- Email: [email protected]
Cloning and Sequence Analysis of the estA gene encoding enzyme for producing (R)-β-acetylmercaptoisobutyric acid from Pseudomonas aeruginosa 1001
JOUIWAL OFBIOSCIENCE AND BIOENOINEEFUNCI Vol. 90, No. 6, 684-687. 2000
Cloning and Sequence Analysis of the estA Gene Encoding Enzyme for Producing (R)+Acetylmercaptoisobutyric Acid from Pseutiomonas aertq$nosa 1001 JE-HYUK LEE,’ GOKUL BOYAPATI,2 KI-BANG SONG,’ SANG-K1 RHEE,’ ANDCHUL-HO KIM’*
Applies’ Microbiology Research Division, Korea Research Institute of Bioscience and Biotechnology, Yusong, Taejon 305-600, Korea’ and Department of ChemicalEngineering,Indian Institute of Technology-Madras,IndiaZ Received 18 September 2OOO/Accepted27 September 2000
The t&A gene encoding the enzyme that catalyzes the production of (ZO-~lmtrcaptoisobutyric acid from (R,S)+stewfrom Pseu&nomw aeruginosa1001, was cloned ia Eschtrichfa coliaud its nudtotidt stqutnct was dtttrmined, reveal&g the lwwumtd optn reading frame twoding a polyptptide of 316 amiuo acid residues (948 nudeoUts). The overall A + T and C +G compositions wtrt 32.59% and 67.41%, resptctively. Tht amino acid stquenct of tht tsfA gent prod& showtd a dgnifhnt simikity with that of the triacylglwtrol Upase from Psychrobaeter bnmobU&(38% idtutity), trhcylglyctro1 lipast from Morawlla sp. (36% identity), and two forms of carboxyl tsterases from Acinetobacte cakoaceticus (17% and 17% identities). The dtductd amino add sequtncts have a pentaptptide constnsus sequence, G-X-S-X-G, having an tttivt stride residue, and another active site, diptptidts H-G, located at 70-100 amino adds upstream of the G-X-S-X-G consensus sequence. [I(es words: esterase gene, mercaptoisobutyric acid]
Pseudomonas ueruginosu, nucleotide sequence, G-X-S-X-G,
(R)+-acctyl-
formants was measured by estimating the amount of I&AMproduced from (R,S)ester using HPLC (CHIREX (R) NGL & DNB column, 250 x 4.6mm, Phenomenez Co., USA) with 20 mM ammonium acetate in methanol (1.0 ml/mm) as the mobile phase. An UV detector (254 nm) was used to identify the components. One of the clones, carrying pTBL7 (about 4.5 kb DNA insert), exhibited enzyme activity of producing I&AM from (R&Q-ester. From the results of subcloning, the estA gene was located within the NheI-NnrI DNA fragment of pTBL76 (about 1.1 kb). The length of pTBL76 was determined to be 1036 bp by nucleotide sequencing (ABI PRISM 377 autosequencer, Perkin-Elmer, USA). Only one open reading frame (ORF) was found in pTBL76 using the DNASIS program (MacDNASIS Pro V3.5, Hitachi Software Engineering Co. Ltd.) and Editseq program in the DNASTAB program package. The ORF had 948 bp nucleotides that encode 316 amino acids derived by computer analysis using the DNASTAR program (Madison, WI, USA). The estA gene had an A+T composition of 32.59% and C+G composition of 67.41%. The isoelectric point and the molecular weight were found to be pH 6.4 and 34,836 daltons, respectively. The molecular weight calculated from the deduced amino acid sequence (316 amino acids) was about 35 kDa, which is in good agreement with the value obtained by SDS-PAGE (data not shown). The NheI site was located at 42 bp upstream of the start codon, ATG, of OKF (the estA gene), and the NruI site was located at 46 bp downstream of the termination codon, TGA. The nucleotide sequence of ORF, the estA gene, and the corresponding deduced amino acid sequence are shown in Fig. 1. The nucleotide sequence (948 bp) of the gene encoding the enzyme that catalyzes BAM production from (R,s)ester has been deposited in the GenBank with the accession number AF170828.
(R)+Acetylmercaptoisobutyric acid (RAM) is an important intermediate for synthesis of various optically active compounds, particularly pharmaceuticals such as Captopril (1) and Alacepril (Sawayama, T. et al., Japanese patent, 63-18599, 1988) which are used for the treatment of hypertension and congestive heart failure. There were several reports on the development of novel processes for BAM production, for example, stereoselective hydrolysis of (R,S)+acetyhnercaptoisobutyrate [(R,s)-ester] and the enzymatic production process (2-4) using Pseudomonas putida, Pseudomonas jlourescence, and Agrobacterium radiobacter (5, 6). Earlier we reported the isolation of a new microorganism from soil with high enzyme activity (7). In this paper, we report the cloning of the gene encoding the enzyme involved in KAM production from (R,S)-ester, and analyzed the amino acid sequence of the gene product. This is the first report on the sequence analysis of the enzyme that catalyzes BAM production from (R,S)-ester. A loopful of RAM-producing strain, Pseudomonas aeruginosa 1001, was cultured at 37°C for 24 h using a medium described previously (7). The cells were harvested by centrifugation (12,000~ g) for 10 min. Chromosomal DNA of P. aeruginosa 1001 was isolated using a G-NOME isolation kit (Bio 101, La Jolla, CA, USA), and was then partially digested with Sau3A and ligated to BamHI-digested pBluescript@ IIKS+ vector. The inserted plasmids were transformed in Escherichia coli DHSlr. About 10,600 colonies of E. coli DHSa transformants were selected by adding ampicillin on the [LB] medium with X-gal (5bromo-4-chloro-3-indolyl-B_Dgalactopyranoside). For the screening of colonies carrying with the desired gene, they were transferred using a toothpick onto a plate with the [LB] medium containing tributyrin and (R,S)-ester. The enzyme activity of trans-
* Corresponding author. 684
VOL.
