- Email: [email protected]
Cloning, identification and characterization of a novel κ-carrageenase from marine bacterium Cellulophaga lytica strain N5-2
Accepted Manuscript Title: Cloning, identification and characterization of a novel κ-carrageenase from marine bacterium Cellulophaga lytica strain N5-2 Authors: Hongli Cui, Yuxin Peng, Bowen Zhao, Yuqing Liu, Fengjia Chen, Haige Wu, Ziang Yao PII: DOI: Reference:
S0141-8130(17)31768-3 http://dx.doi.org/doi:10.1016/j.ijbiomac.2017.07.071 BIOMAC 7879
To appear in:
International Journal of Biological Macromolecules
Received date: Revised date: Accepted date:
19-5-2017 10-7-2017 11-7-2017
Please cite this article as: Hongli Cui, Yuxin Peng, Bowen Zhao, Yuqing Liu, Fengjia Chen, Haige Wu, Ziang Yao, Cloning, identification and characterization of a novel -carrageenase from marine bacterium Cellulophaga lytica strain N5-2, International Journal of Biological Macromoleculeshttp://dx.doi.org/10.1016/j.ijbiomac.2017.07.071 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title: Cloning, identification and characterization of a novel κ-carrageenase from marine bacterium Cellulophaga lytica strain N5-2 Authors: Hongli Cui, Yuxin Peng, Bowen Zhao, Yuqing Liu, Fengjia Chen, Haige Wu, Ziang Yao* Author affiliations: School of Life Science and Technology, Dalian University, Dalian 116622, China Key Laboratory of Marine Biotechnology of Dalian City, Dalian 116622, China Key Laboratory of Glycolipid Metabolism of Liaoning Province, Dalian 116622, China Author address: School of Life Science and Technology, Dalian University, 10 Xuefu Street, Dalian Economic Technological Development Zone, Dalian, Liaoning, 116622, China *
Corresponding author.
Email: [email protected]; Tel.: +86-411-8740-2310; Fax.: +86-411-8740-3139.
1
Highlights A novel κ-carrageenase gene (Cly-κ-car) was cloned and heterologously expressed from marine bacterium Cellulophaga lytica strain N5-2. Recombinant Cly-κ-CAR (R-Cly-κ-CAR) had maximum specific activity of 620.08 U/mg at 35 °C, pH 7.0, 0.7 % κ-carrageenan and in the presence of 0.6 % NaCl. R-Cly-κ-CAR hydrolyzed κ-carrageenan into neo-κ-carraoctaose and neo-κ-carrahexaose. R-Cly-κ-CAR could be a valuable tool to produce high degree of polymerization κ-carrageenan oligosaccharides with various biological activities.
Abstract A novel κ-carrageenase gene (Cly-κ-car) was cloned and heterologously expressed from marine bacterium Cellulophaga lytica strain N5-2. The gene comprised an open reading frame of 1,488 bp encoding 495 amino acid residues. The deduced protein had a calculated molecular weight of 55.24 kDa with an estimated isoelectric point of 9.90. Multiple alignment analysis revealed that Cly-κ-CAR shared identity with κ-carrageenases from Zobellia sp. M-2 (46 %), Zobellia galactanivorans (42 %) and Rhodopirellula islandica (38 %). Recombinant Cly-κ-CAR (R-Cly-κ-CAR) had maximum specific activity of 620.08 U/mg at 35 °C, pH 7.0, 0.7 % κ-carrageenan and in the presence of 0.6 % NaCl. It retained >75 % of its initial activity after heat treatment below 35 °C for 2 h. More than 50 % of its activity was maintained after incubation at pH 5.0-8.0 and 4 °C for 6 h. The Km and Vmax values for κcarrageenan were 0.94 mg/ml and 13.42 mM/min/mg, respectively. Thin layer chromatographic analysis of the R-Cly-κ-CAR hydrolysis products revealed that the enzyme hydrolyzed κ-carrageenan into neo-κ-carraoctaose and neo-κ-carrahexaose. R-Cly-κ-CAR is a novel κ-carrageenase enzyme and could be a valuable tool to produce high degree of polymerization κ-carrageenan oligosaccharides with various biological activities. Key words: Carrageenase; Enzyme properties; Heterologous expression 2
