Tom22 receptor, once within the inter membrane space, proteins destinated for the matrix must pass through the TIM complex [20]. Only few mutations were described in mitochondrial targeting sequence leading to localization defect of mitochondrial proteins synthesized in cytosol. In fact, the R10P mutation in the PDHA1 gene causing a deficiency in the alpha subunit of the mitochondrial pyruvate dehydrogenase E1 was described [21]. Furthermore, the R3P mutation in POLG1 gene located in the protein presequence was found in a family with progressive external ophthalmoplegia [22]. Both of these mutations are located in the TOM22 hexamer match region and the region containing the maximum of positively charged amphiphilicity score (PA score). Equally, the p.M14T mutation is predicted to disturbs the positively charged amphiphilicity score (PA score) in region including 7e16 residues (Fig. 3/A), cause a conformational change, and affect the hydrophobic face of the pre sequence required for a specific interaction. Furthermore, the secondary structure calculated by STRIDE showed that p.M14T had markedly altered backbone angles of the protein suggesting that this substitution could destabilize the helical conformation of the protein. In addition, generation of 3D model of the mutated presequence and its comparison with wild type one revealed that p.M14T lead to removing all hydrogen bonds along the pre sequence and to the creation of novel bonds. Moreover, the rms (root mean square) differences calculated by applying structural superposition of both wide type and mutated 3D model of SUCLG1 MTS valued at 6.53A. Consequently, all these structural changes caused by M14T mutation could affect the stability and translocation of the SUCLG1 protein. To compare structural changes caused by p.M14T mutation with that caused by c.40A > T p.M14L mutation previously described and affecting the same methionine 14 in the SUCLG1 MTS, we performed several in-silico analysis. Results showed that p.M14L had no effect on the mitochondrial translocation with a normal score 0.45 while p.M14T described here affects the mitochondrial presequence with a lower score valued at 0.35. The results of ExpacyProscale and ProtoProgram demonstrated also that the change of Methionine by leucine at position 14 increased the score of hydrophobicity to 0.9 while the threonine decreased it from 0.68 to 0.40 (Table 3). In addition Comparing of the 3D mutated M14L and M14T SUCLG1 model with the wild type showed that the global conformation was slightly changed in presence of M14L with an RMS score 1.49A while this conformation is more changed (RMS 6.5A) with a closed N-terminal tail in the M14T model compared to wild type and M14L model (Fig. 4C). In fact, these data suggest that p.M14T is more pathogenic than p.M14L which confirmed also by previous study that described a total absence of the SUCLG1 protein caused by M14T mutation in compound heterozygous state with S200F [16] while the M14L at homozygous state lead to a reduced SUCLG1 protein level [4]. Besides, reducing of mtDNA copy number in blood leucocytes is rarely detected in patients with SUCLG1 deficiency and it was
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
7
Table 2 Identified mutations affecting the methionine 14 in SUCLG1 gene. Mutation/Aminoacid change
Allele phase
Age of onset
Statut
mtDNA Content (% of controls)
ETC activity
Western blot (SUCLG1, SUCLG2, SUCLA2)
fe rences Re
c.40A > T p.Met14Leu c.40A > T (p.Met14Leu) c.635A > G (p.Gln212Arg)
Homo
Day of life1
Died at17mo
50% (liver)
NA
Severly reduced
[2]
CH
14mo
Alive at10y
72% (muscle) 50% (fibroblastes)
NA
[13]
CH
J2
Died at 20mo
Normal (fibroblasts) Doubled (muscle)
Reduced (mu,fib)
Absent (SUCLG1þSUCLG2) Reduced (SUCLA2) (fibroblasts) NA
[15]
Homo
Day of life1
Died at 24mo Died at 39mo
89% 47% (leucocytes)
NA
NA
Current study
c.41T > C p.Met14T c.599C > T p.Ser200Phe c.41T > C p.Met14T (2cases)
Abbreviations: NA: not available; homo:homozygous; CH:compound heterozygous; mo:month; y:year; ETC:electron transport chain.
This work was supported by The Ministry of the Higher Education and the Scientific Research in Tunisia.
Table 3 In silico comparison of M14L and M14T.
p.14M (wild type) p.M14T p.M14L
MITOFATES
Expasy protscale
Model 3D (RMS)
0.45
0.64
e
0.35 0.45
0.7 0.9
6.5A 1.19A
observed in our patients with 89.49% and 47.62% in P1 and P2, respectively. The mtDNA content was found of 50% in fibroblasts and 72% in muscle compared with controls in patients with p.M14L mutation at compound heterozygous state with Q212R at [13]. Whereas, patient with p.M14T in compound heterozygous state with S200F presented a high level of mtDNA copy number in muscle but not in fibroblasts [16] (Table 2). However, other tissues such as liver and muscle that usually present reduction of mt DNA copy number, were not explored in our study owing the lack of investigation of this disease in our population and the sudden death of patients. Several studies have indicated that SUCL forms a complex with nucleoside diphosphate kinase (NDPK), which is important for the salvage of deoxyribonucleotides for mtDNA synthesis [23,24]. Mutations in SUCLA2 and SUCLG1 seem to disrupt the association between succinyl CoA synthase and mitochondrial nucleoside diphosphate kinase function, resulting in mitochondrial dNTP pool imbalance and eventually, decreased mtDNA synthesis leading to mtDNA depletion [12,25]. To our knowledge the present study reported the first cases with the c.41T > C (p.M14T) mutation at the homozygous state in SUCLG1 gene associated to the mitochondrial encephalomyopathy and lactic acidosis in Tunisia and Africa. The p.M14T mutation is located within the mitochondrial targeting sequence (MTS) and seems to affect stability, structure and translocation of protein. A decrease in MtDNA copy number was also revealed by real time PCR in the peripheral blood leukocytes of the two patients compared with controls. Conflict of interest The authors declare that they have no competing interests. Acknowledgments We thank the parents for their cooperation in the present study.