NOTES 685
90,2ooo GCCGACCACCGGCAGCAC
GCCTAGACTCGTCACAXGCTTGC
GACAGCGGGCCGGCACGG
13
CTAGCGTTCAGCGCTGGCCCCTTTTTTCCTGAAGCCTTC~ZACCCATGAAACGATTCC
4 73
SD HetLysArgPheL TCCTCGGTCTGGTTCTGCTGCTGGCGGTCGCCGCCGGCGTCCTCTACTTCGTCCCG~TA
24
euLeuGlyLeuVa1LeuLeuLeuALaValAl~aGlyValLeuTyrPheVa1ProA;LaT
133 CCCTCCTCGCCAGCGTACGCACCGTCGAGCGCGGCCTCGCCGGTCTCAGCGAGCACAGCG 44
hrLeuLeuATaSerValArgThrValGluArgG1yLe~aG1yLeuSerGluHloStrV
193 TGCAGGTCGACAACCTGGAGATCGCCTACCTGGAAGGCGGCTCGGMRAGMCCCGACCC 64
alGlnValAs~nLeuGluI1eAlaThrLtuGluGlyG1yStrGluLyslbnProThrL
253 TGTTGCTGATCCACGGCTTCGGCGCCGACAAGGACAACTGGCTGCGCTTCGCCCGGCCGC 04 euLtuLeuI1tHisG1yPhtGlyAlaAspLysAspAsnTrpLtuArgPhQAlaArgPtoL 313 TGACCGAGCGCTACCATGTGGTCGCCCTCGXCTGCCCGGCTTCGGCGACAG104 tuThrGluArgTyrHisValValAlaLtuAspLtuProGlyPheGly~pStrStrLysP 373 CGCAACAGGCCAGCTACGACGTCGGCACCCAGGCCGAGCGAGTCGCCAATTTCGCCGCCG 124 roGlnGlnAlaStrTyrA8pValG1yThrGlnAlaGluArgValAlaAsnPhtAlaAlaA 433 CCATCGGCGTGCGCCGCCTGCACCTGGCCGGCAACTCCATGGGCGGGCACATCGCCGCGC 144 laIltG1yValArgArgLtuIiisLtuAlaGlyAsnStr!4ttGlyGlyHisIleAlaAlaL 493 TCTACGCGGCGCGCCATCC GGMCAGGTGCTATCGCTGGCGCTGATCGACAACGCCGGGG 164 tuTyrAlaAlaArgHi6ProGluGlnVa1LtuStrLt~aLtuIleAspAsnAlaGlyV 553 184 613 204
TAATGCCGGCGC GCAAGAGCGAACTGTTCGAGGACCTGGAGCGCGGCGAGMTCCCCTGG a~etProAlaArgLysStrGluLtuPheGluAmpLtuGl~~lyGl~nProLtuV TGGTGCGCCAGCC GGAAGACTTCCAGAAGCTGCTCGACTTCGTGTTCGTCCAGCAACCGC alVaUrgGlnProCl~6pPhtGlnLy8LtuLe~~PhtValPhtValGlnGlnProP
673 CGCTGCCGGCGCCGCTCAAGCGCTACCTCGGCGAACGCGCGGTAGCCGCGTCGGCGTTCA 224 roLtuProAlaProLeuLy8ArgThrLtuG1yGluArgAlaValAlaAlaStrAlaPheA 733 244 793 264 853 284
ACGCGCAGATATTCGAACAAC TGCGCCAGCGCTACATCCCGCTGGAGCkGAACTGCCGA snAlaGlnIltPheGluGlnLt~gGlnArgTyrIltProLtuGluPr~l~tuProL AGATCGAGGCACCGACCCTGCTGCTATGGGGCGACCGCGACCGCGTGCTGGACGTCTCCA ysI1tGluAtaProThrLtuLtuLtuTrpGly~pArgAlpArgVal~uAapValStrS GCATCGAGGTGATGCGTCCGCTGCTGAAGCGGCCCAGCGTGGTGATCATGGAAAACTGCG trIleGluVa~etArgProLtuLtuLysArgProStrValValIlaWttGl~nCysG
913 GACACGTGCCGATGGTCGAACGCCCGGA GGAAACCGCGCAGCACTACCAGGCCTTCCTCG 304 lyHisValPr~etValG1uArgProGluGluThr~aGlnHiaTyrGl~aPheLe~ 973 ACGGTGTACGGMCGCCCAGGTGGCCGGTCGCT 316 spGlyValArgAsnAlaGlnValAlaG1yArg
GAMACGCGAACCGGCGCCTGGGCGCC *
GGTTCGGGGGAGCGGGAGCCGTCGCGAGGACGGCTCGGATACAGGCCTCAGGCCTGGATC FIG. 1. Nucleotide anddeduced amino acid sequences of ORF (the e&A gene) ofP.ueruginasu1001. Theasterisk indicates the termination codon.