1. Introduction Carrageenans are linear sulfated galactans extracted from certain species of red seaweed. Carrageenans share a common backbone of alternating α-1,3-linked β-D-galactopyranosyl and β-1,4-linked α-Dgalactopyranosyl units [1]; they are classified into three types: kappa (κ-), iota (ι-), and lambda (λ-), according to the number and position of sulfate substitutions, as well as the presence of a 3,6-anhydro bridge in α-l,4-linked galactose residues [1]. Carrageenans are widely utilized because of their excellent physical functional properties, such as thickening, gelling and stabilizing abilities [1]. However, the high molecular weight and poor tissue-penetrating ability of carrageenan polysaccharides have greatly limited their further application. Compared with ι- and λ-carrageenans, κ-carrageenan exhibited stronger antioxidant activities, which has attracted increasing interest in developing potential antioxidants [2]. Generally speaking, κ-carrageenan oligosaccharides (κ-COSs) are obtained from degradation of κ-carrageenan and defined as degree of polymerization from 1-5 [3]. In fact, most studies have demonstrated that 1-4 degree of polymerization κ-COSs, i.e., neo-κ-carraoctaose, neo-κcarrahexaose, neo-κ-carratetraose and neo-κ-carrabiose exhibit various biological and physiological activities, including antibacterial [4], antitumor [5], antioxidant [2], and antiangiogenic [6].
Carrageenases (κ-, ι-, and λ-) are important enzymes that play essential roles in producing COSs in enzymolysis technologies featuring high substrate specificity and mild reaction conditions. κCarrageenase (EC 3.2.1.83) belongs to family 16 of the glycoside hydrolases (GH16) and specifically cleaves the internal β (1-4) linkages of carrageenans, yielding a series of homologous even-numbered oligosaccharides. Although such enzymes have been purified from several marine bacteria, there are problems in utilizing native carrageenases: low enzyme production and activity, complex culture systems, and a mixture of products. Heterologous expression may be a key way to solving these problems. Some κ-carrageenases have been cloned and heterologously expressed, e.g., cgkZ from Zobellia sp. ZM-2 [7, 8], cgkX and cgkP from Pseudoalteromonas sp. QY203 [9, 10], cgkS from Shewanella sp. KZ7 [11], and cgkK142b from Pseudoalteromonas tetraodonis [12]. Different κcarrageenases possess diverse properties in terms of primary structure, enzymatic characteristics, and 3
productivity [7]. The main products of κ-carrageenan hydrolyzed by most recombinant κ-carrageenases (CgkX, CgkP, and CgkS) had a low degree of polymerization (neo-κ-carratetraose and neo-κcarrabiose), although Zobellia sp. ZM-2 CgkZ produced neo-κ-carrahexaose and neo-κ-carratetraose. Although our previous study has demonstrated that natural κ-carrageenases from Cellulophaga lytica strain N5-2 could hydrolyzed κ-carrageenan into neo-κ-carraoctaose and neo-κ-carrahexaose first, and then broke neo-κ-carraoctaose into neo-κ-carrabiose and neo-κ-carrahexaose [13]. However, recombinant κ-carrageenases producing neo-κ-carraoctaose have not been reported. Therefore, the discovery of novel κ-carrageenases for further utilization in industrial production and purification of higher degree of polymerization κ-COGs is important. In our previous work, a κ-carrageenan degrading bacterial strain, Cellulophaga lytica N5-2, was isolated from the sediment of a carrageenan production base [13]. The fermentation product of this strain could degrade κ-carrageenan. In the present study, we report the cloning and expression of a novel κ-carrageenase from C. lytica N5-2, Cly-κ-CAR, that belongs to the GH16 family. It could effectively degrade κ-carrageenan and yield neo-κ-carraoctaose and neo-κ-carrahexaose as the main products, thus it may have potential to produce high degree of polymerization κ-COGs in industry. 