- Email: [email protected]
Cloning and expression analysis of six small heat shock protein genes in the common cutworm, Spodoptera litura
Journal of Insect Physiology 57 (2011) 908–914
Contents lists available at ScienceDirect
Journal of Insect Physiology journal homepage: www.elsevier.com/locate/jinsphys
Cloning and expression analysis of six small heat shock protein genes in the common cutworm, Spodoptera litura Ying Shen a,b, Jun Gu a, Li-Hua Huang a,*, Si-Chun Zheng a, Lin Liu a, Wei-Hua Xu c, Qi-Li Feng a, Le Kang b,** a
Guangdong Provincial Key Lab of Biotechnology for Plant Development, School of Life Sciences, South China Normal University, Guangzhou, Guangdong 510631, China State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China c State Key Laboratory of Biocontrol and School of Life Sciences, Sun Yat-Sen University, Guangzhou, China b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 21 January 2011 Received in revised form 25 March 2011 Accepted 31 March 2011
Small heat shock proteins (sHsps) are probably the most diverse in structure and function among the various superfamilies of stress proteins. To explore the diverse functions of insect sHsps, six sHsp cDNAs were cloned from the midgut cDNA library of Spodoptera litura, and a phylogenetic tree was constructed based on the conserved a-crystalline domains. The expression patterns in different developmental stages and tissues, as well as in response to both thermal and 20-hydroxyecdysone (20E) induction, were studied by real-time quantitative PCR. Based on sequence characteristics and phylogenetic relationships, the six SlHsps were classified into three independent groups: BmHsp20.4 like proteins (SlHsp19.7, 20.4, 20.7, 20.8), BmHsp26.6 like protein (SlHsp20), and BmHsp21.4 like protein (SlHsp21.4). All the SlHsps showed highest expression in the Malpighian tubules. The four BmHsp20.4 like protein genes were upregulated by thermal stress and showed expression variation with development. SlHsp20 exhibited lower expression levels in both egg and larval stages than in pupal and adult stages. SlHsp21.4 retained a constant expression level during all life stages. The expression of both SlHsp20.4 and SlHsp20.8 was significantly up-regulated by 20E. These results indicate that sHsps play diverse functions in S. litura: the BmHsp20.4 like proteins are involved in both thermal adaptation and development; SlHsp20 does not respond to temperature stress but possibly plays a role in metamorphosis; SlHsp21.4 may have no direct relationship with either thermal response or development. ß 2011 Elsevier Ltd. All rights reserved.
Keywords: Small heat shock protein Thermal stress Metamorphosis 20-Hydroxyecdysone Real-time quantitative PCR Spodoptera litura
1. Introduction Small heat shock proteins (sHsps) are a superfamily of proteins that contain an a-crystalline domain with molecular weights of 12–43 kDa depending on the variable N- and C-terminal extensions. Most sHsps display chaperone-like activity, helping the unfolding proteins to maintain their correct states (MacRae, 2000; Taylor and Benjamin, 2005). sHsps are probably the most diverse in structure and function among the various superfamilies of stress proteins (Franck et al., 2004). Ten sHsps (HspB1-B10) have been identified from the human genome (Kappe´ et al., 2003), and their orthologs have also been found in many other vertebrates (Franck et al., 2004). Plant sHsps were found to localize in different compartments of the cell, such as cytosol, endoplasmic reticulum, mitochondria and chloroplast (Waters and Vierling, 1999). Recently, 16 sHsps were identified in Bombyx mori based on newly assembled genome sequences (Li et al., 2009). Phylogenetic analysis showed that only one ortholog (B. mori
* Corresponding author. Tel.: +86 20 85210024; fax: +86 20 85215291. ** Corresponding author. Tel.: +86 10 64807219; fax: +86 10 64807099. E-mail addresses: [email protected] (L.-H. Huang), [email protected] (L. Kang). 0022-1910/$ – see front matter ß 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.jinsphys.2011.03.026
Hsp21.4 like protein) exists in insect sHsps, and the others have evolved independently among different insect orders (Sakano et al., 2006; Huang et al., 2008; Li et al., 2009). Complex evolution of sHsps results in great diversity of their functions. sHsps have been implicated to be involved in many physiological processes, such as cellular stress resistance (Landry et al., 1989), actin and intermediate filament dynamics (Wieske et al., 2001; Quinlan, 2002), membrane fluidity (Tsvetkova et al., 2002), life span (Wood et al., 2010) and various diseases (Mackay et al., 2003; Selcen and Engel, 2003; Evgrafov et al., 2004). Knowledgment of insect sHsps is much less than of sHsps in plants and vertebrates. Earlier research implied that sHsps may also play various roles in insects. For instance, they were suggested to contribute to thermal resistance (Qin et al., 2005; Huang et al., 2009), and may therefore extend the geographical distribution of some invasive species (Huang and Kang, 2007). Diapause is a mechanism of adaptation to disadvantageous temperature. The expression patterns of sHsps change when insects enter into diapause (Yocum et al., 1998; Hayward et al., 2005; Gkouvitsas et al., 2008). This suggests that sHsps may play important roles in insect diapause. Later study showed that the expression of some sHsps is related to development (Sonoda et al., 2006; Huang et al., 2009). Some sHsps, such as Hsp27 in Drosophila melanogaster (Huet
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
et al., 1996) and C. capitata (Kokolakis et al., 2008) are up-regulated by 20-hydroxyecdysone (20E) through a canonic ecdysone response element (EcRE) located in the promoter region. These results indicate that in addition to thermal responses, sHsps may be involved in developmental events in insects. sHsps have diverged greatly in insects during their evolution. There are 16 sHsps found in the genome of B. mori (Li et al., 2009). Similarly, more than 10 sHsps are identified in the genomes of D. melanogaster, Tribolium castaneum, Apis mellifera and Nasonia vitripennis, whose genomes have been completely sequenced. In this study, to explore the diversity of structure and functions of sHsps in the polyphagous vegetable pest, the common cutworm Spodoptera litura (Lepidoptera: Noctuidae), six sHsp cDNAs were cloned and their temporal and spatial expression profiles were analyzed. Their responses to treatment of both thermal stress and 20E stimulus were also monitored.
909
Table 1 Primer sequences used in the real-time quantitative PCR. Gene
Primer sequence (50 ! 30 )
Fragment length (bp)
hsp19.7
GATGGGGCTAACACCTGAAGAT TGTCTCTGTCCGACTTGATGCT ACATTGGACCCAGAATCATCG CAGGTTGCCGTCACTCGTTA CGTGGAGTCTCGCCTGTCTT GTGTTGTTGCTCTGGTCCTTTAT CCATCATCGCTGTTCCTCAA CCTGCCTTTCCTCGTGCTTA CCAGCATCAAGAGCGACAAG CCACCACAATAAAGCCGTCA ATGAGGAAGATGGAAGAAGAAAT CTGTGCTGTGACGATGTGGT ACTGTTGATGGACCCTCTGGAA ACAGGAACACGGAAAGCCATAC
134
hsp20 hsp20.4 hsp20.7 hsp20.8 hsp21.4 gapdh
242 144 210 105 110 152
2. Materials and methods 2.1. Experimental insects and cells S. litura and its embryonic cell line (Spli-221) were provided by the Entomology Institute of SUN YAT-SEN University, Guangzhou, China. Insects were reared in laboratory conditions as described by Guo et al. (2009) and Liu et al. (2010). The Spli-221 cell line was cultured at 27 8C in Grace’s insect medium (Invitrogen Co., Guangzhou, China) containing 10% fetal bovine serum. Cells were passaged every 4 days using a 1:4 dilution of cells. 2.2. Sample preparation Sixth instar larvae were dissected on ice, and various tissues, such as midgut, fatbody, epidermis, Malpighian tubules and haemolymph were isolated and stored at 70 8C. Eggs, 3rd instar larvae, 6th instar larvae, pre-pupae, pupae and adults were collected separately for RNA extraction when they were midinstar. For temperature treatment, 6th instar larvae were kept at 0, 26 or 40 8C for 1 h, and then recovered at 26 8C for 1 h. The treated samples were frozen immediately in liquid nitrogen. Each treatment included more than three individual larvae and was repeated three times. The Spli-221 cells were seeded into a six-well plate containing 500 mL Grace’s medium and kept at 26 8C until the cells reached about 90% confluence. The cells were treated with 0.4 mM 20E (dissolved in dimethyl sulfoxide, DMSO) for 3 h before harvest for RNA analysis. The corresponding amount of DMSO was added into the cell medium as a control. 2.3. Sequence alignment and secondary structure prediction
amino acids) of the selected sHsps were aligned using Cluster X with a Gonnet 250 matrix. The phylogenetic analysis was performed with MEGA version 4.0 (Tamura et al., 2007). The trees were constructed using both neighbor-joining (NJ) and maximum parsimony (MP) methods. The sites containing missing data or alignment gaps were removed in a complete deletion fashion and 1000 bootstrap replications were used to test the topology in all cases. Percentage bootstrap values were reported on each cluster. For the NJ tree, the P-distance model was selected because it was thought to give better results than more complicated distance when the number of sequences is large and the number of positions used is relatively small (Nei and Kumar, 2000). 2.5. Real-time quantitative PCR Total RNA was extracted using the RNAprep pure tissue kit (Tiangen Biotech, Beijing, China) combined with On-Column DNase digestion to eliminate DNA contamination, then 1 mg RNAs were used to generate cDNAs. Real time PCR reactions were performed in a 20 mL total reaction volume including 10 mL of 2 SYBR1 Premix EX TaqTM (TaKaRa, Dalian, China) master mix, 5 mM each of gene specific primers (Table 1) and the cDNA templates. The annealing temperature was 58 8C. The reactions were carried out on an ABI7300 real-time PCR system (Applied Biosystems, Foster City, CA). DD The quantity of each sHsp mRNA was calculated with the 2 Ct method (Livak and Schmittgen, 2001), and normalized to the abundance of a house-keeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, accession no. HQ012003). The relative mRNA levels of each gene were represented as folds over the expression levels of gapdh.