Amino acid sequenceshomologous to the estA gene productwere searched using BLAST (Basic Local Alignmentsearch Tool)databasesearchfrom NCBI(National Center for Biotechnology Information) homepage in GenBank, PDB, SwissProt, Spupdate, and PIR database of World Wide Web. Alignments of the predicted amino acid sequences of P. ueruginosa 1001 estA gene products with sequences of esterases and lipases of other microorganisms are shown in Fig. 2. To maximize the similarity, several gaps were introduced into the sequences. The best overall alignment was observed with the triacylglycerol lipase from Psychrobacter immobilis, with 38% identical and 59% similar amino acids. The deduced amino acid sequence of &A from P. aeruginosa 1001 was homologous to the amino acid sequence of a tryacyl-
glycerol lipase from Moraxella sp. (36% identity) and to the amino acid sequence of another form of triacylglycerol lipase from Psychrobacfer immobilis (37% identity). The deduced amino acid sequence of estA from P. aeruginosa 1001 was homologous to the amino acid sequences of two forms of carboxyl esterases from Acinetobacter culcouce&us (17% and 17% identities). It was observed that the deduced amino acid sequence of e&A was highly homologous to those of esterases and lipases from the other microorganisms. The amino acid sequence of the es?stAgene product from P. aeruginosa 1001 has the consensus sequences, Gly-Asn-Ser-Met-Gly containing the active serine residue and His-Gly (Fig. 2). This Gly-X1-Ser-X2-Gly sequence (X is any amino acid) is the consensus sequence for the
686
J. LOSCI. BIOBNCS.,
LEE ET AL. TABLE 1.
Consensus dipeptide and pentapeptide in esterases and lipases from various sources
Strain and enzyme
Consensus dipeptide and pentapeptide
Momxela TAM4 lipase2cs) E.coli lipase-like enzyme@) Streptomyces hygroscopicus N-acetyi hydroh&r*) Streptomym viridochromogenes N-ace@1 hydrolaseCr@ Bacillus acidocaidarius hypothetical protein(r*) Human hormone-sensitive lipasdru Cholesterol esterasdlg) Acetylcholine esterase(*g) Acinetobacter Iwojii esterasdm Pseudomonas fmgi lipas& P. aeruginosa 1001 esterase”
HG--70a.a.b--G-D-S-A-G HG---7Oa.a.---G-D-S-A-G HG--&&a.---G-D-S-A-G HG---66a.a.---G-D-S-A-G HG--7Oa.a.--G-D-S-A-G HG---7Oa.a.~--G-D-S-A-G HG--75a.a.--G-E-S-A-G HG--75a.a.---G-E-S-A-G HG---66a.a.---G-D-S-C-G HG---64a.a.---G-H-S-Q-G HG--65a.a.~--G-N-S-M-G
a This work. b a.a., Amino acids.
active sites of esterases, lipases, and serine proteases (9). However, there is no overall homology between them. Their catalytic triads were believed to be composed’ of Ser, His and Asp/Glu by based on the comparison with serine hydrolase whose active site structure is well established (10, 11). The enzyme (the estA gene product) from P. aeruginosa 1001 of this work is clearly related to a group of enzymes having a serine active triad, erf.pro c-csc1.pro C-.*e. pro t-1ip1.pro
: : :
c-lipZ.pro : t-lips.pro
:
olT.pro c-.sfl.pro
c-*sr*.
pro
: : :
+-lipl.pro : t-1&.2. pro t-1ipz.pro
: :
erf.pro
:
c-sstl.pro
: : :
c-eatz . pro t-lipl.pco
t-lipZ.pco : t-lip3.pro
:
ori.pro
:
c-.*tl.pro
:
c-..ta.pro
:
t-lipI.
pro
:
t-lipZ.pro : t-lip3.pr.z :
ort.pr0 c-..tl.prc
: :
c-*sta.pro
: t-lipl.pr.3 : t-lip2,pr.a: t-lip3,pro :
FIG. 2. Multiple aligmnent of the deduced amino acid sequence of the &A (ORP) gene product (this study) with sequences of the homologs from A. calcoaceticllr (c-&l, GenBank accession no. CAA61351; c-art& GBA no. S57530), Moraxella sp. (t-lipl, GBA no. Pm). and P. immobilti (t-lip2, GBAno. QO2104;t-bp3, GBA no. S28225). c-e& and t-lip are carboxyl esterase and triacylglycerol lipase, respectively. Boxes indicate the consensus sequences for the catalytic triad. The positions that are unique to individual enzymes have been skipped as indicated by dots in order to obtain a comprehensive alignment picture of the consensus sequence.
which is common among many esterases and lipases. As shown in Table 1, several esterases, lipases, and the estA gene product have consensus sequences, H-G and G-X,-S-X2-G, and the distance (about 65-70 amino acids) between the above-mentioned consensus sequences is similar. The human hormone-sensitive lipases (HSLs), which has a role in energy homeostasis by catalyzing the hydrolysis of triacylglycerol and cholesterol ester, have the same pentapeptide consensus sequence, G-X1-S-X2G. Moreover, at the 70-100 ammo acids upstream of the consensus sequences, another consensus sequence H-G, a dipeptide, exists and this motif supports the pentapeptide consensus sequence as a hydrophobic wing. With respect to the primary structure, the RAM-producing enzyme from P. aeruginosa 1001 is an esterase having the active serine motif. Concerning the conserved amino acids, Ser-137 and His-286 were tentatively assigned as the residues of catalytic triad of P. aeruginosa 1001 esterase. Moreover, according to Shimada et al. (lo), the histidine residue also exists downstream of G-X+-X2-G, found in 2-hydroxy&oxo-6-phenylhexa-2,4-dienoic acid (HPDA) hydrolase (12), tropinesterase, and 2-hydroxymuconic semialdehyde (HMC) hydrolase (13) from P. putida and Pseudomonas CF600 (14). This is in good agreement with the finding that RAM-producing esterase has the active serine site, Ser13’. A Shine-Dalgarno (SD) sequence, comprising three bases, is present appropriately spaced at 6 bp upstream of the initiating methionine residue (15). The ORF is preceded by a potential Shine-Dalgarno sequence which is homologous to those of Pseudomonas (16) and E. coli (17) (AGGAGA and GGAGG, respectively). The &A gene product is different in size and ammo acid sequence and does not have the same Shine-Dalgamo sequence (AGGAGA), as in the e&erase reported by Ozaki et al. (6). On the other hand, the coding sequences for the active Ser-residue of other e&erases and lipases were TCG and TCT (6, 9), the &A gene product has the TCC codon, and there is no match for G-X1-S-X2-G in P. aeruginosa as determined by the MedLine and PubMed reference search. Hence, it is concluded that this enzyme is a novel esterase that catalyzes RAM production and is one of serine esterases from P. aeruginosa. We acknowledge the financial support, provided by the Ministry of Science and Technology, Republic of Korea.
