Cloning, expression and nucleotide sequence of the gene fragment encoding an antigenic portion of the nucleoside triphosphate hydrolase of Toxoplasma gondii

Gmr, 85 (1989) 215-220 Elsevier

215

GENE 03317

Cloning, expression and nucleotide sequence of the gene fragment encoding an antigenic portion of the nucleoside triphosphate hydrolase of Toxoplasma go&ii (Recombinant DNA; expression library; fusion protein; protist; plasmids pGEX; phage I vectors; tachyzoite; toxoplasmosis; diagnostic antigen; immunoblots)

Alan M. Johnson*, Susana Illana”, Peter J. McDonald*and Takashi Asaib a ~e~a~~e~t of ClinicalMi~ro~ioio~,alders Un~yers~&hoi ofMedicine,~ders Medal Centre, South Australia 5042 (Australia} and ’ Department ofh4icrobiology, Tokyo Medical College, Shinjuku, Tokyo 160 (Japan) Tel. (03)3516141 Received by P.A. Manning: 9 June 1989 Revised: 4 August 1989 Accepted: 6 August 1989

SUMMARY

Toxophmagondii expresses high levels of an active nucleoside triphosphate hydrolase (NTPase; EC 3.6.1.3) with several unique properties. It has been detected as a circulating antigen in mice, making it an ideal candidate for diagnostic tests for toxoplasmosis. A cDNA library constructed from T. gondii poly(A)+ RNA was made in Jgtll. One hundred thousand members of this library were immunoscreened with a rabbit polyclonal antibody to the purified NTPase. Six positive clones were subcloned into the plasmid, pGEX-lN, and the inserts were restriction-mapped. All clones had identical partial restriction enzyme maps. One insert was subcloned into M 13mp 18 and sequencing by the deoxy/dideoxy method showed an NTPase-encoding gene (ntp) fragment of 571 bp. The insert was also purified, radiolabelled, and used to hybridize to Northern blots of tachyzoite RNA and qu~titative Southern blots of tachyzoite DNA. Northern blotting revealed that the NTPase mRNA was in great abundance and had a length of about 2800 nucleotides. Southern blotting showed a gene copy number of between one and five, and the possibility that ntp is tandemly repeated over a large length of DNA. The NTPase was expressed as a glutathione S-transferase (EC 2.5.1.18) fusion protein of about 50 kDa, which reacted with polyclonal rabbit antibody on Western blotting.

INTRODUCTION

Toxoplasma gondii is an obligately intracellular

protistan

parasite

that commonly

infects many

Correspondence to: Dr. A.M. Johnson, Department of Clinical Microbiolo~, Flinders Medical Centre, Bedford Park, South Australia 5042 (Australia) Tel. (OS)2759319 Telex FLINDU AA89624; Fax (08)2770085. Abbreviations: aa, amino acid(s); bp, base pair(s); BSA, bovine serum albumin; GST, glutathione-S-transferase (EC 2.5.1.18);

warm-blooded animals, including human. First exposure to the parasite during pregnancy may cause congenital malformations or abortion and the disease is often fatal for i~unosuppressed patients

IgG, immuno~obul~ G; kb, kilobase or 1090 bp; nt, nuckotide(s); nrp, gene encoding NTPase; NTPase, nucleoside triphosphate hydrolase (EC 3.6.1.3); ORF, open reading frame; SDS, sodium dodecyl sulfate; ss, single strand(ed); T., Toxoplasma; TBST, 50 mM Tris . HCl pH 8.0/150 mM NaCl/O.O5% Tween-20.