2. Materials and methods 2.1. Strains, plasmids, and culture conditions C. lytica strain N5-2 was now preserved in the China Center for Type Culture Collection (CCTCC no. 10892), Wuhan, China. Escherichia coli strains DH5(Gibco BRL) and BL21 (DE3) (Novagen, USA) were grown in Luria-Bertani (LB) medium. Plasmids pMD18-T (TaKaRa D101A, Dalian, China) and pET-28a(+) (Novagen) were used as cloning and expression vectors, respectively. The nucleotide sequence of the κ-carrageenase-encoding gene of C. lytica strain N5-2 has been deposited in GenBank with accession number KT156767. Purified food-grade κ-carrageenan was purchased from Lubao Biochemistry Co., Ltd. (Jinjiang, China). 2.2. Cloning of the Cly-κ-car gene C. lytica strain N5-2 during the exponential growth phase was harvested. Genomic DNA was isolated following the protocol described by Genomic DNA Extraction Kit (TaKaRa MiniBEST Bacteria 4
Genomic DNA Extraction Kit, TaKaRa, Code NO. 9763). Nuclear acids were quantified by NanoDrop 2000c (Thermo Scientific, USA). DNA solution was stored at -80 °C, if not immediately used. Two pairs of primers (2915-F1/2915-R1 and 2915-F2/2915-R2; Table 1) were designed using PrimerBLAST with reference to three carrageenase genes in the complete genome sequence of C. lytica DSM 7489 (GenBank accession no. NC_015167; Supplementary Table 1). All primers were biosynthesized by Sangon Biotech (Shanghai, China). PCR amplifications were conducted with TaKaRa LA Taq® (TaKaRa DRR002A) according to the manufacturer’s instructions were processed with the following parameters: initial denaturation at 94 °C for 5 min followed by 35 cycles of 94 °C for 30 s, 52-56 °C (according to the Tm value of primers, Tm-5) for 30 s, and 72 °C for 1 min (according to the length of products, 1,000 bp / min), with a final extension at 72 °C for 7 min and cooling to 4 °C. The PCR products were resolved by electrophoresis on 1% agarose gel. Then the fragment of interest was excised and purified using an agarose gel DNA fragment recovery kit (TaKaRa D823A, Dalian, China). The fragment was cloned into pMD-18T and sequenced (Sangon, Shanghai, China). 2.3. Bioinformatic analyses The theoretical molecular weight (Mw) and isoelectronic point (pI) of Cly-κ-CAR protein were computed using the ExPASy Compute pI/Mw tool (http://web.expasy.org/computepi). Transmembrane regions were predicted by the "DAS"-Transmembrane Prediction Server (http://mendel.imp.ac.at/sat/DAS/DAS.html). Prediction of signal peptides was conducted using the SignaIP Server 4.0 (http://www.cbs.dtu.dk/services/SignalP). Cly-κ-CAR protein and other known κcarrageenases were aligned using ClustalW. Maximum likelihood phylogenetic trees of some carrageenases were constructed using PhyML. 2.4. Heterologous expression, purification and zymogram analysis of recombinant Cly-κ-CAR Cly-κ-car gene encoding only mature protein was amplified using the primers Cly-κ-car-F1/Cly-κ-carR1 (Table 1). The sequenced products and pET-28a(+) were digested with EcoR I and Xho I and then were ligated and transformed into E. coli BL21 (DE3) competent cells. Transformed E. colipET28a(+)-Cly-κ-car cells, were grown at 37 °C in LB medium containing 30 μg/ml kanamycin until the OD600 reached 0.4-0.6, and then IPTG was added to a final concentration of 0.1 mM. Cultivation was continued at 18 °C and 120 g for 24 h. Cells were harvested by centrifugation (6,000 × g, 10 min), 5