The plasmids containing the sHsp ESTs were selected from the cDNA expression library of S. litura midgut and sequenced using an ABI 3730 DNA analyzer. The open reading frames (ORFs) were identified with the aid of the ORF Finder software (http:// www.ncbi.nlm.nih.gov/gorf/gorf.html). The deduced amino acid sequences were aligned using Cluster X software (Thompson et al., 1997), and the sequence similarity was calculated according to the observed divergence. Secondary structure predictions were performed with the PHD software accessed via the NPS@Web server (http://npsa-pbil.ibcp.fr [Combet et al., 2000]).
2.6. Statistical analysis Statistical significance of differences between treatments was analyzed either by t-test (for comparison of two means) or by oneway analysis of variance (ANOVA; Systat, Inc, Evanston, IL) followed by a LSD test for multiple comparisons. For the ANOVA, mRNA expression levels were log-transformed by the method of Tomanek and Somero (1999) to assure homogeneity of variances among different groups. The data were analyzed using SPSS 16.0 software and denoted as means SE (standard error).
2.4. Phylogenetic analysis
3. Results
The deduced amino acid sequences of SlHsps were used as queries to search for other lepidopteran sHsps in GenBank by BlastP program available at the NCBI website (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The conserved a-crystalline domains (about 80
3.1. Cloning and characterization of six SlHsps Six SlHsp cDNAs, namely SlHsp19.5, 20, 20.4, 20.7, 20.8 and 21.4 (GenBank accession nos. HM046617, HM046616, HM046615,
910
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
HM046614, HM046613 and HM046612, respectively) were cloned from the cDNA expression library of S. litura midgut. The ORFs were 528, 566, 549, 531, 570 and 564 bp, respectively in length. Their deduced amino acid sequences contained a typical a-crystalline
domain, which consists of seven b-strands. Another b-strand and a-helix were found only in the N-terminal of SlHsp20 and SlHsp21.4, but they were arranged in a different order (Fig. 1). Therefore, based on the secondary structure of N-terminal, the six
Fig. 1. Alignment of the deduced amino acid sequences of six SlHsps. The conserved a-crystallin domain is underlined. The amino acids with over 50% identity are shaded in gray. Secondary structure elements are predicted for individual sequences and are shown as cylinders (a-helices) and arrows (b-strands) below the alignment.
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
911
Table 2 Lepidoptera sHsps collected from GenBank and the genome of Bombyx mori. No.
Species
Name
Accession no.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 39 30 31 32 33 34 35 36 37 38 39
Bombyx mori
BmHsp15.7 BmHsp19.1 BmHsp19.5 BmHsp19.9 BmHsp20.1 BmHsp20.2 BmHsp20.4 BmHsp20.8 BmHsp21.4 BmHsp21.6 BmHsp22.6 BmHsp23.8 BmHsp24.2 BmHsp26.6 BmHsp27.4 BmHsp42.3 SlHsp19.7 SlHsp20 SlHsp20.4 SlHsp20.7 SlHsp20.8 SlHsp21.4 CfHsp19.9 CfHsp21.5 CfHsp33.6 LoHsp1 LoHsp2 LoHsp3 MbHsp19.7 MbHsp20.7 SnHsp19.5 SnHsp20.8 CsHsp19.7 AsHsp HeHsp21.4 GmHsp PiHsp25 PxHsp19.5 EcIbpA
Bmb030089 BGIBMGA004606-TA BGIBMGA013545-TA BGIBMGA004540-TA Bmb016799 BGIBMGA005784-TA BGIBMGA004541-TA BGIBMGA004605-TA BGIBMGA000944-TA BGIBMGA004630-TA BGIBMGA004103-TA BGIBMGA004515-TA BGIBMGA005780-TA BGIBMGA005755-TA BGIBMGA005823-TA BGIBMGA004101-TA HM046617 HM046616 HM046615 HM046614 HM046613 HM046612 AAZ14791 AAZ14790 AAZ14793 AAV91360 AAV91361 AAV91362 BAF03558 BAF03557 ACD01216 ABC68342 BAE94664 ADI48314 ABS57447 AAN15790 AAC36146 BAE48744 YP_001460484
Spodoptera litura
Choristoneura fumiferana
Lonomia obliqua
Mamestra brassicae Sesamia nonagrioides Chilo suppressalis Actias selene Heliconius erato Galleria mellonella Plodia interpunctella Plutella xylostella Escherichia coli
SlHsps were classed into three groups: No a-helix (SlHsp19.7, 20.4, 20.7 and 20.8), one a-helix followed by a b-strand (SlHsp20), and one b-strand followed by an a-helix (SlHsp21.4) .The sequence similarities were very high (>63%) among SlHsp19.7, 20.4, 20.7 and 20.8. However, the similarities were much lower (<30%) for the other two SlHsps (SlHsp20 and 21.4) (Supplementary material, Fig. S1). The low sequence similarities of sHsps in the same species indicate that their functions may have diverged correspondingly. To analyze the relationships of S. litura sHsps to other insect sHsps, 38 lepidopteron sHsps (Table 2), including the 16 B. mori sHsps, were collected by Blast P in both GenBank and the silkworm genome database (http://silkworm.swu.edu.cn/silkdb/). Based on the alignment of a-crystalline domain (Supplementary material, Fig. S2), the NJ (Fig. 2) and MP (Supplementary material, Fig. S3) trees were constructed. Both trees showed that the lepidopteron sHsps formed at least five groups and each B. mori ortholog is BmHsp20.4, BmHsp22.6, BmHsp22.4, BmHsp27.4 and BmHsp26.6, respectively. The SlHsps were clustered into three groups. The four SlHsps (Hsp19.7, 20.4, 20.7 and 20.8) with high sequence similarity to each other belonged to the group of BmHsp20.4 like protein, and SlHsp20 and SlHsp21.4 were grouped as BmHsp26.6 and BmHsp21.4 like proteins, respectively.
Fig. 2. Phylogenetic tree of the lepidopteran sHsps. A total of 38 lepidopteran sHsps and an Escherichia coli sHsp, IbPA were selected to construct the phylogenetic tree, and the E. coli IbpA was used as the out-group. Only the conserved a-crystalline domains (about 80 amino acids) were aligned and used for the tree construction using the neighbor-joining (NJ) method. Percentage bootstrap values above 50% were indicated on each cluster, and values below 50% were omitted. The S. litura sHsps are labeled with asterisks. The GenBank accession numbers and abbreviation for the species names are listed in Table 2.
SlHsp20.8 in the Malpighian tubules was 2.8-fold (compared with the level of gapdh), which was much higher than in the epidermis (0.06-fold). Besides, SlHsp20.8 was expressed highly in many other tissues, such as haemolymph (1.1-fold), midgut (0.75-fold) and fatbody (0.5-fold). However, the other SlHsps were maintained at low mRNA levels (<0.4-fold) in most tissues except for the Malpighian tubules, and levels of SlHsp19.7, 20.7, 20.8 and 21.4 were especially low (<0.05-fold) in the epidermis (Fig. 3). 3.3. Expression of SlHsps in response to thermal stress
3.2. Expression of SlHsps in various tissues The expression patterns of SlHsps were significantly different among various tissues. All six SlHsps exhibited highest expression levels in the Malpighian tubules. For example, the mRNA level of
Responses of six SlHsps to thermal stress were quite different. SlHsp20.4 and SlHsp20.8 were significantly up-regulated by both heat and cold, with an intensive response to heat, and their mRNA expression levels increased by 67- and 21-fold, respectively, after
912
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
Fig. 3. Relative mRNA expression levels of the six SlHsps in different tissues. The relative expression levels of the SlHsps are represented as the fold difference from gapdh expression. Different letters on the tops of the columns indicate significance in the difference of expression levels by ANOVA analysis. Abbreviation: Mg, midgut; Fb, fatbody; Ep, epidermis; Mt, Malpighian tubules; Ha, haemolymph.