VOL.
NOTES
90, 2ooo REFERENCES
1. adctti, M. A., Rubim, B., amd Cmsbmam, D. W.: Design of specific inhibitors of angiotensin-converting enzyme: new class of optically active antihypertensive agents. Science, I%, 441444 (1977). 2. SaIdmae, A., Hosoi, A., Kobayashi, E., Ghsuga, N., Numasawa, R., Watanabe, I., amd- Qhmiabi, a.: scrscning of microorganisms producing r+acetylthioisobutyric acid from methyl DL-@cetylthioisobutyrate. Biosci. Biotech. B&hem., 56, 12521256 (1992). 3. Sakhnae, A., N nmaaawr, R., amd Ohm&&i, H.: A newly isolated microorganism producing r+9-acetyltbioisobutyric acid from methyl Dr+acetylthioisobutyrate. Biosci. Biotech. Biothem., 56, 1341-1341 (1992). 4. SaMmae, A., Kobayaskl, Y., Obsnga, N., Numazawa, R., amd Ohmkbi, IS.: Chemical racekzation of methyl r.+acetylthioisobutyrate. Biosci. Biotech. Biochem., 57, 17-19 (1993). 5. Osaki, E., SaIdmae, A., amd Nmm~azawa,R.: Cloning and expression of Pseudomonas putida esterase gene in Erclrerichia coli and its use in enzymatic production of o+acetylthioisobutyric acid. Biosci. Biotech. Biochem., 58, 1745-1746 (1994). 6. CPzaki, E., SaMmae, A., and Nnmazaws. R.: Nucleotide sequence of the gene for a thermostable esterases from Pseudomonas putida MR-2068. Biosci. Biotech. Biochem., 59, 1u)41207 (1995). 7. Goknl, B., Lee, J.-H., Song, K.-B., Panda, T., R&e, 5. K., and Kim, C.-H.: Screening of microorganisms producing esterase for the production of (R)+acetyhnercaptoisobutyric acid from methyl (R,S)+acetyhnercaptoisobutyrate. Biotechnol. Bioprocess Eng., 5, 57-60 (2600). 8. Kndkr, D. G., Cohen, F. E., and Langridge, R.: Improvements in protein secondary structure prediction by an enhanced neural network. J. Mol. Biol., 214, 171-182 (1990). 9. Sydneyn, B.: The molecular evolution of genes and proteins: a tale of two serine. Nature, 334, 528-530 (1988). _ 10. Shimada. Y.. Nazao. T.. Ssmlhara. A.. EznrnI. T.. Yd. T.. Nakammia,i., &k&e, k., imd Tbmi&a, Y.1 Cloning and sequence analysis of an e&erase gene from Pseudomoncrr sp. KWI-56. Biochem. Biophy. Acta, 1774, 79-82 (1993).
687
11 Brady, L., Brzozowski, A. hf., Derewenda, 2. S., Do&an, E., Dudso~~, G., ToIIey, S., Twukenborg, J. P., Chtistiansen, L., HopeJensen, B., Norskov, L., Thim, L., and Menge, U.: A serine protease triad forms the catalytic centre of a triacylglycerol lim. Nature, 343, 767-770 (1990). 12. Eayase, N., Taba, K., and Furs&awn, K.: A serine protease triad forms the catalytic centre of a triacylglycerol lipase. J. Bacterial., 172, 11603164 (1990). 13. Herm, J. hi., Aarayama, S., ud Ttmmis, K. N.: DNA sequence determination of the TOL plasmid (pWW0) xylGFJ genes of P&udomonas putida: implications for the evolution of aromatic catabolism. Mol. Microbial., 5. 2459-2474 (1991). I. and Shingler, V.: Nucleotide sequences‘ of the 14. Nordhnd, metu-cleavage pathway enzymes Zhydroxymuconic semialdehyde dehydrogenase and 2-hydroxymuconic semialdehyde hydrolase from Pseudomonas CF600. Biochim. Biophys. Acta, 1049.227-230 (1990). 15. Gold, L., Prtbnow, D., Sckneider, T., Sbneidling, S., Singer, B. S., sad Stormo, G.: Translational initiation in prokaryotes. Annu. Rev. Microbial.. 35, 365-403 (1981). 16. Demtk, V., Gill, J. F., and Clmkrabarty, A. M.: Alginate biosynthesis: a model system for gene regulation and function in Pseudomonas. Biotechnology, 5.469-477 (1987). 17. Stormo, G. D., Schneider, T. D., and Gold, L. M.: Characteriration of translational initiation sites in E. coli. Nucl. Acids Res., 10, 2971-2996 (1982). 18. LangIn, D. and Aolm, C.: Sequence similarities between hormone-sensitive lipase and five prokaryotic enzymes. Trends Biothem. Sci., 18,466-467 (1993). 19. David, Y.H. and Ktsw.1, J.A.: Sequence identity between human pancreatic cholesterol e&erase and bile salt-stimulated milk lip&e. FBBS Lett., 276, 131-134 (1990). 20. Ktnat. N. A. and Gatnick. D. L.: Esterase from the oildearading Aknetobacter lwofii RAG-l: sequence analysis and overexpression in Escherichiu coli. FBMS Microbial. Lett., 112, 275-280 (1993). 21. Watam, K., Yasno, O., Y&IO, A., and Yasnyald, T.: Molecular cloning and nucleotide sequence of the lipase gene from Pseudomonas faegi. Biochem. Biophys. Res. Commun., 141, 185-190 (1986).