0378-I 119/89/$03.50 0 1989 Elsevier Science Publishers B.V. (Biomedical Division)

216

such as those with AIDS (reviewed in Johnson, 1990a). Therefore, much research has been performed to establish diagnostic tests for toxoplasmosis (reviewed in Johnson, 1985). However, because the parasite is obligate@ intracellular, host-cell contaxation is a constant problem. Therefore, the production of recombinant antigens of the parasite that could be used to provide a reproducible source of inexpensive antigen devoid of mammalian host-cell cont~ination for diagnostic tests is highly desirable. The tachyzoite form of T. gondii has an active NTPase with several unusual properties. The enzyme contains four equivalent 63-kDa subunits and constitutes about 8 % of the total proteins in the tachyzoite cell (Asai et al., 1987). The hydrolase is unique to T. gondii in that it exhibits an extremely high activity only in the presence of dithiothreitol or other similar strongly reductive dithiols (Asai et al., 1983; 1986). Both polyclonal and monoclonal antibodies directed towards purified NTPase have been used to detect circulating NTPase in the sera of mice infected with either virulent or avirulent strains of T. gondii (Asai et al., 1987). The high abundance of this protein and the ability to detect it as a circulating antigen make it ideal as a candidate antigen for diagnostic tests for toxoplasmosis. Here, we describe the cloning and ch~~te~zation of the cDNA gene fragment that encodes an antigenic portion of the NTPase of T. gondii.

EXPERIMENTAL

AND DISCUSSION

(a) Isolation and restriction mapping of an ~scherichiu coli clone expressing au antigenie portion of Toxoplasma gondii NTPase The cDNA library screened here consisted of 6.3 x 10’ r~ombin~t members having an average insert size of 0.94 5 0.56 kb (not shown). Immunological screening of 100000 members of the Qtll expression library identified six positive clones (not shown), all of which were consistently strongly positive on rescreening with the rabbit polyclonal antiNTPase serum. The gene fragments in the six positive clones were excised with EcoRI and subcloned into the unique EcoRI site of the plasmid pGEX- IN. This ensured that the DNA inserted into the plasmid was in the same reading frame as that in the Qtll

expression library with respect to the EcoRI site. ~~c~e~c~~ co& containing the pGEX-IN plasmid produce a GST of Schistosoma japonicum (Smith and Johnson, 1988). Genes ligated into the pGEX-1N result in the synthesis of a GST-fusion protein which is inducible with isopropyl ~-~-~og~actop~~oside, and can be very easily purified by absorption to glutathione-agarose beads under nondenaturing conditions (Smith and Johnson, 1988). The majority of GST-fusion proteins are soluble (Smith and Johnson, 1988), and at least for one taeniid cestode protein, secretion as a GST-fusion protein stimulates host-protective immunity that is not stimulated when the protein is secreted as a /%galactosidase fusion protein (Johnson et al., 1989). All of the six cloned gene inserts had the same restriction enzyme map (Fig. 1). We are unsure as to why all six positive clones were identical. However, because the rabbit antibody was raised to native functional NTPase, it is possible that this particular polypeptide is the major, if not only, antigenic portion of the NTPase. Alternatively, the fact that the six positive clones were all identical may be an artefact of the library production or amplification. (b) Nucleotide sequence The 571 bp of the ntp gene fragment are given in Fig. 2, along with the predicted aa sequence. This was the only ORF, the other reading frames containing twelve and eleven stop codons. This fragment of the gene had a G + C content of 52 %, very similar to that (50.4 + 1.5%) found for the whole T. gondii genome (Johnson et al., 1986a). This gene fragment had no significant homology with any gene sequence in the GenBank database version 59.0, or the four T. gondii genes sequenced recently: F3G3 antigen (Prince et al., 1989), P30 antigen (Burg et al., 1988), and a- and /.?-tubulin (Nagel and Boothroyd, 1988). A detailed analysis of dinucleotide frequency and codon usage in T. gondii has been described elsewhere (Johnson, 1990b). The ntp gene fragment has a codon bias (60%) towards G or C in the third position, and makes little use, if any, of at least six codons (TTA, CIA, TCA, CGA, CGG, GGG), similar to the other four T. gondii genes sequenced to date. The predicted aa sequence encoded by the ntp gene fragment had no significant homology with any protein in the NBRF (PIR) protein database release 20.0.