References [1] X. Zhu, X. Peng, M.X. Guan, et al., Pathogenic mutations of nuclear genes associated with mitochondrial disorders, Acta Biochim. Biophys. Sin. 41 (2009) 179e187. [2] V. Valayannopoulos, C. Haudry, V. Serre, et al., New SUCLG1 patients expanding the phenotypic spectrum of this rare cause of mild methylmalonic aciduria, Mitochondrion 10 (2010) 335e341. [3] C. Miller, L. Wang, et al., The interplay between SUCLA2, SUCLG2, and mitochondrial DNA depletion, Biochim. Biophys. Acta 1812 (2011) 625e629. [4] J.L. Van Hove, M.S. Saenz, J.A. Thomas, et al., Succinyl-CoA ligase deficiency: a mitochondrial hepatoencephalomyopathy, Pediatr. Res. 68 (2010) 159e164. [5] J.D. Johnson, J.G. Mehus, K. Tews, et al., Genetic evidence for the expression of ATP- and GTP-specific succinyl-CoA synthetases in multicellular eucaryotes, J. Biol. Chem. 273 (1998) 27580e27586. [6] E. Ostergaard, E. Christensen, E. Kristensen, et al., Deficiency of the alpha subunit of succinate-coenzyme A ligase causes fatal infantile lactic acidosis with mitochondrial DNA depletion, Am. J. Hum. Genet. 81 (2007) 383e387. [7] D. Lambeth, K. Tews, S. Adkins, et al., Expression of two succinyl-CoA synthetases with different nucleotide specificities in mammalian tissues, J. Biol. Chem. 279 (2004) 36621e36624. [8] R. Carrozzo, D. Verrigni, M. Rasmussen, et al., Succinate-CoA ligase deficiency due to mutations in SUCLA2 and SUCLG1: phenotype and genotype correlations in 71 patients, J. Inherit. Metab. Dis. 39 (2016) 243e252. [9] H. Rivera, B. Merinero, M. Martinez-Pardo, et al., Marked mitochondrial DNA depletion associated with a novel SUCLG1 gene mutation resulting in lethal neonatal acidosis, multi-organ failure, and interrupted aortic arch, Mitochondrion 10 (2010) 362e368. dard-me reuze, K. Fragaki, et al., The severity of phenotype [10] C. Rouzier, S.L. Gue linked to SUCLG1 mutations could be correlated with residual amount of SUCLG1 protein, J. Med. Genet. 47 (2010) 670e676. [11] Z. Liu, F. Fang, C. Ding, et al., SUCLA2-related encephalomyopathic mitochondrial DNA depletion syndrome: a case report and review of literature, Zhonghua Er Ke Za Zhi 52 (11) (2014) 817e821. [12] A.W. El-Hattab, F. Scaglia, Mitochondrial DNA depletion syndromes: review and updates of genetic basis, manifestations, and therapeutic options, Neurotherapeutics 10 (2013) 186e198. [13] T.R. Donti, R. Masand, D.A. Scott, et al., Expanding the phenotypic spectrum of Succinyl-CoA ligase deficiency through functional validation of a new SUCLG1 variant, Mol. Genet. Metabol. 119 (2016) 68e74. [14] H.A. Lewin, J.A. Stewart-Haynes, A simple method for DNA extraction from leukocytes for use in PCR, Biotechniques 13 (1992) 522e524. [15] V. Venegas, V. Wang, J. Dimmock, et al., Real time quantitative PCR analysis of mitochondrial DNA content, Curr. Protoc. Hum. Genet. (2011) 19.7.1e19.7. 12. [16] O. Sakamoto, T. Ohura, K. Murayama, et al., Neonatal lactic acidosis with methylmalonic aciduria due to novel mutations in the SUCLG1 gene, Pediatr. Int. 53 (2011) 921e925. [17] M.L. Landsverk, V.W. Zhang, L.J.C. Wong, et al., A SUCLG1 mutation in a patient with mitochondrial DNA depletion and congenital anomalies, Mol. Genet. Metab. Rep. 14 (2014) 451e454. [18] A. Chacinska, C.M. Koehler, D. Milenkovic, et al., Importing mitochondrial proteins: machineries and mechanisms, Cell 138 (2009) 628e644. €gtle, S. Wortelkamp, R.P. Zahedi, et al., Global analysis of the mito[19] F.N. Vo chondrial N-proteome identifies a processing peptidase critical for protein stability, Cell 139 (2009) 428e439.
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
8
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
[20] M. Marom, A. Azem, D. Mokranjac, Understanding the molecular mechanism of protein translocation across the mitochondrial inner membrane: still a long way to go, Biochim. Biophys. Acta 1808 (2011) 909e1001. [21] F. Takakubo, P. Cartwright, N. Hoogenraad, et al., An amino acid substitution in the pyruvate dehydrogenase E1 alpha gene, affecting mitochondrial import of the precursor protein, Am. J. Hum. Genet. 57 (1995) 772e780. [22] J.D. Stewart, S. Tennant, H. Powell, et al., Differential features of patients with mutations in two COX assembly genes, SURF-1 and SCO2, Ann. Neurol. 47 (2000) 589e995.
[23] E.F. Kadrmas, P.D. Ray, D.O. Lambeth, Apparent ATP-linked succinate thiokinase activity and its relation to nucleoside kinase in mitochondrial matrix preparations from Rabbit, Biochim. Biophys. Acta 1047 (1991) 339e346. [24] A. Kowluru, M. Tannous, H.Q. Chen, Localization and characterization of the mitochondrial isoform of the nucleoside diphosphate kinase in the pancreatic beta cell: evidence for its complexation with mitochondrial succinyl-CoA synthetase, Arch. Biochem. Biophys. 398 (2002) 160e169. [25] A. Suomalainen, P. Isohanni, Mitochondrial DNA depletion syndromes-many genes, common mechanisms, Neuromuscul. Disord. 20 (2010) 429e437.