Fig. 6. Relative mRNA expression levels of the six SlHsps in response to 20hydroxyecdysone (20E) induction. The corresponding amount of DMSO was used as a control. The asterisks on the tops of the columns indicate significance in the difference of expression levels by t-test analysis.
SlHsp20 exhibited lower expression levels in both eggs and larvae rather than in pupae and adults. 3.5. Regulation of the expression of the SlHsps by 20E 20E was added into the cell medium to test whether ecdysone regulates the expression of the SlHsps. The results showed that both SlHsp20.4 and SlHsp20.8 were significantly up-regulated by 20E (tHsp20.4 = 3.61, P = 0.02; tHsp20.8 = 5.77, P = 0.004). However, this induced expression was not detected in the other SlHsps (Fig. 6). 4. Discussion Fig. 4. Relative mRNA expression levels of the six SlHsps in response to the thermal stress.
heat shock treatment (40 8C for 1 h). SlHsp19.7 and SlHsp20.7 were significantly induced by heat, whereas they showed no induction by cold. SlHsp20 and SlHsp21.4 did not respond to either heat or cold stresses (Fig. 4). 3.4. Expression of SlHsps at different developmental stages While SlHsp21.4 remained at a constant expression level in all developmental stages, other SlHsps exhibited diverse expression profiles with development (Fig. 5). SlHsp19.7, 20.4, 20.7 and 20.8 showed irregular expression variation with development, whereas
Fig. 5. Relative mRNA expression levels of the six SlHsps in different developmental stages. Abbreviation: 3L, the 3rd instar larvae; 6L, the 6th instar larvae; PP, prepupae; P, pupae; Ad, Adult.
Small Hsps have been reported to play critical roles in thermal adaptations of insects (Gehring and Wehner, 1995; Huang and Kang, 2007; Huang et al., 2009). In the present study, SlHsp20.4 and SlHsp20.8 were significantly up-regulated by both heat and cold treatments. This characteristic is the same as most previously reported responses of sHsps. However, SlHsp19.7 and SlHsp20.7 responded only to heat treatment but not to cold stress (Fig. 4). This suggests that these two sHsps may have a different mechanism of thermal adaptation from the other SlHsps. This deviation suggests that the mechanisms of heat and cold adaptation may be different and can function separately. This is consistent with our early finding that cross-resistance may not exist between heat and cold adaptations of insects (Huang et al., 2007). In addition, SlHsp20 and SlHsp21.4 were insensitive to any thermal stress (Fig. 4). It seems that the thermal adaptation of insects is accurately controlled by regulating the expression of different sHsps. sHsps play important roles in insect development. They are involved in regulation of development in D. melanogaster (Takahashi et al., 2010). Many sHsps show regular expression during development. Plutella xylostella Hsp19.7 (Sonoda et al., 2006) and three Liriomyza sativa sHsps (Huang et al., 2009) are expressed at lower levels in both larvae and adults, but reach a peak in the pupal stage. In this study SlHsp20.4 and SlHsp20.8 had similar expression patterns. SlHsp19.7 and SlHsp20.7 also showed lower expression in the larval stage, but they were significantly upregulated in the adult stage. SlHsp20 maintained a lower expression level in both eggs and larvae, whereas it was remarkably up-regulated after the larval-pupal transformation (Fig. 5), suggesting that SlHsp20 may be involved in metamorphosis. While the above SlHsp showed stage-related expression patterns, SlHsp21.4 exhibited a constitutive expression pattern during all developmental stages (Fig. 5). Hsp21.4 is probably the
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
only ortholog of lepidopteran sHsp (Sakano et al., 2006; Huang et al., 2008; Li et al., 2009). Drosophila Hsp21.4 (NM_167669) is located in the X chromosome, whereas all the other sHsps are found on autosomes. The A. mellifera Hsp21.4 (XM_392405) has a stable expression level during the life span of workers, however, higher expression levels were found in queens (Aamodt, 2008). This indicates that Hsp21.4 may be related to the sex-associated functions. It has been suggested that there is a functional connection between hormones (such as ecdysone) and heat shock regulatory systems (Lezzi, 1996). In Drosophila, the steroid 20E was found to up-regulate mRNA levels of Hsp27, and the ecdysone response element (EcRE) was identified in the promoter region of the gene (Antoniewski et al., 1993). The metamorphosis-related transcription factor - Broad-Complex (BR-C) was also found to bind to the promoter region of Drosophila Hsp23 (Dubrovsky et al., 2001). These findings provide a more direct proof for the connection between ecdysone and sHsps. No study has reported the regulation of sHsps by ecdysone through its response element in lepidopteran insects. In the present study, two SlHsps (SlHsp20.4 and SlHsp20.8) were significantly induced by 20E, whereas the others were not (Fig. 6). It is not clear whether these two genes are regulated by 20E directly acting on their promoters or if they are regulated by 20E through other indirect mechanisms. The expression of insect Hsps shows obvious tissue specificity. In B. mori, Hsp20.4 is selectively expressed in the midgut and ovary, Hsp40 in the head, Hsp70 in the cuticle, and Hsp90 in the ovary and head at low temperatures (Saravanakumar et al., 2008). In the present study, SlHsp19.7, 20.7, 20.8 and 21.4 showed very low mRNA levels in epidermis, however, all six SlHsps exhibited the highest mRNA levels in the Malpighian tubules (Fig. 3). Synthesis of Hsp60 were strikingly high in the Malpighian tubules of both grasshoppers and cockroaches (Singh and Lakhotia, 2000). Similar situations were found in many other species, such as Chironomus striatipennis (Nath and Lakhotia, 1989) and Lucilia cuprina (Tiwari et al., 1995). The Malpighian tubules are important excretory organs and accumulate concentrated inorganic ions and poisonous metabolites. It remains to be clarified why sHsps are highly expressed in the Malpighian tubules. One of explanations is that sHsps may be involved in the catabolism of the toxic metabolites or re-absorption of water in the Malpighian tubules. sHsps are the most diverse in structure and function among the various stress protein families (Franck et al., 2004). Except for the conserved a-crystalline domain located in the C- terminal, their Nterminal is high-variable. This region of sHsps is important for both chaperone activity and substrate specificity (Basha et al., 2006). Based on the secondary structure of the N-terminal, SlHsp19.7, 20.4, 20.7 and 20.8 were classified as a single group, however, SlHsp20 and SlHsp21.4 were classified into two groups, respectively (Fig. 1). The above analysis showed that the BmHsp20.4 like proteins (SlHsp19.7, 20.4, 20.7 and 20.8), SlHsp20 and SlHsp21.4 had distinct expression profiles in response to different stimulus. Probably, this expression or function diversity of SlHsps is related to their specific N-terminal structures. In conclusion, the six S. litura sHsps can be classified into three groups: BmHsp20.4 like proteins (SlHsp19.7, 20.4, 20.7, 20.8), BmHsp26.6 like protein (SlHsp20), and BmHsp21.4 like protein (SlHsp21.4) according to their sequence characteristics and expression patterns. This indicates that S. litura sHsps may play diverse functions: the BmHsp20.4 like proteins are involved in both thermal adaptation and development; SlHsp20 does not respond to thermal stress, but may be involved in metamorphosis; SlHsp21.4 may not be directly involved in either thermal response or developmental events. Further investigation on identifying other sHsp members and exploring their functions in S. litura is ongoing.
913
Acknowledgements The research was supported by the grants from the National Natural Science Foundation of China (Grant No. 30900152), the State Key Laboratory of Integrated Management of Pest Insects and Rodents (No. ChineseIPM0902) and the Natural Science Foundation of Guangdong Province (No. 9451063101002022).