217 3’

5’

RB

E I

100

bp

P

s

(c) Molecular analysis of the

ntp gene

E

1

Fig. 1. Partial restriction enzyme map of the ntp fragment. B, BszEII; E, EcoRI; P, PsrI; R, R.ruI; S, SalI. Total RNA was extracted from tachyzoites of the RH strain of T. gondii grown in the peritoneal cavities of LACA mice and poly(A) + RNA was selected by standard oligo(dT) affinity chromatography as described elsewhere (Johnson et al., 1986b). 2 pg of T. gondii poly(A)+RNA was copied into ss cDNA using avian myeloblastosis virus reverse transcriptase (Promega Biotec, Madison, WI) and oligo(dT) primers (Pharmacia, Uppsala, Sweden). The second strand was synthesized using RNase H (Promega) and DNA polymerase I (Promega) (Gubler and Hoffman, 1983).The ends of the cDNA molecules were trimmed with T4 DNA polymerase and EcoRI linkers were added after methylation using EcoRI methylase. The cDNA was digested with EcoRI and excess linkers were removed by passing through a Sephadex G-150 column (Pharmacia) (Huynh et al., 1985). The linkered cDNA was then ligated with an equimolar amount of dephosphorylated Lgtl I vector arms, packaged in vitro using commercially available packaging extracts (Promega), transfected into E. coli strain RY 1090r - and amplified. Bacteriophage plaques were immunoscreened using an alkaline phosphatase conjugate screening procedure essentially as specified by the manufacturer (Promega). Briefly,E. coli strain RY1090r- was transfected with the &tll cDNA library and screened with polyclonal rabbit anti-NTPase IgG diluted 1: 500 in TBST containing 1y0 BSA and 0.02% NaN,. Bound antibody was visualized by reaction with alkaline phosphatase-conjugated goat anti-rabbit IgG diluted 1: 7500 in TBST. Rabbit anti-NTPase was prepared by injecting New Zealand White rabbits intradermally with 50 pg of purified NTPase from RH strain T. gondii tachyzoites (Asai et al., 1983) as described by Vaitukaitis (1981). Polyclonal IgG was purified from .the serum by (NH,)SO, precipitation and DEAE-At%Gel blue (BioRad, Richmond, CA) chromatography as described previously (Asai et al., 1987). Anti-E. coli antibodies were adsorbed from the rabbit anti-NTPase polyclonal IgG by incubating the serum with E. coli lysate several times (Helfman et al., 1984). ntp inserts from the immunopositive cDNA clones were gel-purified using DEAE membranes (Schleicher & Schuell, Keene, NH) and subcloned into pGEX-IN. These recombinant plasmids were transfected into E. coli which were immunoscreened using a procedure modified from that described elsewhere (Helfman et al., 1983). Briefly, colonies grown directly on nitrocellulose filters were lysed in a tank ofchloroform vapour for 30 min and then incubated at 22°C for 2 h in 50 mM Tris.HCl pH 8.0/4OOpg lysozyme per ml/l% BSA, without shaking. After incubation at 22°C overnight with gentle shaking in 50 mM Tris . HCl pH 8.0/150 mM NaCl/S mM MgCl,/40 pg lysozyme per ml/10 ng DNase I per ml/10 pg RNase A per ml/l y0 BSA, the filters were washed three times in TBST and subjected to the antibody screening procedure as described for the plaque assay. Recombinant plasmids were purified from E. coli using QIAGEN-pack 500 columns (Qiagen Inc., Studio

To determine the copy number of the ntp gene, T. gondii genomic DNA and known genome equivalents of the pGEX-1N plasmid containing the ntp gene fragment were transferred to nylon and hybridized with labelled purified ntp gene fragment. The