Cloning and Sequence Analysis of the estA Gene Encoding Enzyme for Producing (R)+Acetylmercaptoisobutyric Acid from Pseutiomonas aertq$nosa 1001 JE-HYUK LEE,’ GOKUL BOYAPATI,2 KI-BANG SONG,’ SANG-K1 RHEE,’ ANDCHUL-HO KIM’*
Applies’ Microbiology Research Division, Korea Research Institute of Bioscience and Biotechnology, Yusong, Taejon 305-600, Korea’ and Department of ChemicalEngineering,Indian Institute of Technology-Madras,IndiaZ Received 18 September 2OOO/Accepted27 September 2000
The t&A gene encoding the enzyme that catalyzes the production of (ZO-~lmtrcaptoisobutyric acid from (R,S)+stewfrom Pseu&nomw aeruginosa1001, was cloned ia Eschtrichfa coliaud its nudtotidt stqutnct was dtttrmined, reveal&g the lwwumtd optn reading frame twoding a polyptptide of 316 amiuo acid residues (948 nudeoUts). The overall A + T and C +G compositions wtrt 32.59% and 67.41%, resptctively. Tht amino acid stquenct of tht tsfA gent prod& showtd a dgnifhnt simikity with that of the triacylglwtrol Upase from Psychrobaeter bnmobU&(38% idtutity), trhcylglyctro1 lipast from Morawlla sp. (36% identity), and two forms of carboxyl tsterases from Acinetobacte cakoaceticus (17% and 17% identities). The dtductd amino add sequtncts have a pentaptptide constnsus sequence, G-X-S-X-G, having an tttivt stride residue, and another active site, diptptidts H-G, located at 70-100 amino adds upstream of the G-X-S-X-G consensus sequence. [I(es words: esterase gene, mercaptoisobutyric acid]
Pseudomonas ueruginosu, nucleotide sequence, G-X-S-X-G,
(R)+-acctyl-
formants was measured by estimating the amount of I&AMproduced from (R,S)ester using HPLC (CHIREX (R) NGL & DNB column, 250 x 4.6mm, Phenomenez Co., USA) with 20 mM ammonium acetate in methanol (1.0 ml/mm) as the mobile phase. An UV detector (254 nm) was used to identify the components. One of the clones, carrying pTBL7 (about 4.5 kb DNA insert), exhibited enzyme activity of producing I&AM from (R&Q-ester. From the results of subcloning, the estA gene was located within the NheI-NnrI DNA fragment of pTBL76 (about 1.1 kb). The length of pTBL76 was determined to be 1036 bp by nucleotide sequencing (ABI PRISM 377 autosequencer, Perkin-Elmer, USA). Only one open reading frame (ORF) was found in pTBL76 using the DNASIS program (MacDNASIS Pro V3.5, Hitachi Software Engineering Co. Ltd.) and Editseq program in the DNASTAB program package. The ORF had 948 bp nucleotides that encode 316 amino acids derived by computer analysis using the DNASTAR program (Madison, WI, USA). The estA gene had an A+T composition of 32.59% and C+G composition of 67.41%. The isoelectric point and the molecular weight were found to be pH 6.4 and 34,836 daltons, respectively. The molecular weight calculated from the deduced amino acid sequence (316 amino acids) was about 35 kDa, which is in good agreement with the value obtained by SDS-PAGE (data not shown). The NheI site was located at 42 bp upstream of the start codon, ATG, of OKF (the estA gene), and the NruI site was located at 46 bp downstream of the termination codon, TGA. The nucleotide sequence of ORF, the estA gene, and the corresponding deduced amino acid sequence are shown in Fig. 1. The nucleotide sequence (948 bp) of the gene encoding the enzyme that catalyzes BAM production from (R,s)ester has been deposited in the GenBank with the accession number AF170828.
(R)+Acetylmercaptoisobutyric acid (RAM) is an important intermediate for synthesis of various optically active compounds, particularly pharmaceuticals such as Captopril (1) and Alacepril (Sawayama, T. et al., Japanese patent, 63-18599, 1988) which are used for the treatment of hypertension and congestive heart failure. There were several reports on the development of novel processes for BAM production, for example, stereoselective hydrolysis of (R,S)+acetyhnercaptoisobutyrate [(R,s)-ester] and the enzymatic production process (2-4) using Pseudomonas putida, Pseudomonas jlourescence, and Agrobacterium radiobacter (5, 6). Earlier we reported the isolation of a new microorganism from soil with high enzyme activity (7). In this paper, we report the cloning of the gene encoding the enzyme involved in KAM production from (R,S)-ester, and analyzed the amino acid sequence of the gene product. This is the first report on the sequence analysis of the enzyme that catalyzes BAM production from (R,S)-ester. A loopful of RAM-producing strain, Pseudomonas aeruginosa 1001, was cultured at 37°C for 24 h using a medium described previously (7). The cells were harvested by centrifugation (12,000~ g) for 10 min. Chromosomal DNA of P. aeruginosa 1001 was isolated using a G-NOME isolation kit (Bio 101, La Jolla, CA, USA), and was then partially digested with Sau3A and ligated to BamHI-digested pBluescript@ IIKS+ vector. The inserted plasmids were transformed in Escherichia coli DHSlr. About 10,600 colonies of E. coli DHSa transformants were selected by adding ampicillin on the [LB] medium with X-gal (5bromo-4-chloro-3-indolyl-B_Dgalactopyranoside). For the screening of colonies carrying with the desired gene, they were transferred using a toothpick onto a plate with the [LB] medium containing tributyrin and (R,S)-ester. The enzyme activity of trans-
* Corresponding author. 684
VOL.