resuspended in 20 mM sodium phosphate buffer containing 5 mM imidazole, 0.2 mg/ml lysozyme, 20 μg/ml DNase and 1 mM MgCl2, and then disrupted by ultrasonication. The supernatant was obtained by centrifugation (10,000 × g, 30 min). The recombinant proteins were purified by loading into a Nisepharose 6FF column (GE Healthcare, USA). His-tagged target proteins were eluted with imidazole at concentrations ranging from 50 to 300 mM in 20 mM sodium phosphate buffer. The purity and molecular weight of R-Cly-κ-CAR were determined using 12 % sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Zymography electrophoresis was applied to test RCly-κ-CAR: a separating gel (15 %) was prepared by adding 0.2 % κ-carrageenan; the content of other reagents was as same as in normal SDS-PAGE. After electrophoresis, the separating gel was renaturated in renaturation solution (0.05 M Tris-HCl, 0.2 M NaCl, 0.01 M CaCl2, 1 % TritonX-100, pH 7.0) at 35 °C for 5 h, then stained with 0.1% alcian blue (in 0.1 M HCl, pH 1.0). 2.5. Activity assay and kinetic study of R-Cly-κ-CAR The enzymatic activity was assayed by measuring the concentration of reducing sugar produced using the dinitrosalicylic (DNS) method of Miller. R-Cly-κ-CAR enzyme solution (100 μl) was incubated with 900 μl substrate solution consisting of 0.2 % (w/v) κ-carrageenan in 20 mM phosphate buffer (pH 7.0) at 35 °C for 30 min. After incubation, 1,000 μl of modified 3,5-dinitrosalicylic acid reagent was added to the solution, and the mixture was heated for 5 min in a boiling water bath and then cooled in ice water. When the sample was cooled, 5 ml of deionized water was added and the absorption at 520 nm was measured in a (NewCentury-T6) spectrophotometer (Purkinje General Instrument Co., Ltd., Beijing, China). One unit of enzyme (U) was defined as the amount of protein needed to release 1 μM reducing sugar (measured as D-galactose) per min. The initial reaction rate of the enzyme was assayed at various concentrations of κ-carrageenan (0.5-10 mg/100 ml) by the DNS method at 35 °C and pH 7.0 for 30 min. The Michaelis constant (Km) and the reaction rate at infinite substrate concentration (Vmax) were determined from Lineweaver-Burk plots. 2.6. Characterization of R-Cly-κ-CAR The optimum temperature for R-Cly-κ-CAR activity was determined under the standard assay condition by varying the incubation temperature from 25 to 50 °C. The thermal stability of R-Cly-κCAR was tested by incubating the enzyme solution at each temperature (25-50 °C) for 0.5 to 2.5 h and 6
then measuring the residual enzyme activity. The effect of pH on R-Cly-κ-CAR activity was assayed at pH 4.0-5.0 (20 mM Na2HPO4-citric acid buffer) or at pH 6.0-8.0 (20 mM sodium phosphate buffer) or at pH 9.0 (20 mM Gly-NaOH buffer), respectively. The pH stability of the R-Cly-κ-CAR was determined by pre-incubating the enzyme solution at each pH (4.0-9.0) at 4 °C for 6 h, respectively, and then the enzyme activity was determined in the same pH buffer. The activity of untreated enzyme was regarded as 100 % and relative activity was determined. For the analyses of substrate specificities, κ-, ι-, λ-carrageenan and agar were respectively used as substrates. To discover the effects of ions and chemical reagents on enzyme activity, the enzyme assay was performed in the presence of Na+ (0-250 mM), K+ (10-100 mM), Li+ (1 mM), Mg2+ (1 mM), Ca2+ (1 mM), EDTA (1 mM) and SDS (1 mM), respectively. Reaction systems without addition of ions/chemical reagents were used as controls. 