“alArgProAspGlySerAlaSer”alAsnGl”Asp”alArgLysAs”Ar CTCCGTCCTGACGGATCTGCTGTGWWGATGTG -GCTGAAGCCG 130

140

150

160

170

180

LeuAlaThrTyrCysSer”alRs”As”ProGluIleSerPheLys”alTh

CTTGCAACGTACTGCTCAGTI\AATAACCCGGZLPATCAGC190

200

210

220

GT~-c-TG 240 98

GlnCysArgGluAsnSerIleAspProThrLysProLe~AlaGluArgMetLysIleGlu CAGTGCCGGWUULAC TCGATTGATCCAACGRRGCCACTCGCGGAGAGAATGAAGATCGAG 250 260 270 280 290

300 I18

AsnCysSerIleIleLysG1yThrGlyAsnPheAspLysCysValSerGlnValGluSer AACTGCAGTATAAT-GAPCCGGAAACTTTGACAAATGCGTGAGCCAGGTAGAAAGC 310 320 330 340 350

360 138

Il~Le"V~lAl~Pr~LysLeuProLeuProLeuProAlaAsnIleGluAlaAlaSerSerGlyPhe ATTCTCGTCGCTCCCRAGTTACCTCTACCAGC-TT-TGCGTCCTCGGGCTTC 370 380 390 400 410 420

GluSerValAspGlnValPheArgPheAlaSerSerThrAlaProMetIleValThrGly GAATCCGTCGACCAAGTCTTCGTTTGCCTCCTCGACAGCGCCGATGATCGTCACGGGC 430 440 450 460 470

480 178

GlyGlySerLeuAlaAlarleAsnThrLeuLysAspHisA=gL~"L~"A=gS~=A*p~h~ GGAGGTAGTCTAGCGGCGATCAACACACTCKUGATCACCGTCTTCTTCGGAGCGACTTC 490 500 510 520 530

540

190

SerGlyAspValGluGluLeuAlaGlu~laAlaAlaGly AGCGGTGACGTAGAAGAACTC GGAAGCGGCGGGTGAATTC 550 560 570

Fig. 2. Nucleotide sequence ofthe nrp fragment and the predicted aa sequence. Last digits ofthe numbers are aligned with the given nt. The ntp fragment was subcloned into M13mp18 and sequenced in both directions by the deoxy/dideoxy chaintermination method (Sanger et al., 1977) using [“%]dATP and the SequenaseTM kit (USB, Cleveland, OH). Analysis of the nrp gene fragment and its predicted aa sequence was performed using the SEQFIX and ANALYSEQ suite of programmes of Staden (1987) and the SEQH and SEQHP programmes on a VAX 11/750, VMS version 5.0 computer of the University of Adelaide.

(Fig. 1 legend, continued)

City, CA) and double-digested with BamHI and one of a range of other restriction endonucleases (ApaI, BglII, BstEII, HindIII, KpnI,NueI,PstI,RsaI, SalI, SmnI, SmI, SryI,XhoI) which have three or less restriction sites in pGEX-1N (N. Samaras, personal communication, AMRAD Corp. Ltd., Melbourne, Australia) according to the manufacturer’s instructions (New England Biolabs, Beverly, MA).

218

intensity of the autoradiograph obtained (Fig. 3), suggested that, whilst the nrp gene is more than a single copy, there were probably less than five copies of it in the T. gondii genome. As mentioned in the INTRODUCTION, the native NTPase consists of four protein subunits, and it is possible that each copy of the gene encodes one of the four subunits. Evidence consistent with this hypothesis was obtained by restricting T. gondii genomic DNA with a range of enzymes, and hybridizing the Southern blots with the purified ntp gene fragment (Fig. 4). The murine DNA in lanes 12 and 13 of Fig. 4 was included to exclude the possib~ity that the cloned gene fragment was of murine origin, because there may have been some mouse contamination of the original NTPase fraction employed to produce the rabbit polyclonal antiserum used for the immunoscreening. The lack of hybridization with DNA in these two lanes and the strong signals with the T. gondii DNA in lanes l-l 1, confirm that the cloned gene fragment encodes an