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family ne Bouguila c, Samia Tilouche c, Senda Majdoub d, Marwa Maalej a, b, *, Amel Tej c, Jihe b Boudour Khabou , Mouna Tabbebi b, Rahma Felhi a, Marwa Ammar a, Emna Mkaouar-Rebai a, Leila Keskes b, Lamia Boughamoura c, Faiza Fakhfakh a, ** a
Laboratory of Molecular and Functional Genetics, Faculty of Science of Sfax, University of Sfax, Tunisia Laboratory of Human Molecular Genetics, Faculty of Medicine of Sfax, University of Sfax, Tunisia c Service de p ediatrie, C.H.U. Farhat Hachad de sousse, University of Sousse, Tunisia d Service de Radiologie, CHU Farhat Hached, Sousse, University of Sousse, Tunisia b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 21 November 2017 Accepted 2 December 2017 Available online xxx
Deficiency of the mitochondrial enzyme succinyl COA ligase (SUCL) is associated with encephalomyopathic mtDNA depletion syndrome and methylmalonic aciduria. This disorder is caused by mutations in both SUCL subunits genes: SUCLG1 (a subnit) and SUCLA2 (b subnit). We report here, two Tunisian patients belonging to a consanguineous family with mitochondrial encephalomyopathy, hearing loss, lactic acidosis, hypotonia, psychomotor retardation and methylmalonic aciduria. Mutational analysis of SUCLG1 gene showed, for the first time, the presence of c.41T > C in the exon 1 at homozygous state. In-silico analysis revealed that this mutation substitutes a conserved methionine residue to a threonine at position 14 (p.M14T) located at the SUCLG1 protein mitochondrial targeting sequence. Moreover, these analysis predicted that this mutation alter stability structure and mitochondrial translocation of the protein. In Addition, a decrease in mtDNA copy number was revealed by real time PCR in the peripheral blood leukocytes in the two patients compared with controls. © 2017 Elsevier Inc. All rights reserved.
Keywords: SUCLG1 mtDNA copy number Succinyl COA ligase
1. Introduction Mitochondrial encephalomyopathies constitute a heterogeneous group of neurodegenerative disorders characterized by biochemical deficiency leading to the alteration of the functioning of the oxidative phosphorylation system. This mitochondrial disease can be caused by mutations in either nuclear or mitochondrial genes, coding for structural proteins of the respiratory chain complexes, or other genes implicated in the biogenesis, activity of the respiratory chain and in the maintenance and stability of mitochondrial genome [1]. Among them, the SUCLG1 and SUCLA2 genes
* Corresponding author. Laboratory of Molecular and Functional Genetics, Faculty of Science of Sfax, Route Soukra. Km 3, Sfax, Tunisia. ** Corresponding author. Laboratory of Molecular and Functional Genetics, Faculty of Science of Sfax, Route Soukra. Km 3, Sfax, Tunisia. E-mail addresses: [email protected] (M. Maalej), faiza.fakhfakh02@ gmail.com (F. Fakhfakh).
were previously described on chromosome 2p11.3 and 13q12.2q13.3 [2,3]. These genes have been reported to cause mitochondrial encephalomyopathy and methylmalonic aciduria associated with a deficiency of succinate-CoA ligase [4]. SUCL is a matrix mitochondrial enzyme which catalyzes the conversion of succinylCoA to succinate within the citric acid cycle. It is a heterodimer constituted of an a-subunit, SUCLG1, and one of two b-subunit isoforms SUCLA2 or SUCLG2 in, the ADP forming SUCL (A-SUCL) and the GDP-forming SUCL (GSUCL) complex respectively [5]. SUCLG1 is ubiquitously expressed but with high level in heart, brain, kidneys and liver [6] while the expression of SUCLA2 is mainly observed in the brain and skeletal muscle and SUCLG2 in liver [7]. The succinyl coA ligase deficiency is responsible of a particular phenotype characterized by a multisystemic disease and the association of three typical signs: the first is encephalomyopathy demonstrated by cerebral MRI showing bilateral basal ganglia lesions, cerebral atrophy and white matter abnormalities; the second
https://doi.org/10.1016/j.bbrc.2017.12.011 0006-291X/© 2017 Elsevier Inc. All rights reserved.