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jinsphys.2011.03.026. References Aamodt, R.M., 2008. The caste- and age-specific expression signature of honeybee heat shock genes shows an alternative splicing-dependent regulation of Hsp90. Mechanisms of Ageing and Development 129, 632–637. Antoniewski, C., Laval, M., Lepesant, J.A., 1993. Structural features critical to the activity of an ecdysone receptor binding site. Insect Biochemistry and Molecular Biology 23, 105–114. Basha, E., Friedrich, K.L., Vierling, E., 2006. The N-terminal arm of small heat shock proteins is important for both chaperone activity and substrate specificity. Journal of Biological Chemistry 281, 39943–39952. Combet, C., Blanchet, C., Geourjon, C., Dele´age, G., 2000. NPS@:Network protein sequence analysis. Trends in Biochemical Sciences 291, 147–150. Dubrovsky, E.B., Dubrovskaya, V.A., Berger, E.M., 2001. Selective binding of Drosophila BR-C isoforms to a distal regulatory element in the hsp23 promoter. Insect Biochemistry and Molecular Biology 3, 1231–1239. Evgrafov, O.V., Mersiyanova, I., Irobi, J., Van Den Bosch, L., Dierick, I., Leung, C.L., Schagina, O., Verpoorten, N., Van Impe, K., Fedotov, V., Dadali, E., Auer-Grumbach, M., Windpassinger, C., Wagner, K., Mitrovic, Z., Hilton-Jones, D., Talbot, K., Martin, J.J., Vasserman, N., Tverskaya, S., Polyakov, A., Liem, R.K., Gettemans, J., Robberecht, W., De Jonghe, P., Timmerman, V., 2004. Mutant small heat-shock protein 27 causes axonal Charcot–Marie-Tooth disease and distal hereditary motor neuropathy. Nature Genetics 36, 602–606. Franck, E., Madsen, O., Rheede, T.V., Ricard, G., Huynen, M.A., de Jong, W.W., 2004. Evolutionary diversity of vertebrate small heat shock proteins. Journal of Molecular Evolution 59, 792–805. Gehring, W.J., Wehner, R., 1995. Heat shock protein synthesis and thermotolerance in Cataglyphis, an ant from the Sahara desert. Proceedings of the National Academy of Sciences of the United States of America 92, 2994–2998. Gkouvitsas, T., Kontogiannatos, D., Kourti, A., 2008. Differential expression of two small Hsps during diapause in the corn stalk borer Sesamia nonagrioides (Lef.). Journal of Insect Physiology 54, 1503–1510. Guo, X.R., Zheng, S.C., Liu, L., Feng, Q.L., 2009. The sterol carrier protein 2/3-oxoacylCoA thiolase (SCPx) is involved in cholesterol uptake in the midgut of Spodoptera litura: gene cloning, expression, localization and functional analyses. BMC Molecular Biology 10, 102. Hayward, S.A.L., Pavlidesb, S.C., Tammariellob, S.P., Rineharta, J.P., Denlinger, D.L., 2005. Temporal expression patterns of diapause-associated genes in flesh fly pupae from the onset of diapause through post-diapause quiescence. Journal of Insect Physiology 51, 631–640. Huang, L.H., Chen, B., Kang, L., 2007. Impact of mild temperature hardening on thermotolerance, fecundity, and Hsp gene expression in Liriomyza huidobrensis. Journal of Insect Physiology 53, 1199–1205. Huang, L.H, Kang, L., 2007. Cloning and inter-specific altered expression of heat shock protein genes in two leafminer species in response to thermal stress. Insect Molecular Biology 16, 491–500. Huang, L.H., Wang, C.Z., Kang, L., 2009. Cloning and expression of five heat shock protein genes in relation to cold hardening and development in the leafminer, Liriomyza sativa. Journal of Insect Physiology 55, 279–285. Huang, L.H., Wang, H.S., Kang, L., 2008. Different evolutionary lineages of large and small heat shock proteins in Eukaryota. Cell Research 18, 1074–1076. Huet, F., Lage, J.D., Ruiz, C., Richards, G., 1996. The role of ecdysone in the induction and maintenance of hsp27 transcripts during larval and prepupal development of Drosophila. Development Genes and Evolution 206, 326–332. Kappe´, G., Franck, E., Verschuure, P., Boelens, W.C., Leunissen, J.A., de Jong, W.W., 2003. The human genome encodes 10 a-crystalline-related small heat shock proteins: HspB1-10. Cell Stress Chaperones 8, 53–61. Kokolakis, G., Tatari, M., Zacharopoulou, A., Mintzas, A.C., 2008. The hsp27 gene of the Mediterranean fruit fly, Ceratitis capitata: structural characterization, regulation and developmental expression. Insect Molecular Biology 17, 699–710. Landry, J., Chretien, P., Lambert, H., Hickey, E., Weber, L.A., 1989. Heat shock resistance conferred by expression of the human HSP27 gene in rodent cells. Cell Biology 109, 7–15. Lezzi, M., 1996. Chromosome puffing: supramolecular aspects of ecdysone action. In: Gilbert, L.I., Tata, J.R., Atkinson, B.G. (Eds.), Metamorphosis: Post-Embryonic Reprogramming of Gene Expression in Amphibian and Insect Cells. Academic Press, New York, pp. 145–173.
914
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
Li, Z.W., Li, X., Yu, Q.Y., Xiang, Z.H., Kishino, H., Zhang, Z., 2009. The small heat shock protein (sHSP) genes in the silkworm, Bombyx mori, and comparative analysis with other insect sHSP genes. BMC Evolutionary Biology 9, 215. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Liu, J.C., Zheng, S.C., Liu, L., Feng, Q.L., 2010. Protein profiles of the midgut of Spodoptera litura larvae at the sixth instar feeding stage by shotgun ESI-MS approach. Journal of Proteome Research 9, 2117–2147. Mackay, D.S., Andley, U.P., Shiels, A., 2003. Cell death triggered by a novel mutation in the a-crystallin gene underlies autosomal dominant cataract linked to chromosome 21q. European Journal of Human Genetics 11, 784–793. MacRae, T.H., 2000. Structure and function of small heat shock/a-crystallin proteins: established concepts and emerging ideas. Cellular and Molecular Life Sciences 57, 899–913. Nath, B.B., Lakhotia, S.C., 1989. Heat shock response in a tropical Chironomus: seasonal variation in response and the effect of developmental stage and tissue type on heat shock protein synthesis. Genome 32, 676–686. Nei, M., Kumar, S., 2000. Molecular Evolution and Phylogenetics. Oxford University Press, Oxford, England. Qin, W., Neal, S.J., Robertson, R.M., Westwood, J.T., Walker, V.K., 2005. Cold hardening and transcriptional change in Drosophila melanogaster. Insect Molecular Biology 14, 607–613. Quinlan, R., 2002. Cytoskeletal competence requires protein chaperones. Progress in Molecular and Subcellular Biology 28, 219–234. Sakano, D., Li, B., Xia, Q., Yamamoto, K., Banno, Y., Fujii, H., Aso, Y., 2006. Genes encoding small heat shock proteins of the silkworm, Bombyx mori. Bioscience, Biotechnology, and Biochemistry 70, 2443–2450. Saravanakumar, R., Ponnuvel, K.M., Hussaini Qadri, S.M., 2008. Expression of metabolic enzyme genes and heat-shock protein genes during embryonic development in diapause and non-diapause egg of multivoltine silkworm Bombyx mori. Biologia 63, 737–744. Selcen, D., Engel, A.G., 2003. Myofibrillar myopathy caused by novel dominant negative alpha B-crystallin mutations. Annals of Neurology 54, 804–810. Singh, A.K., Lakhotia, S.C., 2000. Tissue-specific variations in the induction of Hsp70 and Hsp64 by heat shock in insects. Cell Stress and Chaperones 5, 90–97. Sonoda, S., Ashfaq, M., Tsumuki, H., 2006. Cloning and nucleotide sequencing of three heat shock protein genes (hsp90, hsc70, and hsp19.5) from the diamond-
back moth, Plutella xylostella (L.) and their expression in relation to developmental stage and temperature. Archives of Insect Biochemistry and Physiology 62, 80–90. Takahashi, K.H., Rako, L., Takano-Shimizu, T., Hoffmann, A.A., Lee, S.F., 2010. Effects of small Hsp genes on developmental stability and micro-environmental canalization. BMC Evolutionary Biology 10, 284. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–1599. Taylor, R.P., Benjamin, I.J., 2005. Small heat shock proteins: a new classification scheme in mammals. Journal of Molecular and Cellular Cardiology 38, 433–444. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24, 4876–4882. Tiwari, P.K., Mohan, D.R.K., Archana, J., 1995. Developmental study of thermotolerance and the heat shock response in Lucilia cuprina (Weidemann). Journal of Bioscience 20, 341–354. Tomanek, L., Somero, G.N., 1999. Evolutionary and acclimation-induced variation in the heat-shock responses of congeneric marine snails (genus Tegula) from different thermal habitats: implications for limits of thermotolerance and biogeography. Journal of Experimental Biology 202, 2925–2936. Tsvetkova, N.M., Horvath, I., Torok, Z., Wolkers, W.F., Balogi, Z., Shigapova, N., Crowe, L.M., Tablin, F., Vierling, E., Crowe, J.H., Vigh, L., 2002. Small heat-shock proteins regulate membrane lipidpolymorphism. Proceedings of the National Academy of Sciences United States of America 99, 13504–13509. Waters, E.R., Vierling, E., 1999. Chloroplast small heat shock proteins: Evidence for atypical evolution of an organelle-localized protein. Proceedings of the National Academy of Sciences United States of America 96, 14394–14399. Wieske, M., Benndorf, R., Behlke, J., Dolling, R., Grelle, G., Bielka, H., Lutsch, G., 2001. Defined sequence segments of the small heat shock proteins HSP25 and aBcrystallin inhibit actin polymerization. European Journal of Biochemistry 268, 2083–2090. Wood, K.L., Voss, O.H., Huang, Q., Parihar, A., Mehta, N., Batra, S., Doseff, A.I., 2010. The small heat shock protein 27 is a key regulator of CD8+CD57+ lymphocyte survival. The Journal of Immunology 184, 5582–5588. Yocum, G.D., Joplin, K.H., Denlinger, D.L., 1998. Upregulation of a 23 kDa small heat shock protein transcript diapause in the flesh fly, Sarcophaga crassipalpis. Insect Biochemistry and Molecular Biology 28, 677–682.