NOTES 685
90,2ooo GCCGACCACCGGCAGCAC
GCCTAGACTCGTCACAXGCTTGC
GACAGCGGGCCGGCACGG
13
CTAGCGTTCAGCGCTGGCCCCTTTTTTCCTGAAGCCTTC~ZACCCATGAAACGATTCC
4 73
SD HetLysArgPheL TCCTCGGTCTGGTTCTGCTGCTGGCGGTCGCCGCCGGCGTCCTCTACTTCGTCCCG~TA
24
euLeuGlyLeuVa1LeuLeuLeuALaValAl~aGlyValLeuTyrPheVa1ProA;LaT
133 CCCTCCTCGCCAGCGTACGCACCGTCGAGCGCGGCCTCGCCGGTCTCAGCGAGCACAGCG 44
hrLeuLeuATaSerValArgThrValGluArgG1yLe~aG1yLeuSerGluHloStrV
193 TGCAGGTCGACAACCTGGAGATCGCCTACCTGGAAGGCGGCTCGGMRAGMCCCGACCC 64
alGlnValAs~nLeuGluI1eAlaThrLtuGluGlyG1yStrGluLyslbnProThrL
253 TGTTGCTGATCCACGGCTTCGGCGCCGACAAGGACAACTGGCTGCGCTTCGCCCGGCCGC 04 euLtuLeuI1tHisG1yPhtGlyAlaAspLysAspAsnTrpLtuArgPhQAlaArgPtoL 313 TGACCGAGCGCTACCATGTGGTCGCCCTCGXCTGCCCGGCTTCGGCGACAG104 tuThrGluArgTyrHisValValAlaLtuAspLtuProGlyPheGly~pStrStrLysP 373 CGCAACAGGCCAGCTACGACGTCGGCACCCAGGCCGAGCGAGTCGCCAATTTCGCCGCCG 124 roGlnGlnAlaStrTyrA8pValG1yThrGlnAlaGluArgValAlaAsnPhtAlaAlaA 433 CCATCGGCGTGCGCCGCCTGCACCTGGCCGGCAACTCCATGGGCGGGCACATCGCCGCGC 144 laIltG1yValArgArgLtuIiisLtuAlaGlyAsnStr!4ttGlyGlyHisIleAlaAlaL 493 TCTACGCGGCGCGCCATCC GGMCAGGTGCTATCGCTGGCGCTGATCGACAACGCCGGGG 164 tuTyrAlaAlaArgHi6ProGluGlnVa1LtuStrLt~aLtuIleAspAsnAlaGlyV 553 184 613 204
TAATGCCGGCGC GCAAGAGCGAACTGTTCGAGGACCTGGAGCGCGGCGAGMTCCCCTGG a~etProAlaArgLysStrGluLtuPheGluAmpLtuGl~~lyGl~nProLtuV TGGTGCGCCAGCC GGAAGACTTCCAGAAGCTGCTCGACTTCGTGTTCGTCCAGCAACCGC alVaUrgGlnProCl~6pPhtGlnLy8LtuLe~~PhtValPhtValGlnGlnProP
673 CGCTGCCGGCGCCGCTCAAGCGCTACCTCGGCGAACGCGCGGTAGCCGCGTCGGCGTTCA 224 roLtuProAlaProLeuLy8ArgThrLtuG1yGluArgAlaValAlaAlaStrAlaPheA 733 244 793 264 853 284
ACGCGCAGATATTCGAACAAC TGCGCCAGCGCTACATCCCGCTGGAGCkGAACTGCCGA snAlaGlnIltPheGluGlnLt~gGlnArgTyrIltProLtuGluPr~l~tuProL AGATCGAGGCACCGACCCTGCTGCTATGGGGCGACCGCGACCGCGTGCTGGACGTCTCCA ysI1tGluAtaProThrLtuLtuLtuTrpGly~pArgAlpArgVal~uAapValStrS GCATCGAGGTGATGCGTCCGCTGCTGAAGCGGCCCAGCGTGGTGATCATGGAAAACTGCG trIleGluVa~etArgProLtuLtuLysArgProStrValValIlaWttGl~nCysG
913 GACACGTGCCGATGGTCGAACGCCCGGA GGAAACCGCGCAGCACTACCAGGCCTTCCTCG 304 lyHisValPr~etValG1uArgProGluGluThr~aGlnHiaTyrGl~aPheLe~ 973 ACGGTGTACGGMCGCCCAGGTGGCCGGTCGCT 316 spGlyValArgAsnAlaGlnValAlaG1yArg
GAMACGCGAACCGGCGCCTGGGCGCC *
GGTTCGGGGGAGCGGGAGCCGTCGCGAGGACGGCTCGGATACAGGCCTCAGGCCTGGATC FIG. 1. Nucleotide anddeduced amino acid sequences of ORF (the e&A gene) ofP.ueruginasu1001. Theasterisk indicates the termination codon.
Amino acid sequenceshomologous to the estA gene productwere searched using BLAST (Basic Local Alignmentsearch Tool)databasesearchfrom NCBI(National Center for Biotechnology Information) homepage in GenBank, PDB, SwissProt, Spupdate, and PIR database of World Wide Web. Alignments of the predicted amino acid sequences of P. ueruginosa 1001 estA gene products with sequences of esterases and lipases of other microorganisms are shown in Fig. 2. To maximize the similarity, several gaps were introduced into the sequences. The best overall alignment was observed with the triacylglycerol lipase from Psychrobacter immobilis, with 38% identical and 59% similar amino acids. The deduced amino acid sequence of &A from P. aeruginosa 1001 was homologous to the amino acid sequence of a tryacyl-
glycerol lipase from Moraxella sp. (36% identity) and to the amino acid sequence of another form of triacylglycerol lipase from Psychrobacfer immobilis (37% identity). The deduced amino acid sequence of estA from P. aeruginosa 1001 was homologous to the amino acid sequences of two forms of carboxyl esterases from Acinetobacter culcouce&us (17% and 17% identities). It was observed that the deduced amino acid sequence of e&A was highly homologous to those of esterases and lipases from the other microorganisms. The amino acid sequence of the es?stAgene product from P. aeruginosa 1001 has the consensus sequences, Gly-Asn-Ser-Met-Gly containing the active serine residue and His-Gly (Fig. 2). This Gly-X1-Ser-X2-Gly sequence (X is any amino acid) is the consensus sequence for the
686
J. LOSCI. BIOBNCS.,
LEE ET AL. TABLE 1.