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
2
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
is a methylmalonic aciduria (MMA) [2,8] and the third is an increase of the C4-dicarboxylic carnitine (C4DC) in the blood and urine linked to the accumulation of succinyl CoA [10,11]. Patients with SUCL deficiency usually present a severe global hypotonia within the first months, lactic acidosis, psychomotor retardation, failure to thrive and feeding problems. They could also develop growth retardation and muscular atrophy. Some patients also develop dystonia and sensorineural hearing impairment, hepatopathy and cardiomyopathy [8]. To date, under than 30 patients have been described with mutations in SUCLG1 gene with clinical spectrum ranging from severe lactic acidosis and death during the first days of life [3,9] to encephalomyopathy with mild methylmalonic acidemia and mtDNA depletion [12]. Furthermore, it seems that clinical phenotype of SUCLG1 patients, in whom death is generally occurring prior to the age of three years, is more severe than that of SUCLA2 patients [8,13]. In the present study, we report two Tunisian patients belonging to a consanguineous family with clinical features of mitochondrial encephalomyopathy, severe lactic acidosis, and elevated MMA. The result of mutational analysis of the SUCLG1 gene revealed the presence of c.41T > C (p.M14T) mutation at homozygous state. Moreover, in silico analysis were performed to predict the effects of this mutation on stability structure and translocation of SUCLG1 protein. 2. Patients and methods 2.1. Patients In this study, we report two patients belonging to a Tunisian consanguineous family. They were born at term after normal pregnancies and their parents were healthy. Clinical features of patients P1 and P2 were summarized in (Table 1). 2.1.1. Patient 1 (P1) The first subject was a 3years old female who was the first child of her parents. At birth, she had 2.270 g of weight, 48 cm of length,
31 cm of head circumference and 9e10 of the apgar scores. She was hospitalized in the neonatal period (H12) for respiratory distress, a global hypotonia with hepatomegaly, bilateral ptosis bilateral and abolished ROT. Laboratory analysis revealed hypoglycemia, elevated liver enzymes activities (AST: 78; ALAT: 78) and lactic acidosis (lactate levels: 9.7 mmol/l, ammonia levels: 60 mmol/l). When she had 9 month she did not balance her head, she followed objects with her eyes but did not try to grasp them and hypotonia and hepatomegaly were also noticed. Laboratory analyses showed compensated metabolic acidosis (pH 7.41, PCO2: 27.8 mmHg; HCO3-: 18 mmol/l). Liver function tests revealed moderate hepatic cytolysis (2e3 times) compared to normal range (AST/ALAT130/108 IU/L) without signs of hepatic failure. Renal function and blood electrolytes were normal (urea/creatinine: 4.1/41; Na þ/K þ 136/3.8). Total and free plasma carnitine levels were normal while plasma acylcarnitines showed elevations in C3 and C4DC. In addition, plasma vitamine B12 level was normal. At the age of 3 years, brain MRI examination showed a bilateral hyperintensity of basal ganglia (Fig. 1).
2.1.2. Patient 2 (P2) The second patient is a male who was investigated at the age of 14 months. At birth, he had 3350 g of weight, 50 cm of length, 35 cm of head circumference and 9e10 of the apgar scores. He was hospitalized at H18 of life for neurological distress, hypoglycemia and lactic acidosis. He was intubated and ventilated for 18 days. Clinical examination showed a global hypotonia with hepatomegaly. The patient did not balance his head. He followed objects with his eyes but did not grasp them. Laboratory investigations revealed a lactic acidosis (blood pH 7.2. normal 7.4; HCO3_8 mmol/l, normal >18 mmol/l; plasma lactate concentration of up to 2.5 mmol/l, normal<2.20 mmol/l) and a high lactate/pyruvate ratio. Lactate concentration in cerebrospinal fluid was elevated but the measurement of acyl carnitine in plasma was not available. In addition, the electrocardiogram was normal and the cerebral MRI was not performed. The patient was also hospitalized at age of 14 months and laboratory investigations revealed a moderate increased level of lactate in blood (3.1 and 4.1 mmol/L) and increased levels of creatinine aminotransferases (AST 124 U/L, ALT 76 U/L), creatine
Table 1 Clinical features of studied patients. Patient
Patient1
Patient2
Age at onest Age at death
H12 39 months
H18 21months
þ þ þ þ þ e e e e þ þ þ e þ
þ þ þ þ þ e e e e þ þ þ e þ
e þ þ
NA NA NA
Clinical characteristics Hypotnia Failture to thrive Psychomotor retardation Motor retardation Muscular atrophy Epilepsy Voming Hyperkinesia/distonia Hyperhisdrosis Hearing impairment Growth retardation Feeding problems Cardiomyopathy Hepatopathy Neuroimaging Cerebellar atrophy Cerebral atrophy Basal ganglia lesions
Abbreviation: þpresent/eabsent/NA: not available.
Fig. 1. Magnetic resonance imaging of the patient P1 brain showing bilateral hyperintensity of basal ganglia.
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
kinase (469, U/L), ammonia (217/mmol/L). Serum and urine amino acids analysis showed generalized hyper aminoacidemia. After the second year of life, a bilateral hearing loss was detected and laboratory analysis showed a compensated metabolic acidosis (pH 7.45, PCO2: 25 mmHg; HCO3-: 17.7 mmol/l; BE: 6.4). Liver function tests revealed a moderate liver enzymes (AST/ALT: 130/ 85UI/L) without signs of hepatic failure (glucose: 6.2 mmol/l TP: 88%). Muscle enzymes dosage showed a restrained rise of LDH and aldolase (CPK: 35 IU/L, LDH: 563UI/L, Aldolase: 13.85UI/l). The rest of the laboratory tests were unremarkable. At this age, clinical presentation of this patient was similar to his sister. At the age of 21 months, he was hospitalized for septic shock with pulmonary starting point with a fatal outcome. 2.1.3. Controls In addition, 200 Tunisian healthy individuals from the same ethnocultural group and having neither personal nor family history of disorder were tested as controls. 2.2. Methods 2.2.1. DNA extraction from peripheral blood After getting informed consent from all the participating family's members, DNA was extracted from peripheral blood leucocytes using standard procedures [14]. But, no biological tissue of the proband was available for genetic analysis. 