Fig. 3. Quantitation of ntp in T. gondii genomicDNA. 5 pg of T. go&i DNA (lane A) or the indicated genome equivalents of pGEX-IN containing the ntg fragment, plus 51.rg of salmon sperm DNA, were digested with BarnHI and resolved on a 1% agarose gel. The DNAs were transferred to nylon membrane and hybridized with 32P-labelled and purified n&efragment.

antigenic portion of T. gondii NTPase. ApaI and Hind111 had no restriction sites in the ntp gene. BarnHI, KpnI, 22~1,XhoI and PstI, appeared to cut the gene at only one site generating two hybridization bands, suggesting that all copies of the ntp gene are homogen~us for these enzymes. However, EcoRI, NueI, and B&E11 produced at least live, four and four hybridization bands, respectively. The findings with these latter three enzymes are consistent with the hypothesis that ntp is tandemly repeated over a large length of DNA. In addition, because there are more than two bands for each ofthese three enzymes, it is possible that the tandemly repeated copies of ntp are heterogeneous for these specific restriction sites. Because there are only a few copies (less than five) of ntp in the T. gondii genome, and the NTPase constitutes about 8% of the total protein of the tachyzoite (A& et al., 1987), we anticipated a great abundance of the NTPase mRNA in the T. gondii poly(A) + RNA. This was indeed the case (Fig. 5). A distinct hybridization band could be detected after as

Fig. 4. Southern-blot analysis of the nrp gene of T. gondii. 5 pg of T. gondii genomic DNA was digested with a range of restriction enzymes, separated on 1% agarose gels and transferred to nylon membranes by standard techniques (Maniatis et al., 1982). The membranes were hybridized witb 32P-nick-transiated (Rigby et al., 1977) ntp gene fragment according to the method used by Johnson et al. (1986a). The nfp gene fragment was purified from pGEX-IN by excision with EcoRI, separation in agarose, and collection onto DEAE membranes. Lanes: 1, undigested; 2,ApaI; 3, BumHI; 4, EcoRI; 5, HindIII; 6, KpnI; 7, NaeI; 8, &I; 9, XhoI; IO, BsrEII; 11, &I; 12.5 pg undigested murine genomic DNA; 13,s pigBumHI-digested murine genomic DNA. Numbers on the left correspond to DNA markers in kb.

219

little as 1 h of x-ray exposure (not shown). The NTPase mRNA had a length of about 2800 nt, which is more than sticient to encode a 63-kDa protein. (d) Western blotting To confirm that the polyclonal rabbit anti-NTPase did react with the NTPase portion of the fusion protein, the glutathione-agarose-purified fusion protein and GST were analyzed on SDS-polyacrylamide gels (Fig. 6). GST appeared as one 25kDa band after Coomassie blue staining (Panel A, lane l), very similar to the theoretical size of 27.5 kDa (Smith and Johnson, 1988). The GST/NTPase fusion protein appeared as a major 50-kDa band and several smaller, much fainter, bands after Coomassie blue staining (Panel A, lane 2). Therefore, the NTPase part of the fusion protein appears to consist of a polypeptide of about 25 kDa. The ANALYSEQ programme calculated that the M, of the total predicted aa sequence of the ntp fragment was 20524, so the fusion protein we have obtained appears to consist of a translation of the entire gene fragment. However, the immunoscreening of the transferred polypeptides (Panel B, lane 2), shows that four of the smaller fainter bands on Coomassie blue staining do react significantly with the ~ti-NTPase antibody. These bands (about 42, 35, 33, and 30 kDa) are unlikely to be E. coli polypeptides, as the polyclonal rabbit anti-NTPase antibody was extensively adsorbed with E. cob. We,