Consensus dipeptide and pentapeptide in esterases and lipases from various sources
Strain and enzyme
Consensus dipeptide and pentapeptide
Momxela TAM4 lipase2cs) E.coli lipase-like enzyme@) Streptomyces hygroscopicus N-acetyi hydroh&r*) Streptomym viridochromogenes N-ace@1 hydrolaseCr@ Bacillus acidocaidarius hypothetical protein(r*) Human hormone-sensitive lipasdru Cholesterol esterasdlg) Acetylcholine esterase(*g) Acinetobacter Iwojii esterasdm Pseudomonas fmgi lipas& P. aeruginosa 1001 esterase”
HG--70a.a.b--G-D-S-A-G HG---7Oa.a.---G-D-S-A-G HG--&&a.---G-D-S-A-G HG---66a.a.---G-D-S-A-G HG--7Oa.a.--G-D-S-A-G HG---7Oa.a.~--G-D-S-A-G HG--75a.a.--G-E-S-A-G HG--75a.a.---G-E-S-A-G HG---66a.a.---G-D-S-C-G HG---64a.a.---G-H-S-Q-G HG--65a.a.~--G-N-S-M-G
a This work. b a.a., Amino acids.
active sites of esterases, lipases, and serine proteases (9). However, there is no overall homology between them. Their catalytic triads were believed to be composed’ of Ser, His and Asp/Glu by based on the comparison with serine hydrolase whose active site structure is well established (10, 11). The enzyme (the estA gene product) from P. aeruginosa 1001 of this work is clearly related to a group of enzymes having a serine active triad, erf.pro c-csc1.pro C-.*e. pro t-1ip1.pro
: : :
c-lipZ.pro : t-lips.pro
:
olT.pro c-.sfl.pro
c-*sr*.
pro
: : :
+-lipl.pro : t-1&.2. pro t-1ipz.pro
: :
erf.pro
:
c-sstl.pro
: : :
c-eatz . pro t-lipl.pco
t-lipZ.pco : t-lip3.pro
:
ori.pro
:
c-.*tl.pro
:
c-..ta.pro
:
t-lipI.
pro
:
t-lipZ.pro : t-lip3.pr.z :
ort.pr0 c-..tl.prc
: :
c-*sta.pro
: t-lipl.pr.3 : t-lip2,pr.a: t-lip3,pro :
FIG. 2. Multiple aligmnent of the deduced amino acid sequence of the &A (ORP) gene product (this study) with sequences of the homologs from A. calcoaceticllr (c-&l, GenBank accession no. CAA61351; c-art& GBA no. S57530), Moraxella sp. (t-lipl, GBA no. Pm). and P. immobilti (t-lip2, GBAno. QO2104;t-bp3, GBA no. S28225). c-e& and t-lip are carboxyl esterase and triacylglycerol lipase, respectively. Boxes indicate the consensus sequences for the catalytic triad. The positions that are unique to individual enzymes have been skipped as indicated by dots in order to obtain a comprehensive alignment picture of the consensus sequence.
which is common among many esterases and lipases. As shown in Table 1, several esterases, lipases, and the estA gene product have consensus sequences, H-G and G-X,-S-X2-G, and the distance (about 65-70 amino acids) between the above-mentioned consensus sequences is similar. The human hormone-sensitive lipases (HSLs), which has a role in energy homeostasis by catalyzing the hydrolysis of triacylglycerol and cholesterol ester, have the same pentapeptide consensus sequence, G-X1-S-X2G. Moreover, at the 70-100 ammo acids upstream of the consensus sequences, another consensus sequence H-G, a dipeptide, exists and this motif supports the pentapeptide consensus sequence as a hydrophobic wing. With respect to the primary structure, the RAM-producing enzyme from P. aeruginosa 1001 is an esterase having the active serine motif. Concerning the conserved amino acids, Ser-137 and His-286 were tentatively assigned as the residues of catalytic triad of P. aeruginosa 1001 esterase. Moreover, according to Shimada et al. (lo), the histidine residue also exists downstream of G-X+-X2-G, found in 2-hydroxy&oxo-6-phenylhexa-2,4-dienoic acid (HPDA) hydrolase (12), tropinesterase, and 2-hydroxymuconic semialdehyde (HMC) hydrolase (13) from P. putida and Pseudomonas CF600 (14). This is in good agreement with the finding that RAM-producing esterase has the active serine site, Ser13’. A Shine-Dalgarno (SD) sequence, comprising three bases, is present appropriately spaced at 6 bp upstream of the initiating methionine residue (15). The ORF is preceded by a potential Shine-Dalgarno sequence which is homologous to those of Pseudomonas (16) and E. coli (17) (AGGAGA and GGAGG, respectively). The &A gene product is different in size and ammo acid sequence and does not have the same Shine-Dalgamo sequence (AGGAGA), as in the e&erase reported by Ozaki et al. (6). On the other hand, the coding sequences for the active Ser-residue of other e&erases and lipases were TCG and TCT (6, 9), the &A gene product has the TCC codon, and there is no match for G-X1-S-X2-G in P. aeruginosa as determined by the MedLine and PubMed reference search. Hence, it is concluded that this enzyme is a novel esterase that catalyzes RAM production and is one of serine esterases from P. aeruginosa. We acknowledge the financial support, provided by the Ministry of Science and Technology, Republic of Korea.