2.2.2. Direct sequencing of the SUCLG1 gene All coding exons, of SUCLG1 gene and their flanking intronic were amplified using specific primers previously described [6]. The reaction was carried out in a total volume of 50 mL, with 50 ng of genomic DNA, 8 pmol of each primer, 0.5 mM of each dNTP, 2 mM MgCl2, 1 PCR buffer, and 1 U Taq DNA polymerase (Promega). The PCR reaction was performed in GeneAmp PCR System 9700; (AppliedBiosystem). PCR products were then purified and sequenced with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (ABI PRISM/Biosystems). 2.2.3. Long-range PCR amplification Two fragments of a 12.182 bp and 10,162 bp were amplified by PCR reaction in a thermal cycler (GenAmp PCR System 9700; Applied Biosystem) using the following primers: 50 TGGCTCCTTTAACCTCTCCA30 and 50 GAGGCCTAACCCCTGTCTTT30 for forward primers and 50 AGCTTTGGGTGCTAATGGTG 30 for a common reverse. PCR amplification was performed using the long-range PCR enzyme mix (Mix #K0182, Fermentas). The conditions for the PCR reaction were: initial denaturation at 93 _C for 3 min, followed by 10 cycles: 30 s at 93 _C, 30 s at 58.5 _C and 12 min at 68 _C and then 25 cycles at 93 _C for 30 s, 58,5 _C for 30 s, 68 _C for 12 min and 10 s, and a final extension at 68 _C for 11 min. Products were separated on 0.8% agarose gel and visualized with ethidium bromide. 2.2.4. MtDNA quantification in blood leucocytes The relative mtDNA copy number in blood leucocytes were measured by real time polymerase chain reaction (StepOne™ RealTime PCR System) using complementary primers to ND4 gene and corrected by simultaneous measurement of the nuclear DNA using complementary primers to GAPDH gene. PCR was performed in a final volume of 20 ml containing 2 ml of DNA (10 ng) which was mixed with 10 ml SYBR green MASTER mix (TAKARA), 0.4 ml of each primer (10mM), 0.4 ml ROXI and 6.8 ml H2O. The PCR conditions were divided into 3 steps. The first one was the hold step, 10 min at 95 C, followed by 40 cycles of denaturation at 95 C for 5 s, annealing at 52 C for 34 s and a final step of dissociation at 95 c at 15s followed
3
by 1 min at 60 C. According VENEGAS et al., the mtDNA content was measured using the formula: 2 2Dct where T is the difference of CT values between GAPDH gene and the ND4 gene [15]. The relative mtDNA of a patient was calculated by dividing mtDNA content of the patient by mtDNA content of the pooled control (%). The control sample is an age-matched pooled control (1e4 years) made up of ten patients with normal mtDNA content. 2.2.5. Computational analysis The sequence alignment of the SUCLG1 protein was performed using the ClustalW program (http://bioinfo.hku.hk/services/ analyseq/cgi-bin/clustalw_in.pl). The pathogenicity was investigated using Polyphen2 software available at: (http://genetics.bwh. harvard.edu/pph2/). The assessment of the possible impact of the mutation on the protein transport by predicting the mitochondrial presequence, and its cleaved position, was performed with MitoFates software available at: (http://mitf.cbrc.jp/MitoFates/cgi-bin/ top.cgi). ProtParam (http://web.expasy.org/protparam/) was used to allow the computation of various physical and chemical parameters of the studied protein. The computed parameters include the molecular weight, theoretical pI, amino acid composition, extinction coefficient, aliphatic index and grand average of hydropathicity (GRAVY). ProtScale (http://web.expasy.org/protscale/) was used for computing and representing the profile produced by amino acid scale on the protein. The prediction of the secondary structure of the studied protein was performed by using EXPASYCFSSP (http://cho-fas.sourceforge.net/) and STRIDE (http:// webclu.bio.wzw.tum.de/stride/). Generation of three dimensional protein structures was performed using the RaptorX software (http://raptorx.uchicago.edu/). In addition the Swiss PDB VIEWER software was used to display and compare models. 3. Results 3.1. Mutational analysis In the present study, we reported two patients from the same consanguineous family with clinical features of mitochondrial encephalomyopathy and lactic acidosis. Furthermore, additional biochemical and histological investigations revealed increased levels of blood lactate and C3-carnitine and C4-dicarboxylic acylcarnitine, which reflect an elevated excretion of methylmalonic acid and the liver biopsy examination showed a centrilobular macrovascular steatosis. These data suggested mitochondrial abnormalities with Succinyl-CoA deficiency. As candidate gene responsible of Succinyl-CoA deficiency, the SUCLG1 gene, encoding the subunit of Succinyl-CoA ligase was analyzed. The results of mutational screening of the 9 exons of SUCLG1 gene and their flanking regions showed the presence of a novel mutation c.41T > C in the exon 1 at homozygous state in the two patients and at heterozygous state in the parents. This mutation substitutes a conserved methionine residue to a threonine at position 14 (p.M14T) (Fig. 2). As the c.41T > C mutation abolishes a FatI restriction site, PCR/RFLP was performed to search the mutation in controls and results revealed its absence in 100 chromosomes in healthy controls from the same region. 3.2. Mitochondrial DNA analysis For mtDNA deletions analysis, we performed a Long Range PCR of two fragments of the major arc of mitochondrial DNA extracted from blood leukocytes of P1, P2 and a healthy individual. The results revealed the absence of a mitochondrial deletion since we observed the same bands in the tested patients compared to the wild-type. Besides, the quantification of mtDNA in the peripheral blood
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
4
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
Fig. 2. A. Pedigree of the studied family and sequence chromatograms showing the mutation c.41T > C in SUCLG1 gene in homozygous state in patients and in heterozygous state in parents. Generations are indicated on the left in Roman numerals and the number under the individuals represent identification numbers for each generation. B. Global alignment of the amino acid sequences of SUCLG1 protein in 6 different eukaryotic organisms. Amino acid change of interest is framed and indicated with arrow.