Contents lists available at ScienceDirect
Journal of Insect Physiology journal homepage: www.elsevier.com/locate/jinsphys
Cloning and expression analysis of six small heat shock protein genes in the common cutworm, Spodoptera litura Ying Shen a,b, Jun Gu a, Li-Hua Huang a,*, Si-Chun Zheng a, Lin Liu a, Wei-Hua Xu c, Qi-Li Feng a, Le Kang b,** a
Guangdong Provincial Key Lab of Biotechnology for Plant Development, School of Life Sciences, South China Normal University, Guangzhou, Guangdong 510631, China State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China c State Key Laboratory of Biocontrol and School of Life Sciences, Sun Yat-Sen University, Guangzhou, China b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 21 January 2011 Received in revised form 25 March 2011 Accepted 31 March 2011
Small heat shock proteins (sHsps) are probably the most diverse in structure and function among the various superfamilies of stress proteins. To explore the diverse functions of insect sHsps, six sHsp cDNAs were cloned from the midgut cDNA library of Spodoptera litura, and a phylogenetic tree was constructed based on the conserved a-crystalline domains. The expression patterns in different developmental stages and tissues, as well as in response to both thermal and 20-hydroxyecdysone (20E) induction, were studied by real-time quantitative PCR. Based on sequence characteristics and phylogenetic relationships, the six SlHsps were classified into three independent groups: BmHsp20.4 like proteins (SlHsp19.7, 20.4, 20.7, 20.8), BmHsp26.6 like protein (SlHsp20), and BmHsp21.4 like protein (SlHsp21.4). All the SlHsps showed highest expression in the Malpighian tubules. The four BmHsp20.4 like protein genes were upregulated by thermal stress and showed expression variation with development. SlHsp20 exhibited lower expression levels in both egg and larval stages than in pupal and adult stages. SlHsp21.4 retained a constant expression level during all life stages. The expression of both SlHsp20.4 and SlHsp20.8 was significantly up-regulated by 20E. These results indicate that sHsps play diverse functions in S. litura: the BmHsp20.4 like proteins are involved in both thermal adaptation and development; SlHsp20 does not respond to temperature stress but possibly plays a role in metamorphosis; SlHsp21.4 may have no direct relationship with either thermal response or development. ß 2011 Elsevier Ltd. All rights reserved.
Keywords: Small heat shock protein Thermal stress Metamorphosis 20-Hydroxyecdysone Real-time quantitative PCR Spodoptera litura
1. Introduction Small heat shock proteins (sHsps) are a superfamily of proteins that contain an a-crystalline domain with molecular weights of 12–43 kDa depending on the variable N- and C-terminal extensions. Most sHsps display chaperone-like activity, helping the unfolding proteins to maintain their correct states (MacRae, 2000; Taylor and Benjamin, 2005). sHsps are probably the most diverse in structure and function among the various superfamilies of stress proteins (Franck et al., 2004). Ten sHsps (HspB1-B10) have been identified from the human genome (Kappe´ et al., 2003), and their orthologs have also been found in many other vertebrates (Franck et al., 2004). Plant sHsps were found to localize in different compartments of the cell, such as cytosol, endoplasmic reticulum, mitochondria and chloroplast (Waters and Vierling, 1999). Recently, 16 sHsps were identified in Bombyx mori based on newly assembled genome sequences (Li et al., 2009). Phylogenetic analysis showed that only one ortholog (B. mori
* Corresponding author. Tel.: +86 20 85210024; fax: +86 20 85215291. ** Corresponding author. Tel.: +86 10 64807219; fax: +86 10 64807099. E-mail addresses: [email protected] (L.-H. Huang), [email protected] (L. Kang). 0022-1910/$ – see front matter ß 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.jinsphys.2011.03.026
Hsp21.4 like protein) exists in insect sHsps, and the others have evolved independently among different insect orders (Sakano et al., 2006; Huang et al., 2008; Li et al., 2009). Complex evolution of sHsps results in great diversity of their functions. sHsps have been implicated to be involved in many physiological processes, such as cellular stress resistance (Landry et al., 1989), actin and intermediate filament dynamics (Wieske et al., 2001; Quinlan, 2002), membrane fluidity (Tsvetkova et al., 2002), life span (Wood et al., 2010) and various diseases (Mackay et al., 2003; Selcen and Engel, 2003; Evgrafov et al., 2004). Knowledgment of insect sHsps is much less than of sHsps in plants and vertebrates. Earlier research implied that sHsps may also play various roles in insects. For instance, they were suggested to contribute to thermal resistance (Qin et al., 2005; Huang et al., 2009), and may therefore extend the geographical distribution of some invasive species (Huang and Kang, 2007). Diapause is a mechanism of adaptation to disadvantageous temperature. The expression patterns of sHsps change when insects enter into diapause (Yocum et al., 1998; Hayward et al., 2005; Gkouvitsas et al., 2008). This suggests that sHsps may play important roles in insect diapause. Later study showed that the expression of some sHsps is related to development (Sonoda et al., 2006; Huang et al., 2009). Some sHsps, such as Hsp27 in Drosophila melanogaster (Huet
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
et al., 1996) and C. capitata (Kokolakis et al., 2008) are up-regulated by 20-hydroxyecdysone (20E) through a canonic ecdysone response element (EcRE) located in the promoter region. These results indicate that in addition to thermal responses, sHsps may be involved in developmental events in insects. sHsps have diverged greatly in insects during their evolution. There are 16 sHsps found in the genome of B. mori (Li et al., 2009). Similarly, more than 10 sHsps are identified in the genomes of D. melanogaster, Tribolium castaneum, Apis mellifera and Nasonia vitripennis, whose genomes have been completely sequenced. In this study, to explore the diversity of structure and functions of sHsps in the polyphagous vegetable pest, the common cutworm Spodoptera litura (Lepidoptera: Noctuidae), six sHsp cDNAs were cloned and their temporal and spatial expression profiles were analyzed. Their responses to treatment of both thermal stress and 20E stimulus were also monitored.
909
Table 1 Primer sequences used in the real-time quantitative PCR. Gene
Primer sequence (50 ! 30 )
Fragment length (bp)
hsp19.7
GATGGGGCTAACACCTGAAGAT TGTCTCTGTCCGACTTGATGCT ACATTGGACCCAGAATCATCG CAGGTTGCCGTCACTCGTTA CGTGGAGTCTCGCCTGTCTT GTGTTGTTGCTCTGGTCCTTTAT CCATCATCGCTGTTCCTCAA CCTGCCTTTCCTCGTGCTTA CCAGCATCAAGAGCGACAAG CCACCACAATAAAGCCGTCA ATGAGGAAGATGGAAGAAGAAAT CTGTGCTGTGACGATGTGGT ACTGTTGATGGACCCTCTGGAA ACAGGAACACGGAAAGCCATAC
134
hsp20 hsp20.4 hsp20.7 hsp20.8 hsp21.4 gapdh
242 144 210 105 110 152
2. Materials and methods 2.1. Experimental insects and cells S. litura and its embryonic cell line (Spli-221) were provided by the Entomology Institute of SUN YAT-SEN University, Guangzhou, China. Insects were reared in laboratory conditions as described by Guo et al. (2009) and Liu et al. (2010). The Spli-221 cell line was cultured at 27 8C in Grace’s insect medium (Invitrogen Co., Guangzhou, China) containing 10% fetal bovine serum. Cells were passaged every 4 days using a 1:4 dilution of cells. 2.2. Sample preparation Sixth instar larvae were dissected on ice, and various tissues, such as midgut, fatbody, epidermis, Malpighian tubules and haemolymph were isolated and stored at 70 8C. Eggs, 3rd instar larvae, 6th instar larvae, pre-pupae, pupae and adults were collected separately for RNA extraction when they were midinstar. For temperature treatment, 6th instar larvae were kept at 0, 26 or 40 8C for 1 h, and then recovered at 26 8C for 1 h. The treated samples were frozen immediately in liquid nitrogen. Each treatment included more than three individual larvae and was repeated three times. The Spli-221 cells were seeded into a six-well plate containing 500 mL Grace’s medium and kept at 26 8C until the cells reached about 90% confluence. The cells were treated with 0.4 mM 20E (dissolved in dimethyl sulfoxide, DMSO) for 3 h before harvest for RNA analysis. The corresponding amount of DMSO was added into the cell medium as a control. 2.3. Sequence alignment and secondary structure prediction
amino acids) of the selected sHsps were aligned using Cluster X with a Gonnet 250 matrix. The phylogenetic analysis was performed with MEGA version 4.0 (Tamura et al., 2007). The trees were constructed using both neighbor-joining (NJ) and maximum parsimony (MP) methods. The sites containing missing data or alignment gaps were removed in a complete deletion fashion and 1000 bootstrap replications were used to test the topology in all cases. Percentage bootstrap values were reported on each cluster. For the NJ tree, the P-distance model was selected because it was thought to give better results than more complicated distance when the number of sequences is large and the number of positions used is relatively small (Nei and Kumar, 2000). 2.5. Real-time quantitative PCR Total RNA was extracted using the RNAprep pure tissue kit (Tiangen Biotech, Beijing, China) combined with On-Column DNase digestion to eliminate DNA contamination, then 1 mg RNAs were used to generate cDNAs. Real time PCR reactions were performed in a 20 mL total reaction volume including 10 mL of 2 SYBR1 Premix EX TaqTM (TaKaRa, Dalian, China) master mix, 5 mM each of gene specific primers (Table 1) and the cDNA templates. The annealing temperature was 58 8C. The reactions were carried out on an ABI7300 real-time PCR system (Applied Biosystems, Foster City, CA). DD The quantity of each sHsp mRNA was calculated with the 2 Ct method (Livak and Schmittgen, 2001), and normalized to the abundance of a house-keeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, accession no. HQ012003). The relative mRNA levels of each gene were represented as folds over the expression levels of gapdh.