2.7. Analysis of reaction products and hydrolytic pattern Enzymatic hydrolysis of κ-carrageenan was conducted in standard conditions with 0.7 % κ-carrageenan as the substrate, by incubating for 0 min and 6, 12, 24, 48, and 72 h, respectively. Then, the solution mixture was boiled for 10 min and centrifuged at 10,000 × g for 10 min to remove insoluble materials. The reaction products were analyzed by thin-layer chromatography (TLC) with the developing agent composed of butanol-acetic-acid-water (2:1:1, v/v/v) and the saccharide was visualized with a diphenylamine-aniline-phosphate reagent, as described previously [10]. 3. Results and discussion 3.1. Cloning and bioinformatic analysis of Cly-κ-CAR The ORF consisted of 1,488 bp, encoding 495 deduced amino acid residues including a putative signal peptide (Fig. 1); SignaIP 4.0 analysis showed that the most probable cleavage site of the signal peptide was between residues Gly45 and Gln46. "DAS"-Transmembrane Prediction Server analysis suggested that a helical transmembrane motif was located in residues 25-40. The mature protein had a calculated molecular weight of 49.96 kDa and a pI of 9.17. Except for an uncharacterized κ-carrageenase (Celly_2915, from C. lytica), the highest identity of Cly-κ-CAR was 46 % with a κ-carrageenase from Zobellia sp. M-2 (GenBank AGS43006). Multiple alignment analysis (Fig. 2) showed that seventeen active sites (Lys124-Cly164-Val165-Cys166-Pro167-Ser168-Phe169-Trp170-Glu188-Asp190-Glu1937
Asp215-Asn219-Leu220-Lys270-Ser299-Gly301) and three catalytic sites (Glu159-Asp161-Glu164; Fig. 2) were found within 495 aa of Cly-κ-CAR. Among them, three key sites, including the κcarrageenan binding site signatures (black and green boxes) and the active site (red box), were conserved in Cly-κ-car (Fig. 2). A phylogenetic tree was constructed for some predicted and functional identified κ-carrageenases from different bacterial organisms (Fig. 3). Cly-κ-CAR, Celly_2915 (GenBank YP_004263603), CgkA (GenBank YP_004734701), and CgkZ (GenBank AGS43006) formed a deeply monophyletic group (bootstrap support 99 %) when β-agarase from C. lytica DSM 7489 was used as outgroup. The relationships displayed in κ-carrageenases are consistent well with the traditional taxonomy of bacteria organisms. Although different carrageenases have notable distinctions in their primary structures, they usually feature a common catalytic motif [7]. The conserved domain EIDVVE was detected in Cly-κ-CAR (Fig. 2), which is consistent with the characteristic motif E(I/L/V)D(I/V/A/F)(V/I/L/M/F)(0,1)E. 3.2. Expression, productivity, and purification of recombinant Cly-κ-CAR (R-Cly-κ-CAR) R-Cly-κ-CAR was purified to homogeneity with a specific activity of 620.08 U/mg and a final yield of 88 %. As Fig. 4 shows, a single band with an apparent molecular weight of ∼50 kDa was observed on SDS-PAGE, which was in accordance with the calculated. Zymography results further verified that RCly-κ-CAR could degrade κ-carrageenan (Fig. 4). The purified enzyme aggregated into a single band with an apparent molecular weight of ∼50 kDa on SDS-PAGE (Fig. 4). As calculated from Lineweaver-Burk plots, the apparent Km and Vmax values were 0.94 mg/ml and 13.42 mM/min/mg, respectively, similar to those of CgkZ from Zobellia sp. ZM-2 [7, 8]. 