leukocytes of the two patients by real time PCR showed a decrease of mtDNA content of 89.49% and 47.62% compared to normal controls respectively in P1 and P2. 3.3. Computational analysis 3.3.1. Effect on the protein transport MITOFATES software revealed that c.41T > C (p.M14T) mutation effect an ATG which located at the mitochondrial targeting sequence MTS corresponding to the first 41 amino acids of the SUCLG1 protein. It indicated also that substitution of methionine by threonine at position 14 could lead to the loss of mitochondrial pre sequence where the score was decreased from 0.450 to 0.356 (Fig. 3A) (gray coloration of T14). This result marked a potential effect of the mutation p.M14T on the SUCLG1 protein transport from the cytosol to the mitochondrial matrix. 3.3.2. Effect on structure and stability PolyPhen analysis predicted that the c.41T > C variant is probably damaging with scores of 0.71 and 0.59 on HumDiv and HumVar models, respectively. The characterization of the mutated protein by the ProtoProgram showed that this substitution decreased the grand average of hydropathicity (GRAVY) (0.023 > 0.030) but not the instability index (II). In addition The
KyteeDoolittle algorithm used in ExpacyProscale demonstrated that the c.41T > C replaced the methionine (non-polar, sulfur hydrophobic; with hydropthy index 1.9) by the threonine (polar, uncharged; with hydropthy index 0.7) at position 14 in the mitochondrial leader sequence of the SUCLG1 protein. This substitution decreased the level of hydrophobicity from 0.68 to 0.40 at this position and also in neighboring residues (D10-S18) which could possibly alter the protein flexibility structure (Fig. 3B). 3.3.3. Effect on 2D structure In order to predict the effect of the mutation on the 2D structure, we used the EXPASYCFSSP which demonstrated in the presence of the mutation (p.M14T) a decrease of the percent of helixes from 70 to 67.5 caused by a loss of an helix in the polypeptide signal. Moreover, secondary structure calculated by STRIDE showed that p.M14T had markedly altered backbone angles of the protein suggesting that this substitution could destabilizing the helical conformation of the protein. 3.3.4. Effect on 3D structure To investigate the eventual effect of the non synonymous variation changing methionine residue by a Threonin at position 14 (p.14M > T) of SUCLG1 protein, we modeled and compared the two variants, 14M and 14T. 3D Model revealed that the M14 is involved
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
5
Fig. 3. A. Mitofates prediction in human's wild type (M14) and mutated (T14) SUCLG1 mitochondrial targeting sequence B. Hydrophobicity scale in SUCLG1 MTS (first41 amino acid) is compared in the wild-type (control) and in the mutated p.M14T and p.M14L proteins. Red frames show changes in hydrophobicity scales. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
in a hydrogen bond with the residue T 13, while the T14 variation leads to a new hydrogen bond with the residue 12A and remove all hydrogen bonds in the MTS (first41 residues). The comparison of wild type and mutated 3D model of SUCLG1 MTS demonstrated the removing of seven hydrogen bunds between M1-M2, T4-A6, A9-I11, D10-I11, R29-S30 and R29-F31 and the creation of novel bunds A12T14, V15-S16, D36-G35, D36-P34, and I11-T13 (Fig. 4AeB). Moreover, the rms (root mean square) differences calculated by applying structural superposition of both wide type and mutant 3D model of SUCLG1 MTS valued at 6.53A. 4. Discussion I this work we examined two patients from the same consanguineous family presenting the similar phenotypes of
mitochondrial neonatal encepahlomyopathy and lactic acidosis. The results of mutational screening of the 9 exons of SUCLG1 gene and their flanking regions showed the presence of the mutation c.41T > C in the exon 1 at homozygous state in the two patients. This mutation substitutes a conserved methionine residue to a threonine at position 14 (p.M14T) located within the mitochondrial targeting sequence (MTS) which is composed by the first 41 amino acids of the SUCLG1 protein. In the studied patients, this mutation c.41T > C p.M14T was founded for the first time at homozygous state when it has been previously described in compound heterozygous state with p.S200F mutation in a female patient presenting a neonatal-onset lactic acidosis with urinary excretion of methylmalonic acid and a complex I deficiency [16]. At the same position, the p.M14L mutation was described at homozygous [4] and also at compound
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
6
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
Fig. 4. Generation of the 3-dimensional model showing added hydrogen bonds between the wild type (A) and the mutant model including the p.M14T mutation (B). Model generation of 14M, 14T and 14Lvariants (C).
heterozygous state with p.Q212R [13]. Cases with succinyl-CoA synthase deficiency are not frequent and under than 30 disease-causing mutations were found in the SUCLG1 gene including missense, splice site, and nonsense mutations and also deletions which affect activity, stability and oligomerization of the protein [6,9,17]. In order to investigate the effect of the homozygous p.M14T mutation on SUCLG1 structure, function and translocation to mitochondrial matrix, we used several bioinformatics tools. In fact, ExpacyProscale and Proto Program demonstrated that the c.41T > C p.M14T mutation caused a decrease of hydropathicity at the position of mutated amino acid and also in neighboring residues (D10-S18) which could possibly