The plasmids containing the sHsp ESTs were selected from the cDNA expression library of S. litura midgut and sequenced using an ABI 3730 DNA analyzer. The open reading frames (ORFs) were identified with the aid of the ORF Finder software (http:// www.ncbi.nlm.nih.gov/gorf/gorf.html). The deduced amino acid sequences were aligned using Cluster X software (Thompson et al., 1997), and the sequence similarity was calculated according to the observed divergence. Secondary structure predictions were performed with the PHD software accessed via the NPS@Web server (http://npsa-pbil.ibcp.fr [Combet et al., 2000]).
2.6. Statistical analysis Statistical significance of differences between treatments was analyzed either by t-test (for comparison of two means) or by oneway analysis of variance (ANOVA; Systat, Inc, Evanston, IL) followed by a LSD test for multiple comparisons. For the ANOVA, mRNA expression levels were log-transformed by the method of Tomanek and Somero (1999) to assure homogeneity of variances among different groups. The data were analyzed using SPSS 16.0 software and denoted as means SE (standard error).
2.4. Phylogenetic analysis
3. Results
The deduced amino acid sequences of SlHsps were used as queries to search for other lepidopteran sHsps in GenBank by BlastP program available at the NCBI website (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The conserved a-crystalline domains (about 80
3.1. Cloning and characterization of six SlHsps Six SlHsp cDNAs, namely SlHsp19.5, 20, 20.4, 20.7, 20.8 and 21.4 (GenBank accession nos. HM046617, HM046616, HM046615,
910
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
HM046614, HM046613 and HM046612, respectively) were cloned from the cDNA expression library of S. litura midgut. The ORFs were 528, 566, 549, 531, 570 and 564 bp, respectively in length. Their deduced amino acid sequences contained a typical a-crystalline
domain, which consists of seven b-strands. Another b-strand and a-helix were found only in the N-terminal of SlHsp20 and SlHsp21.4, but they were arranged in a different order (Fig. 1). Therefore, based on the secondary structure of N-terminal, the six
Fig. 1. Alignment of the deduced amino acid sequences of six SlHsps. The conserved a-crystallin domain is underlined. The amino acids with over 50% identity are shaded in gray. Secondary structure elements are predicted for individual sequences and are shown as cylinders (a-helices) and arrows (b-strands) below the alignment.
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
911
Table 2 Lepidoptera sHsps collected from GenBank and the genome of Bombyx mori. No.
Species
Name
Accession no.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 39 30 31 32 33 34 35 36 37 38 39
Bombyx mori
BmHsp15.7 BmHsp19.1 BmHsp19.5 BmHsp19.9 BmHsp20.1 BmHsp20.2 BmHsp20.4 BmHsp20.8 BmHsp21.4 BmHsp21.6 BmHsp22.6 BmHsp23.8 BmHsp24.2 BmHsp26.6 BmHsp27.4 BmHsp42.3 SlHsp19.7 SlHsp20 SlHsp20.4 SlHsp20.7 SlHsp20.8 SlHsp21.4 CfHsp19.9 CfHsp21.5 CfHsp33.6 LoHsp1 LoHsp2 LoHsp3 MbHsp19.7 MbHsp20.7 SnHsp19.5 SnHsp20.8 CsHsp19.7 AsHsp HeHsp21.4 GmHsp PiHsp25 PxHsp19.5 EcIbpA
Bmb030089 BGIBMGA004606-TA BGIBMGA013545-TA BGIBMGA004540-TA Bmb016799 BGIBMGA005784-TA BGIBMGA004541-TA BGIBMGA004605-TA BGIBMGA000944-TA BGIBMGA004630-TA BGIBMGA004103-TA BGIBMGA004515-TA BGIBMGA005780-TA BGIBMGA005755-TA BGIBMGA005823-TA BGIBMGA004101-TA HM046617 HM046616 HM046615 HM046614 HM046613 HM046612 AAZ14791 AAZ14790 AAZ14793 AAV91360 AAV91361 AAV91362 BAF03558 BAF03557 ACD01216 ABC68342 BAE94664 ADI48314 ABS57447 AAN15790 AAC36146 BAE48744 YP_001460484
Spodoptera litura
Choristoneura fumiferana
Lonomia obliqua
Mamestra brassicae Sesamia nonagrioides Chilo suppressalis Actias selene Heliconius erato Galleria mellonella Plodia interpunctella Plutella xylostella Escherichia coli
SlHsps were classed into three groups: No a-helix (SlHsp19.7, 20.4, 20.7 and 20.8), one a-helix followed by a b-strand (SlHsp20), and one b-strand followed by an a-helix (SlHsp21.4) .The sequence similarities were very high (>63%) among SlHsp19.7, 20.4, 20.7 and 20.8. However, the similarities were much lower (<30%) for the other two SlHsps (SlHsp20 and 21.4) (Supplementary material, Fig. S1). The low sequence similarities of sHsps in the same species indicate that their functions may have diverged correspondingly. To analyze the relationships of S. litura sHsps to other insect sHsps, 38 lepidopteron sHsps (Table 2), including the 16 B. mori sHsps, were collected by Blast P in both GenBank and the silkworm genome database (http://silkworm.swu.edu.cn/silkdb/). Based on the alignment of a-crystalline domain (Supplementary material, Fig. S2), the NJ (Fig. 2) and MP (Supplementary material, Fig. S3) trees were constructed. Both trees showed that the lepidopteron sHsps formed at least five groups and each B. mori ortholog is BmHsp20.4, BmHsp22.6, BmHsp22.4, BmHsp27.4 and BmHsp26.6, respectively. The SlHsps were clustered into three groups. The four SlHsps (Hsp19.7, 20.4, 20.7 and 20.8) with high sequence similarity to each other belonged to the group of BmHsp20.4 like protein, and SlHsp20 and SlHsp21.4 were grouped as BmHsp26.6 and BmHsp21.4 like proteins, respectively.
Fig. 2. Phylogenetic tree of the lepidopteran sHsps. A total of 38 lepidopteran sHsps and an Escherichia coli sHsp, IbPA were selected to construct the phylogenetic tree, and the E. coli IbpA was used as the out-group. Only the conserved a-crystalline domains (about 80 amino acids) were aligned and used for the tree construction using the neighbor-joining (NJ) method. Percentage bootstrap values above 50% were indicated on each cluster, and values below 50% were omitted. The S. litura sHsps are labeled with asterisks. The GenBank accession numbers and abbreviation for the species names are listed in Table 2.
SlHsp20.8 in the Malpighian tubules was 2.8-fold (compared with the level of gapdh), which was much higher than in the epidermis (0.06-fold). Besides, SlHsp20.8 was expressed highly in many other tissues, such as haemolymph (1.1-fold), midgut (0.75-fold) and fatbody (0.5-fold). However, the other SlHsps were maintained at low mRNA levels (<0.4-fold) in most tissues except for the Malpighian tubules, and levels of SlHsp19.7, 20.7, 20.8 and 21.4 were especially low (<0.05-fold) in the epidermis (Fig. 3). 3.3. Expression of SlHsps in response to thermal stress
3.2. Expression of SlHsps in various tissues The expression patterns of SlHsps were significantly different among various tissues. All six SlHsps exhibited highest expression levels in the Malpighian tubules. For example, the mRNA level of
Responses of six SlHsps to thermal stress were quite different. SlHsp20.4 and SlHsp20.8 were significantly up-regulated by both heat and cold, with an intensive response to heat, and their mRNA expression levels increased by 67- and 21-fold, respectively, after
912
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
Fig. 3. Relative mRNA expression levels of the six SlHsps in different tissues. The relative expression levels of the SlHsps are represented as the fold difference from gapdh expression. Different letters on the tops of the columns indicate significance in the difference of expression levels by ANOVA analysis. Abbreviation: Mg, midgut; Fb, fatbody; Ep, epidermis; Mt, Malpighian tubules; Ha, haemolymph.
Fig. 6. Relative mRNA expression levels of the six SlHsps in response to 20hydroxyecdysone (20E) induction. The corresponding amount of DMSO was used as a control. The asterisks on the tops of the columns indicate significance in the difference of expression levels by t-test analysis.