3.3. Biochemical characterization of R-Cly-κ-CAR R-Cly-κ-CAR was most active at 35 °C and pH 7.0 in 20 mM phosphate buffer (Fig. 5a and 5c). It retained >75 % of its original activity after incubation below 35 °C for 2 h (Fig. 5b). The optimal temperature for R-Cly-κ-CAR activity was similar to the 36-42 °C observed for CgkZ [4] and lower than the 55 °C reported for CgkX [10]. The enzyme was stable between pH 5.0 and 8.0 (Fig. 5d). More than 50 % of the original activity was maintained after treating the enzyme at pH 5.0–8.0 and 4 °C for 6 h (Fig. 5d), which is consistent with most reports for κ-carrageenases (range from 6.0 to 8.0) [7-9, 12, 13]. R-Cly-κ-CAR showed strict substrate specificity since it was active only toward κ-carrageenan but 8
not ι- or λ-carrageenan, or any other polysaccharides such as agar, alginate, cellulose and starch (data not shown). The optimum concentration of κ-carrageenan was 0.7 % (Fig. 5e). The active of R-Cly-κCAR was in a positive concentration-dependent manner from 0.1-0.7 % and decreased when the concentration was higher than 0.7 %. Under low temperature or high concentration conditions, carrageenan is gelatinous and viscous which impeded the binding efficiency between enzyme (R-Cly-κCAR) and substrate (κ-carrageenan). Further detail information is necessary to test this hypothesis. The R-Cly-κ-CAR activity was enhanced in a concentration-dependent manner in the presence of NaCl from 0.2 to 0.6 % (Fig. 5f). Enhancement by 0.6 % NaCl was higher than the enhancing NaCl concentration observed for κ-carrageenase from Pseudoalteromonas sp. AJ5-13 (0.3 %) [14], and lower than those for Z. galactanovorans (0.9 %) [15] and Zobellia sp. ZM-2 (0.7 %) [7]. The presence of NaCl inhibited the activity of the κ-carrageenases from P. porphyrae LL1 [16] and Tamlana sp. HC4 [17]. R-Cly-κ-CAR activity was strongly inhibited by EDTA (1 mM), SDS (1 mM), and KCl (10-100 mM) (Table 2). At 1 mM, CaCl2, MgCl2 and LiCl had almost no effect on the enzyme activity (Table 2). 3.4. Analysis of hydrolytic pattern and products of R-Cly-κ-CAR After completion of κ-carrageenan hydrolysis by R-Cly-κ-CAR, the degradation products were analyzed by TLC at various time points. The main end products were neo-κ-carraoctaose and neo-κcarrahexaose (Fig. 6a), which are different from the degradation products of C. lytica N5-2 (Fig. 6b) [13]. It was surprising that neo-κ-neocarrabiose was not detected, suggesting that neo-κ-carraoctaose was not broken down into neo-κ-carrabiose and neo-κ-carrahexaose by R-Cly-κ-CAR. Further detailed information is required to fully explain these observations. Most main products of κ-carrageenan hydrolysis by recombinant κ-carrageenases (CgkX, CgkP, and CgkS) had a low degree of polymerization [9-11]. Therefore, R-Cly-κ-CAR could be a valuable tool for the production of higher degree of polymerization κ-COGs. Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 81671243 and 81373429). Conflicts of interest 9
The authors declare no conflict of interest. Author contributions ZA. Yao conceived and designed the experiments; YX. Peng, BW. Zhao and YQ. Liu performed the experiments; HL. Cui and FJ. Chen analyzed the data; HG.Wu contributed wrote the paper.
Addition information text Supplementary material Table 1 Genes encoding carrageenases in Cellulophaga lytica DSM 7489.