alter the protein flexibility structure and the grand average of hydrophobicity (GRAVY) (0.023 > 0.030). In addition, Mitofates software showed that the substitution of residue Methionine to threonine at position 14 decreased the probability of the protein mitochondrial targeting from 0.42 to 0.356. Indeed, protein import into the mitochondrion is a complex process involving specific interactions with several receptors and channels. In a first step, the process is initiated when Tom20, a heterodimer receptor binds to the typical mitochondrial preproteins that carry the cleavable N-terminal mitochondrial targeting sequence (MTS) [18]. This signal is a motif predicted to form an amphipathic helix including ~70 residues, most of which are positively charged basic residues [19]. In a second step, Tom20 transfers the presequence to the Tom22 receptor, once within the inter membrane space, proteins destinated for the matrix must pass through the TIM complex [20]. Only few mutations were described in mitochondrial targeting sequence leading to localization defect of mitochondrial proteins synthesized in cytosol. In fact, the R10P mutation in the PDHA1 gene causing a deficiency in the alpha subunit of the mitochondrial pyruvate dehydrogenase E1 was described [21]. Furthermore, the R3P mutation in POLG1 gene located in the protein presequence was found in a family with progressive external ophthalmoplegia [22]. Both of these mutations are located in the TOM22 hexamer match region and the region containing the maximum of positively charged amphiphilicity score (PA score). Equally, the p.M14T mutation is predicted to disturbs the positively charged amphiphilicity score (PA score) in region including 7e16 residues (Fig. 3/A), cause a conformational change, and affect the hydrophobic face of the pre sequence required for a specific interaction. Furthermore, the secondary structure calculated by STRIDE showed that p.M14T had markedly altered backbone angles of the protein suggesting that this substitution could destabilize the helical conformation of the protein. In addition, generation of 3D model of the mutated presequence and its comparison with wild type one revealed that p.M14T lead to removing all hydrogen bonds along the pre sequence and to the creation of novel bonds. Moreover, the rms (root mean square) differences calculated by applying structural superposition of both wide type and mutated 3D model of SUCLG1 MTS valued at 6.53A. Consequently, all these structural changes caused by M14T mutation could affect the stability and translocation of the SUCLG1 protein. To compare structural changes caused by p.M14T mutation with that caused by c.40A > T p.M14L mutation previously described and affecting the same methionine 14 in the SUCLG1 MTS, we performed several in-silico analysis. Results showed that p.M14L had no effect on the mitochondrial translocation with a normal score 0.45 while p.M14T described here affects the mitochondrial presequence with a lower score valued at 0.35. The results of ExpacyProscale and ProtoProgram demonstrated also that the change of Methionine by leucine at position 14 increased the score of hydrophobicity to 0.9 while the threonine decreased it from 0.68 to 0.40 (Table 3). In addition Comparing of the 3D mutated M14L and M14T SUCLG1 model with the wild type showed that the global conformation was slightly changed in presence of M14L with an RMS score 1.49A while this conformation is more changed (RMS 6.5A) with a closed N-terminal tail in the M14T model compared to wild type and M14L model (Fig. 4C). In fact, these data suggest that p.M14T is more pathogenic than p.M14L which confirmed also by previous study that described a total absence of the SUCLG1 protein caused by M14T mutation in compound heterozygous state with S200F [16] while the M14L at homozygous state lead to a reduced SUCLG1 protein level [4]. Besides, reducing of mtDNA copy number in blood leucocytes is rarely detected in patients with SUCLG1 deficiency and it was
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
7
Table 2 Identified mutations affecting the methionine 14 in SUCLG1 gene. Mutation/Aminoacid change
Allele phase
Age of onset
Statut
mtDNA Content (% of controls)
ETC activity
Western blot (SUCLG1, SUCLG2, SUCLA2)
fe rences Re
c.40A > T p.Met14Leu c.40A > T (p.Met14Leu) c.635A > G (p.Gln212Arg)
Homo
Day of life1
Died at17mo
50% (liver)
NA
Severly reduced
[2]
CH
14mo
Alive at10y
72% (muscle) 50% (fibroblastes)
NA
[13]
CH
J2
Died at 20mo
Normal (fibroblasts) Doubled (muscle)
Reduced (mu,fib)
Absent (SUCLG1þSUCLG2) Reduced (SUCLA2) (fibroblasts) NA
[15]
Homo
Day of life1
Died at 24mo Died at 39mo
89% 47% (leucocytes)
NA
NA
Current study
c.41T > C p.Met14T c.599C > T p.Ser200Phe c.41T > C p.Met14T (2cases)
Abbreviations: NA: not available; homo:homozygous; CH:compound heterozygous; mo:month; y:year; ETC:electron transport chain.
This work was supported by The Ministry of the Higher Education and the Scientific Research in Tunisia.
Table 3 In silico comparison of M14L and M14T.
p.14M (wild type) p.M14T p.M14L
MITOFATES
Expasy protscale
Model 3D (RMS)
0.45
0.64
e
0.35 0.45
0.7 0.9
6.5A 1.19A
observed in our patients with 89.49% and 47.62% in P1 and P2, respectively. The mtDNA content was found of 50% in fibroblasts and 72% in muscle compared with controls in patients with p.M14L mutation at compound heterozygous state with Q212R at [13]. Whereas, patient with p.M14T in compound heterozygous state with S200F presented a high level of mtDNA copy number in muscle but not in fibroblasts [16] (Table 2). However, other tissues such as liver and muscle that usually present reduction of mt DNA copy number, were not explored in our study owing the lack of investigation of this disease in our population and the sudden death of patients. Several studies have indicated that SUCL forms a complex with nucleoside diphosphate kinase (NDPK), which is important for the salvage of deoxyribonucleotides for mtDNA synthesis [23,24]. Mutations in SUCLA2 and SUCLG1 seem to disrupt the association between succinyl CoA synthase and mitochondrial nucleoside diphosphate kinase function, resulting in mitochondrial dNTP pool imbalance and eventually, decreased mtDNA synthesis leading to mtDNA depletion [12,25]. To our knowledge the present study reported the first cases with the c.41T > C (p.M14T) mutation at the homozygous state in SUCLG1 gene associated to the mitochondrial encephalomyopathy and lactic acidosis in Tunisia and Africa. The p.M14T mutation is located within the mitochondrial targeting sequence (MTS) and seems to affect stability, structure and translocation of protein. A decrease in MtDNA copy number was also revealed by real time PCR in the peripheral blood leukocytes of the two patients compared with controls. Conflict of interest The authors declare that they have no competing interests. Acknowledgments We thank the parents for their cooperation in the present study.