SlHsp20 exhibited lower expression levels in both eggs and larvae rather than in pupae and adults. 3.5. Regulation of the expression of the SlHsps by 20E 20E was added into the cell medium to test whether ecdysone regulates the expression of the SlHsps. The results showed that both SlHsp20.4 and SlHsp20.8 were significantly up-regulated by 20E (tHsp20.4 = 3.61, P = 0.02; tHsp20.8 = 5.77, P = 0.004). However, this induced expression was not detected in the other SlHsps (Fig. 6). 4. Discussion Fig. 4. Relative mRNA expression levels of the six SlHsps in response to the thermal stress.
heat shock treatment (40 8C for 1 h). SlHsp19.7 and SlHsp20.7 were significantly induced by heat, whereas they showed no induction by cold. SlHsp20 and SlHsp21.4 did not respond to either heat or cold stresses (Fig. 4). 3.4. Expression of SlHsps at different developmental stages While SlHsp21.4 remained at a constant expression level in all developmental stages, other SlHsps exhibited diverse expression profiles with development (Fig. 5). SlHsp19.7, 20.4, 20.7 and 20.8 showed irregular expression variation with development, whereas
Fig. 5. Relative mRNA expression levels of the six SlHsps in different developmental stages. Abbreviation: 3L, the 3rd instar larvae; 6L, the 6th instar larvae; PP, prepupae; P, pupae; Ad, Adult.
Small Hsps have been reported to play critical roles in thermal adaptations of insects (Gehring and Wehner, 1995; Huang and Kang, 2007; Huang et al., 2009). In the present study, SlHsp20.4 and SlHsp20.8 were significantly up-regulated by both heat and cold treatments. This characteristic is the same as most previously reported responses of sHsps. However, SlHsp19.7 and SlHsp20.7 responded only to heat treatment but not to cold stress (Fig. 4). This suggests that these two sHsps may have a different mechanism of thermal adaptation from the other SlHsps. This deviation suggests that the mechanisms of heat and cold adaptation may be different and can function separately. This is consistent with our early finding that cross-resistance may not exist between heat and cold adaptations of insects (Huang et al., 2007). In addition, SlHsp20 and SlHsp21.4 were insensitive to any thermal stress (Fig. 4). It seems that the thermal adaptation of insects is accurately controlled by regulating the expression of different sHsps. sHsps play important roles in insect development. They are involved in regulation of development in D. melanogaster (Takahashi et al., 2010). Many sHsps show regular expression during development. Plutella xylostella Hsp19.7 (Sonoda et al., 2006) and three Liriomyza sativa sHsps (Huang et al., 2009) are expressed at lower levels in both larvae and adults, but reach a peak in the pupal stage. In this study SlHsp20.4 and SlHsp20.8 had similar expression patterns. SlHsp19.7 and SlHsp20.7 also showed lower expression in the larval stage, but they were significantly upregulated in the adult stage. SlHsp20 maintained a lower expression level in both eggs and larvae, whereas it was remarkably up-regulated after the larval-pupal transformation (Fig. 5), suggesting that SlHsp20 may be involved in metamorphosis. While the above SlHsp showed stage-related expression patterns, SlHsp21.4 exhibited a constitutive expression pattern during all developmental stages (Fig. 5). Hsp21.4 is probably the
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
only ortholog of lepidopteran sHsp (Sakano et al., 2006; Huang et al., 2008; Li et al., 2009). Drosophila Hsp21.4 (NM_167669) is located in the X chromosome, whereas all the other sHsps are found on autosomes. The A. mellifera Hsp21.4 (XM_392405) has a stable expression level during the life span of workers, however, higher expression levels were found in queens (Aamodt, 2008). This indicates that Hsp21.4 may be related to the sex-associated functions. It has been suggested that there is a functional connection between hormones (such as ecdysone) and heat shock regulatory systems (Lezzi, 1996). In Drosophila, the steroid 20E was found to up-regulate mRNA levels of Hsp27, and the ecdysone response element (EcRE) was identified in the promoter region of the gene (Antoniewski et al., 1993). The metamorphosis-related transcription factor - Broad-Complex (BR-C) was also found to bind to the promoter region of Drosophila Hsp23 (Dubrovsky et al., 2001). These findings provide a more direct proof for the connection between ecdysone and sHsps. No study has reported the regulation of sHsps by ecdysone through its response element in lepidopteran insects. In the present study, two SlHsps (SlHsp20.4 and SlHsp20.8) were significantly induced by 20E, whereas the others were not (Fig. 6). It is not clear whether these two genes are regulated by 20E directly acting on their promoters or if they are regulated by 20E through other indirect mechanisms. The expression of insect Hsps shows obvious tissue specificity. In B. mori, Hsp20.4 is selectively expressed in the midgut and ovary, Hsp40 in the head, Hsp70 in the cuticle, and Hsp90 in the ovary and head at low temperatures (Saravanakumar et al., 2008). In the present study, SlHsp19.7, 20.7, 20.8 and 21.4 showed very low mRNA levels in epidermis, however, all six SlHsps exhibited the highest mRNA levels in the Malpighian tubules (Fig. 3). Synthesis of Hsp60 were strikingly high in the Malpighian tubules of both grasshoppers and cockroaches (Singh and Lakhotia, 2000). Similar situations were found in many other species, such as Chironomus striatipennis (Nath and Lakhotia, 1989) and Lucilia cuprina (Tiwari et al., 1995). The Malpighian tubules are important excretory organs and accumulate concentrated inorganic ions and poisonous metabolites. It remains to be clarified why sHsps are highly expressed in the Malpighian tubules. One of explanations is that sHsps may be involved in the catabolism of the toxic metabolites or re-absorption of water in the Malpighian tubules. sHsps are the most diverse in structure and function among the various stress protein families (Franck et al., 2004). Except for the conserved a-crystalline domain located in the C- terminal, their Nterminal is high-variable. This region of sHsps is important for both chaperone activity and substrate specificity (Basha et al., 2006). Based on the secondary structure of the N-terminal, SlHsp19.7, 20.4, 20.7 and 20.8 were classified as a single group, however, SlHsp20 and SlHsp21.4 were classified into two groups, respectively (Fig. 1). The above analysis showed that the BmHsp20.4 like proteins (SlHsp19.7, 20.4, 20.7 and 20.8), SlHsp20 and SlHsp21.4 had distinct expression profiles in response to different stimulus. Probably, this expression or function diversity of SlHsps is related to their specific N-terminal structures. In conclusion, the six S. litura sHsps can be classified into three groups: BmHsp20.4 like proteins (SlHsp19.7, 20.4, 20.7, 20.8), BmHsp26.6 like protein (SlHsp20), and BmHsp21.4 like protein (SlHsp21.4) according to their sequence characteristics and expression patterns. This indicates that S. litura sHsps may play diverse functions: the BmHsp20.4 like proteins are involved in both thermal adaptation and development; SlHsp20 does not respond to thermal stress, but may be involved in metamorphosis; SlHsp21.4 may not be directly involved in either thermal response or developmental events. Further investigation on identifying other sHsp members and exploring their functions in S. litura is ongoing.
913
Acknowledgements The research was supported by the grants from the National Natural Science Foundation of China (Grant No. 30900152), the State Key Laboratory of Integrated Management of Pest Insects and Rodents (No. ChineseIPM0902) and the Natural Science Foundation of Guangdong Province (No. 9451063101002022).