Fig. 5. Northern-blot analysis of the nrp gene. 1 pg of T. go& poly(A) + RNA was electrophoresed on a 2.2 M formaldehyde/ 1.5% agarose gel, transferred to nylon membrane, and hybridized with 32P-labelled purified nrp gene fragment. 0 denotes or&in of the gel. Sixes are in kb.

therefore, believe that they are GST/NTPase fusion proteins, translation of which has ceased prematurely before the end of the gene fragment. Consistent with the specificity of the antibody, the polyclonal rabbit anti-NTPase did not react with the GST (Panel B, lane 1). (e) Conclusions The NTPase appears to play an important role in the biology of the parasite, being detectable early in infection in laboratory animals. However, the sera of

A t

6 2

1

2 em#

-0 -94 -67

-20 -F Fig. 6. Western-blot analysis of the NTPase fusion protein. The NTPase fusion protein was purified by absorption to glutathioneagarose beads as previously described (Smith and Jobnson, 1988). Briefly, cultures of E. cdi strain JM105 carrying either pGEX-IN or pGEX-lN/NTPase were grown at 37°C and induced by adding isopropyl-~-~-thiog~actop~~oside to a final concentration of 0.1 mM. Prior to lysis by brief sonication, the cells were harvested and resuspended in mouse tonicity phosphate-buffered saline pH 7.3 containing 1% Triton X-100. After centrifugation at 10000 x g for 5 min at 4”C, the supematant fluid was mixed with pre-swollen glutathione-agarose beads and the tision protein was eluted using 50mM Tris. HCl pH 8.0 containing 5 mM reduced glutathione. Glutathione-agarose puritied proteins were resolved on 0.1% SDS-IO% polyac~l~de gels as described elsewhere (Johnson et al., 1981), and stained with Coomassie blue (panel A), or transferred to nitrocellulose as described by Towbin et al. (1979) and reacted with polyclonal rabbit anti-NTPase antibody diluted 1: 500 in TBST. (Panel B) Lanes: 1, GST; 2, GST/NTPase fusion protein. Numbers on the right indicate molecular size standards (kDa). 0 denotes origin; F denotes front.

220

human patients are often not tested for evidence of toxoplasmosis until weeks or months after the onset of the disease. In these cases, tests to measure antibodies to NTPase would be a useful alternative, or addition, to the detection of NTPase itself. To obtain the ~tigenic portion of this protein in a pure, reproducible and inexpensive manner, we have cloned the gene fragment encoding an antigenic portion of NTPase into E. coli. The recombinant protein is now being used to ascertain its suitability as a diagnostic antigen in enzyme-linked immunosorbent assays for toxoplasmosis. In addition, the molecular analysis of the ntp reported here adds si~~cantly to our meager knowledge of the molecular biology of this important parasite of humans and domestic animals.

ACKNOWLEDGEMENTS

This work was supposed by a grant from the National Health and Medical Research Council of Australia. The material contained in this publication is covered by provisional patent No. PJ4995/89.

REFERENCES Asai, T., O’Sullivan, W.J. and Tatibana, M.: A potent nucleoside triphosphate hydrolase from the parasitic protozoan Toxoplasma gondff. J. Biol. Chem. 258 (1983) 6816-6822. Asai, T., Kanazawa, T., Kobayashi, S., Takeuchi, T. and Kim, T.: Do protozoa conceal a high potency of nucleoside triphosphate hydrolysis present in Toxoplasma gondii? Comp. B&hem. Physiol. 85B (1986) 365-367. Asai, T., Kim, T., Kobayashi, M. and Kojima, S.: Detection of nucleoside t~phosphate hydrolase as a circulating antigen in sera of mice infected with Toxoplasma gondii. Infect. Immun. 55 (1987) 1332-1335. Burg, J.L., Perelman, D., Kasper, L.H., Ware, P.L. and Boothroyd, J.C.: Molecular analysis of the gene encoding the major surface antigen of Toxoplasma gondii. J. Immunol. 141 (1988) 3584-3591. Gubler, U. and Hoffman, B.J.: A simple and very efficient method for generating cDNA libraries. Gene 25 (1983) 263-269. Heltinan, D.M., Feramisco, J.R., Fiddes, J.C., Thomas, G.P. and Hughes, S.H.: Identification of clones that encode chicken tropomyosin by direct immunological screening of a cDNA expression library. Proc. Natl. Acad. Sci. USA 80 (1983) 31-35. Helfman, D.M., Feramisco, J.R., Fiddes, J.C., Thomas, G.P. and Hughes, S.H.: Immunolo~c~ screening of cDNA expression libraries. Focus 6 (1984) 1-5.