References [1] X. Zhu, X. Peng, M.X. Guan, et al., Pathogenic mutations of nuclear genes associated with mitochondrial disorders, Acta Biochim. Biophys. Sin. 41 (2009) 179e187. [2] V. Valayannopoulos, C. Haudry, V. Serre, et al., New SUCLG1 patients expanding the phenotypic spectrum of this rare cause of mild methylmalonic aciduria, Mitochondrion 10 (2010) 335e341. [3] C. Miller, L. Wang, et al., The interplay between SUCLA2, SUCLG2, and mitochondrial DNA depletion, Biochim. Biophys. Acta 1812 (2011) 625e629. [4] J.L. Van Hove, M.S. Saenz, J.A. Thomas, et al., Succinyl-CoA ligase deficiency: a mitochondrial hepatoencephalomyopathy, Pediatr. Res. 68 (2010) 159e164. [5] J.D. Johnson, J.G. Mehus, K. Tews, et al., Genetic evidence for the expression of ATP- and GTP-specific succinyl-CoA synthetases in multicellular eucaryotes, J. Biol. Chem. 273 (1998) 27580e27586. [6] E. Ostergaard, E. Christensen, E. Kristensen, et al., Deficiency of the alpha subunit of succinate-coenzyme A ligase causes fatal infantile lactic acidosis with mitochondrial DNA depletion, Am. J. Hum. Genet. 81 (2007) 383e387. [7] D. Lambeth, K. Tews, S. Adkins, et al., Expression of two succinyl-CoA synthetases with different nucleotide specificities in mammalian tissues, J. Biol. Chem. 279 (2004) 36621e36624. [8] R. Carrozzo, D. Verrigni, M. Rasmussen, et al., Succinate-CoA ligase deficiency due to mutations in SUCLA2 and SUCLG1: phenotype and genotype correlations in 71 patients, J. Inherit. Metab. Dis. 39 (2016) 243e252. [9] H. Rivera, B. Merinero, M. Martinez-Pardo, et al., Marked mitochondrial DNA depletion associated with a novel SUCLG1 gene mutation resulting in lethal neonatal acidosis, multi-organ failure, and interrupted aortic arch, Mitochondrion 10 (2010) 362e368. dard-me reuze, K. Fragaki, et al., The severity of phenotype [10] C. Rouzier, S.L. Gue linked to SUCLG1 mutations could be correlated with residual amount of SUCLG1 protein, J. Med. Genet. 47 (2010) 670e676. [11] Z. Liu, F. Fang, C. Ding, et al., SUCLA2-related encephalomyopathic mitochondrial DNA depletion syndrome: a case report and review of literature, Zhonghua Er Ke Za Zhi 52 (11) (2014) 817e821. [12] A.W. El-Hattab, F. Scaglia, Mitochondrial DNA depletion syndromes: review and updates of genetic basis, manifestations, and therapeutic options, Neurotherapeutics 10 (2013) 186e198. [13] T.R. Donti, R. Masand, D.A. Scott, et al., Expanding the phenotypic spectrum of Succinyl-CoA ligase deficiency through functional validation of a new SUCLG1 variant, Mol. Genet. Metabol. 119 (2016) 68e74. [14] H.A. Lewin, J.A. Stewart-Haynes, A simple method for DNA extraction from leukocytes for use in PCR, Biotechniques 13 (1992) 522e524. [15] V. Venegas, V. Wang, J. Dimmock, et al., Real time quantitative PCR analysis of mitochondrial DNA content, Curr. Protoc. Hum. Genet. (2011) 19.7.1e19.7. 12. [16] O. Sakamoto, T. Ohura, K. Murayama, et al., Neonatal lactic acidosis with methylmalonic aciduria due to novel mutations in the SUCLG1 gene, Pediatr. Int. 53 (2011) 921e925. [17] M.L. Landsverk, V.W. Zhang, L.J.C. Wong, et al., A SUCLG1 mutation in a patient with mitochondrial DNA depletion and congenital anomalies, Mol. Genet. Metab. Rep. 14 (2014) 451e454. [18] A. Chacinska, C.M. Koehler, D. Milenkovic, et al., Importing mitochondrial proteins: machineries and mechanisms, Cell 138 (2009) 628e644. €gtle, S. Wortelkamp, R.P. Zahedi, et al., Global analysis of the mito[19] F.N. Vo chondrial N-proteome identifies a processing peptidase critical for protein stability, Cell 139 (2009) 428e439.
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011
8
M. Maalej et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
[20] M. Marom, A. Azem, D. Mokranjac, Understanding the molecular mechanism of protein translocation across the mitochondrial inner membrane: still a long way to go, Biochim. Biophys. Acta 1808 (2011) 909e1001. [21] F. Takakubo, P. Cartwright, N. Hoogenraad, et al., An amino acid substitution in the pyruvate dehydrogenase E1 alpha gene, affecting mitochondrial import of the precursor protein, Am. J. Hum. Genet. 57 (1995) 772e780. [22] J.D. Stewart, S. Tennant, H. Powell, et al., Differential features of patients with mutations in two COX assembly genes, SURF-1 and SCO2, Ann. Neurol. 47 (2000) 589e995.
[23] E.F. Kadrmas, P.D. Ray, D.O. Lambeth, Apparent ATP-linked succinate thiokinase activity and its relation to nucleoside kinase in mitochondrial matrix preparations from Rabbit, Biochim. Biophys. Acta 1047 (1991) 339e346. [24] A. Kowluru, M. Tannous, H.Q. Chen, Localization and characterization of the mitochondrial isoform of the nucleoside diphosphate kinase in the pancreatic beta cell: evidence for its complexation with mitochondrial succinyl-CoA synthetase, Arch. Biochem. Biophys. 398 (2002) 160e169. [25] A. Suomalainen, P. Isohanni, Mitochondrial DNA depletion syndromes-many genes, common mechanisms, Neuromuscul. Disord. 20 (2010) 429e437.
Please cite this article in press as: M. Maalej, et al., Clinical, Molecular, and Computational Analysis in two cases with mitochondrial encephalomyopathy associated with SUCLG1 mutation in a consanguineous family, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.12.011