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jinsphys.2011.03.026. References Aamodt, R.M., 2008. The caste- and age-specific expression signature of honeybee heat shock genes shows an alternative splicing-dependent regulation of Hsp90. Mechanisms of Ageing and Development 129, 632–637. Antoniewski, C., Laval, M., Lepesant, J.A., 1993. Structural features critical to the activity of an ecdysone receptor binding site. Insect Biochemistry and Molecular Biology 23, 105–114. Basha, E., Friedrich, K.L., Vierling, E., 2006. The N-terminal arm of small heat shock proteins is important for both chaperone activity and substrate specificity. Journal of Biological Chemistry 281, 39943–39952. Combet, C., Blanchet, C., Geourjon, C., Dele´age, G., 2000. NPS@:Network protein sequence analysis. Trends in Biochemical Sciences 291, 147–150. Dubrovsky, E.B., Dubrovskaya, V.A., Berger, E.M., 2001. Selective binding of Drosophila BR-C isoforms to a distal regulatory element in the hsp23 promoter. Insect Biochemistry and Molecular Biology 3, 1231–1239. Evgrafov, O.V., Mersiyanova, I., Irobi, J., Van Den Bosch, L., Dierick, I., Leung, C.L., Schagina, O., Verpoorten, N., Van Impe, K., Fedotov, V., Dadali, E., Auer-Grumbach, M., Windpassinger, C., Wagner, K., Mitrovic, Z., Hilton-Jones, D., Talbot, K., Martin, J.J., Vasserman, N., Tverskaya, S., Polyakov, A., Liem, R.K., Gettemans, J., Robberecht, W., De Jonghe, P., Timmerman, V., 2004. Mutant small heat-shock protein 27 causes axonal Charcot–Marie-Tooth disease and distal hereditary motor neuropathy. Nature Genetics 36, 602–606. Franck, E., Madsen, O., Rheede, T.V., Ricard, G., Huynen, M.A., de Jong, W.W., 2004. Evolutionary diversity of vertebrate small heat shock proteins. Journal of Molecular Evolution 59, 792–805. Gehring, W.J., Wehner, R., 1995. Heat shock protein synthesis and thermotolerance in Cataglyphis, an ant from the Sahara desert. Proceedings of the National Academy of Sciences of the United States of America 92, 2994–2998. Gkouvitsas, T., Kontogiannatos, D., Kourti, A., 2008. Differential expression of two small Hsps during diapause in the corn stalk borer Sesamia nonagrioides (Lef.). Journal of Insect Physiology 54, 1503–1510. Guo, X.R., Zheng, S.C., Liu, L., Feng, Q.L., 2009. The sterol carrier protein 2/3-oxoacylCoA thiolase (SCPx) is involved in cholesterol uptake in the midgut of Spodoptera litura: gene cloning, expression, localization and functional analyses. BMC Molecular Biology 10, 102. Hayward, S.A.L., Pavlidesb, S.C., Tammariellob, S.P., Rineharta, J.P., Denlinger, D.L., 2005. Temporal expression patterns of diapause-associated genes in flesh fly pupae from the onset of diapause through post-diapause quiescence. Journal of Insect Physiology 51, 631–640. Huang, L.H., Chen, B., Kang, L., 2007. Impact of mild temperature hardening on thermotolerance, fecundity, and Hsp gene expression in Liriomyza huidobrensis. Journal of Insect Physiology 53, 1199–1205. Huang, L.H, Kang, L., 2007. Cloning and inter-specific altered expression of heat shock protein genes in two leafminer species in response to thermal stress. Insect Molecular Biology 16, 491–500. Huang, L.H., Wang, C.Z., Kang, L., 2009. Cloning and expression of five heat shock protein genes in relation to cold hardening and development in the leafminer, Liriomyza sativa. Journal of Insect Physiology 55, 279–285. Huang, L.H., Wang, H.S., Kang, L., 2008. Different evolutionary lineages of large and small heat shock proteins in Eukaryota. Cell Research 18, 1074–1076. Huet, F., Lage, J.D., Ruiz, C., Richards, G., 1996. The role of ecdysone in the induction and maintenance of hsp27 transcripts during larval and prepupal development of Drosophila. Development Genes and Evolution 206, 326–332. Kappe´, G., Franck, E., Verschuure, P., Boelens, W.C., Leunissen, J.A., de Jong, W.W., 2003. The human genome encodes 10 a-crystalline-related small heat shock proteins: HspB1-10. Cell Stress Chaperones 8, 53–61. Kokolakis, G., Tatari, M., Zacharopoulou, A., Mintzas, A.C., 2008. The hsp27 gene of the Mediterranean fruit fly, Ceratitis capitata: structural characterization, regulation and developmental expression. Insect Molecular Biology 17, 699–710. Landry, J., Chretien, P., Lambert, H., Hickey, E., Weber, L.A., 1989. Heat shock resistance conferred by expression of the human HSP27 gene in rodent cells. Cell Biology 109, 7–15. Lezzi, M., 1996. Chromosome puffing: supramolecular aspects of ecdysone action. In: Gilbert, L.I., Tata, J.R., Atkinson, B.G. (Eds.), Metamorphosis: Post-Embryonic Reprogramming of Gene Expression in Amphibian and Insect Cells. Academic Press, New York, pp. 145–173.
914
Y. Shen et al. / Journal of Insect Physiology 57 (2011) 908–914
Li, Z.W., Li, X., Yu, Q.Y., Xiang, Z.H., Kishino, H., Zhang, Z., 2009. The small heat shock protein (sHSP) genes in the silkworm, Bombyx mori, and comparative analysis with other insect sHSP genes. BMC Evolutionary Biology 9, 215. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Liu, J.C., Zheng, S.C., Liu, L., Feng, Q.L., 2010. Protein profiles of the midgut of Spodoptera litura larvae at the sixth instar feeding stage by shotgun ESI-MS approach. Journal of Proteome Research 9, 2117–2147. Mackay, D.S., Andley, U.P., Shiels, A., 2003. Cell death triggered by a novel mutation in the a-crystallin gene underlies autosomal dominant cataract linked to chromosome 21q. European Journal of Human Genetics 11, 784–793. MacRae, T.H., 2000. Structure and function of small heat shock/a-crystallin proteins: established concepts and emerging ideas. Cellular and Molecular Life Sciences 57, 899–913. Nath, B.B., Lakhotia, S.C., 1989. Heat shock response in a tropical Chironomus: seasonal variation in response and the effect of developmental stage and tissue type on heat shock protein synthesis. Genome 32, 676–686. Nei, M., Kumar, S., 2000. Molecular Evolution and Phylogenetics. Oxford University Press, Oxford, England. Qin, W., Neal, S.J., Robertson, R.M., Westwood, J.T., Walker, V.K., 2005. Cold hardening and transcriptional change in Drosophila melanogaster. Insect Molecular Biology 14, 607–613. Quinlan, R., 2002. Cytoskeletal competence requires protein chaperones. Progress in Molecular and Subcellular Biology 28, 219–234. Sakano, D., Li, B., Xia, Q., Yamamoto, K., Banno, Y., Fujii, H., Aso, Y., 2006. Genes encoding small heat shock proteins of the silkworm, Bombyx mori. Bioscience, Biotechnology, and Biochemistry 70, 2443–2450. Saravanakumar, R., Ponnuvel, K.M., Hussaini Qadri, S.M., 2008. Expression of metabolic enzyme genes and heat-shock protein genes during embryonic development in diapause and non-diapause egg of multivoltine silkworm Bombyx mori. Biologia 63, 737–744. Selcen, D., Engel, A.G., 2003. Myofibrillar myopathy caused by novel dominant negative alpha B-crystallin mutations. Annals of Neurology 54, 804–810. Singh, A.K., Lakhotia, S.C., 2000. Tissue-specific variations in the induction of Hsp70 and Hsp64 by heat shock in insects. Cell Stress and Chaperones 5, 90–97. Sonoda, S., Ashfaq, M., Tsumuki, H., 2006. Cloning and nucleotide sequencing of three heat shock protein genes (hsp90, hsc70, and hsp19.5) from the diamond-
back moth, Plutella xylostella (L.) and their expression in relation to developmental stage and temperature. Archives of Insect Biochemistry and Physiology 62, 80–90. Takahashi, K.H., Rako, L., Takano-Shimizu, T., Hoffmann, A.A., Lee, S.F., 2010. Effects of small Hsp genes on developmental stability and micro-environmental canalization. BMC Evolutionary Biology 10, 284. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–1599. Taylor, R.P., Benjamin, I.J., 2005. Small heat shock proteins: a new classification scheme in mammals. Journal of Molecular and Cellular Cardiology 38, 433–444. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24, 4876–4882. Tiwari, P.K., Mohan, D.R.K., Archana, J., 1995. Developmental study of thermotolerance and the heat shock response in Lucilia cuprina (Weidemann). Journal of Bioscience 20, 341–354. Tomanek, L., Somero, G.N., 1999. Evolutionary and acclimation-induced variation in the heat-shock responses of congeneric marine snails (genus Tegula) from different thermal habitats: implications for limits of thermotolerance and biogeography. Journal of Experimental Biology 202, 2925–2936. Tsvetkova, N.M., Horvath, I., Torok, Z., Wolkers, W.F., Balogi, Z., Shigapova, N., Crowe, L.M., Tablin, F., Vierling, E., Crowe, J.H., Vigh, L., 2002. Small heat-shock proteins regulate membrane lipidpolymorphism. Proceedings of the National Academy of Sciences United States of America 99, 13504–13509. Waters, E.R., Vierling, E., 1999. Chloroplast small heat shock proteins: Evidence for atypical evolution of an organelle-localized protein. Proceedings of the National Academy of Sciences United States of America 96, 14394–14399. Wieske, M., Benndorf, R., Behlke, J., Dolling, R., Grelle, G., Bielka, H., Lutsch, G., 2001. Defined sequence segments of the small heat shock proteins HSP25 and aBcrystallin inhibit actin polymerization. European Journal of Biochemistry 268, 2083–2090. Wood, K.L., Voss, O.H., Huang, Q., Parihar, A., Mehta, N., Batra, S., Doseff, A.I., 2010. The small heat shock protein 27 is a key regulator of CD8+CD57+ lymphocyte survival. The Journal of Immunology 184, 5582–5588. Yocum, G.D., Joplin, K.H., Denlinger, D.L., 1998. Upregulation of a 23 kDa small heat shock protein transcript diapause in the flesh fly, Sarcophaga crassipalpis. Insect Biochemistry and Molecular Biology 28, 677–682.