Huynh, T.V., Young, R.A. and Davis, R.W.: Constructing and screening cDNA libraries in lgl0 and Lgtll. In Glover, D. (Ed.), DNA Cloning. A Practical Approach, Vol. 1. IRL Press, Oxford, 1985, pp.49-78. Johnson, A.M.: The antigen& structure of Toxopfasma gondii: a review. Pathology 17 (1985) 9-19. Johnson, A.M.: Comparison of dinucleotide frequency and codon usage in Toxoplasma and Plasmodfum: evolutionary implications. J. Mol. Evol. (199Ob) in press. Johnson, A.M.: Toxoplasma: biology, pathology and immunology. In Long, P.L. (Ed.), Coccidiosis of Man and Domestic Animals. CRC Press, Boca Raton, FL, 1990a, in press. Johnson, A.M., McDonald, P.J. and Neoh, S.: Molecular weight analysis of the major polypeptides and glycopeptides of Toxoplasma got&i. B&hem. Biophys. Res. Comma. 100 (1981) 934-943. Johnson, A.M., Dubey, J.P. and Dame, J.B.: Purification and characterization of Toxoplasmagondff tachyzoite DNA. Aust. J. Exp. Biol. Med. Sci. 64 (1986a) 351-355. Johnson, A.M., McDonald, P.J. and Illana, S.: Characterization and in vitro translation of Toxopfasma gondii ribonucleic acid. Mol. Biochem. Parasitol. 18 (1986b) 313-320. Johnson, K.S., Harrison, G.B.L., ~~towlers, M.W., O’Hoy, K.L., Cougle, W.G., Dumpster, R.P., Lawrence, S.B., Vinton, J.G., Heath, D.D. and Rickard, M.D.: Vaccination against ovine cysticercosis using a defined recombinant antigen. Nature 338 (1989) 585-587. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Nagel, SD. and Boothroyd, J.C.: ‘Ihe c(- and ~-tubulins of Toxoplasma gondii are encoded by sit@e copy genes conta~ing multiple introns. Mol. B&hem. Parasitol. 29 (1988) 261-273. Prince, J.B.N., Araujo, F.G., Remington, J.S., Burg, J.L., Boothroyd, J. and Sharma, S.D.: Cloning of cDNA’s encoding a 28 kilodalton antigen of Toxoplasma gondif. Mol. Biochem. Parasitol. 34 (1989) 3-14. Rigby, P.W.J., Dieckmann, M., Rhodes, C. and Berg, P.: Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 113 (1977) 237-251. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467. Smith, D.B. and Johnson, KS.: Single-step purification of polypeptides expressed in Escherfchia coli as fusions with glutathione S-transferase. Gene 67 (1988) 31-40. Staden, R.: Computer handling of DNA sequencing projects. In Bishop, M.J. and Rawlings, C.J. (Eds.), Nucleic Acid and Protein Sequence Analysis. A Practical Approach. IRL Press, Oxford, 1987, pp. 173-217. Towbin, H., Staehelin, T. and Gordon, J.: Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76 (1979) 4350-4354. Vaitukaitis, J.L.: Production of antisera with small doses of imm~ogen: multiple intradermal injections. Methods Enzymol. 73 (1981) 46-52.