VOL.
NOTES
90, 2ooo REFERENCES
1. adctti, M. A., Rubim, B., amd Cmsbmam, D. W.: Design of specific inhibitors of angiotensin-converting enzyme: new class of optically active antihypertensive agents. Science, I%, 441444 (1977). 2. SaIdmae, A., Hosoi, A., Kobayashi, E., Ghsuga, N., Numasawa, R., Watanabe, I., amd- Qhmiabi, a.: scrscning of microorganisms producing r+acetylthioisobutyric acid from methyl DL-@cetylthioisobutyrate. Biosci. Biotech. B&hem., 56, 12521256 (1992). 3. Sakhnae, A., N nmaaawr, R., amd Ohm&&i, H.: A newly isolated microorganism producing r+9-acetyltbioisobutyric acid from methyl Dr+acetylthioisobutyrate. Biosci. Biotech. Biothem., 56, 1341-1341 (1992). 4. SaMmae, A., Kobayaskl, Y., Obsnga, N., Numazawa, R., amd Ohmkbi, IS.: Chemical racekzation of methyl r.+acetylthioisobutyrate. Biosci. Biotech. Biochem., 57, 17-19 (1993). 5. Osaki, E., SaIdmae, A., amd Nmm~azawa,R.: Cloning and expression of Pseudomonas putida esterase gene in Erclrerichia coli and its use in enzymatic production of o+acetylthioisobutyric acid. Biosci. Biotech. Biochem., 58, 1745-1746 (1994). 6. CPzaki, E., SaMmae, A., and Nnmazaws. R.: Nucleotide sequence of the gene for a thermostable esterases from Pseudomonas putida MR-2068. Biosci. Biotech. Biochem., 59, 1u)41207 (1995). 7. Goknl, B., Lee, J.-H., Song, K.-B., Panda, T., R&e, 5. K., and Kim, C.-H.: Screening of microorganisms producing esterase for the production of (R)+acetyhnercaptoisobutyric acid from methyl (R,S)+acetyhnercaptoisobutyrate. Biotechnol. Bioprocess Eng., 5, 57-60 (2600). 8. Kndkr, D. G., Cohen, F. E., and Langridge, R.: Improvements in protein secondary structure prediction by an enhanced neural network. J. Mol. Biol., 214, 171-182 (1990). 9. Sydneyn, B.: The molecular evolution of genes and proteins: a tale of two serine. Nature, 334, 528-530 (1988). _ 10. Shimada. Y.. Nazao. T.. Ssmlhara. A.. EznrnI. T.. Yd. T.. Nakammia,i., &k&e, k., imd Tbmi&a, Y.1 Cloning and sequence analysis of an e&erase gene from Pseudomoncrr sp. KWI-56. Biochem. Biophy. Acta, 1774, 79-82 (1993).
687
11 Brady, L., Brzozowski, A. hf., Derewenda, 2. S., Do&an, E., Dudso~~, G., ToIIey, S., Twukenborg, J. P., Chtistiansen, L., HopeJensen, B., Norskov, L., Thim, L., and Menge, U.: A serine protease triad forms the catalytic centre of a triacylglycerol lim. Nature, 343, 767-770 (1990). 12. Eayase, N., Taba, K., and Furs&awn, K.: A serine protease triad forms the catalytic centre of a triacylglycerol lipase. J. Bacterial., 172, 11603164 (1990). 13. Herm, J. hi., Aarayama, S., ud Ttmmis, K. N.: DNA sequence determination of the TOL plasmid (pWW0) xylGFJ genes of P&udomonas putida: implications for the evolution of aromatic catabolism. Mol. Microbial., 5. 2459-2474 (1991). I. and Shingler, V.: Nucleotide sequences‘ of the 14. Nordhnd, metu-cleavage pathway enzymes Zhydroxymuconic semialdehyde dehydrogenase and 2-hydroxymuconic semialdehyde hydrolase from Pseudomonas CF600. Biochim. Biophys. Acta, 1049.227-230 (1990). 15. Gold, L., Prtbnow, D., Sckneider, T., Sbneidling, S., Singer, B. S., sad Stormo, G.: Translational initiation in prokaryotes. Annu. Rev. Microbial.. 35, 365-403 (1981). 16. Demtk, V., Gill, J. F., and Clmkrabarty, A. M.: Alginate biosynthesis: a model system for gene regulation and function in Pseudomonas. Biotechnology, 5.469-477 (1987). 17. Stormo, G. D., Schneider, T. D., and Gold, L. M.: Characteriration of translational initiation sites in E. coli. Nucl. Acids Res., 10, 2971-2996 (1982). 18. LangIn, D. and Aolm, C.: Sequence similarities between hormone-sensitive lipase and five prokaryotic enzymes. Trends Biothem. Sci., 18,466-467 (1993). 19. David, Y.H. and Ktsw.1, J.A.: Sequence identity between human pancreatic cholesterol e&erase and bile salt-stimulated milk lip&e. FBBS Lett., 276, 131-134 (1990). 20. Ktnat. N. A. and Gatnick. D. L.: Esterase from the oildearading Aknetobacter lwofii RAG-l: sequence analysis and overexpression in Escherichiu coli. FBMS Microbial. Lett., 112, 275-280 (1993). 21. Watam, K., Yasno, O., Y&IO, A., and Yasnyald, T.: Molecular cloning and nucleotide sequence of the lipase gene from Pseudomonas faegi. Biochem. Biophys. Res. Commun., 141, 185-190 (1986).