10
References [1] V.L. Campo, D.F. Kawano, D.B.D. Silva, I. Carvalho, Carbohydr. Polym. 77 (2009) 167-180. [2] Y. Sun, B. Yang, Y. Wu, Y. Liu, X. Gu, H. Zhang, C. Wang, H. Cao, L. Huang, Z. Wang, Food. Chem. 178 (2015) 311-318. [3] G. Yu, H. Guan, A.S. Ioanoviciu, S.A. Sikkander, C. Thanawiroon, J.K. Tobacman, T. Toida, R.J. Linhardt, Carbohydr Res. 337 (2002) 433-40. [4] F. Wang, Z. Yao, H. Wu, S. Zhang, N. Zhu, X. Gai, Appl. Mech. Mater. 2 (2011) 194-199. [5] H. Yuan, J. Song, X. Li, N. Li, J. Dai, Cancer Lett. 243 (2006) 228-234. [6] Z. Yao, H. Wu, S. Zhang, Y. Du, Carbohydr. Polym. 101 (2014) 359-367. [7] Z. Liu, G. Liu, H. Mou, Appl. Microbiol. Biot. 97 (2013) 1301-1307. [8] Z. Liu, L. Tian, Y. Chen, H. Mou, J. Biotechnol. 185 (2014) 8-14. [9] S. Li, L. Wang, W. Yu, F. Han, J. Ocean. U. China. 12 (2013) 155-159. [10] X. Xu, S. Li, X. Yang, W. Yu, H. Feng, J. Ocean. U. China. 14 (2015) 1082-1086. [11] L. Wang, S. Li, S. Zhang, J. Li, W. Yu, Q. Gong, J. Ocean. U. China. 14 (2015) 759-763. [12] T. Kobayashi, K. Uchimura, O. Koide, S. Deguchi, K. Horikoshi, Biosci. Biotech. Bioch. 76 (2012) 506-511. [13] Z. Yao, F. Wang, Z. Gao, L. Jin, H. Wu, Int. J. Mol. Sci. 14 (2013) 24592-24602. [14] Y. MA,S. Dong, X. Jiang, J. Li, H. Mou, J. Food. Biochem. 34 (2010) 661-678. [15] G. Michel, N.C. Pi, T. Barbeyron, M. Czjzek, W. Helbert, Appl. Microbiol. Biot. 71 (2006) 23-33 [16] G. Liu, Y. Li, Z. Chi, Process. Biochem. 46 (2011) 265-271. [17] F. Sun, Y. Wang, Q. Liu, Chin. J. Oceanol. Limnol. 49 (2009) 1139-1145.
11
Figure legends Fig. 1. The nucleotide and deduced amino acid sequence of Cly-κ-CAR from Cellulophaga lytica strain N5-2. The underlined letters indicate the start codon (ATG) and the stop codon (TAG). The predicted signal peptide sequence is indicated by gray amino acids. N-glycosylation and O-glycosylation sites are indicated by yellow and pink amino acids, respectively. The three conserved domains involved in the catalytic mechanism of κ-carrageenase proteins are underlined, including grayish-blue (GVCPSFW) and green (three conserved Arg) residues involved in κ-carrageenan binding, and red residues (EIDVVE) at the active site. Fig. 2. Multiple alignment of the deduced amino acid sequence of Cly-κ-CAR from Cellulophaga lytica strain N5-2 and functionally characterized κ-carrageenases from other organisms: AGS43006, Zobellia sp. M-2; YP_004734701, Zobellia galactanivorans; YP_004263603, Cellulophaga lytica; WP_008655792, Rhodopirellula europaea; WP_007339445, Rhodopirellula baltica; BAJ61957, Pseudoalteromonas tetraodonis; CGKA_PSEVC, Pseudoalteromonas carrageenovora; ADD92366, Pseudoalteromonas sp. LL1; ADE53467, Coraliomargarita akajimensis; and GAF02139, Cytophaga fermentans. Seventeen columns marked with colored boxes (black, red, and green) indicate key residues, among which the three red boxes represent catalytic residues (E-D-x-x-E). The blue columns indicate regions of high amino acid identity. Fig. 3. Phylogenetic analysis of κ-carrageenase Cly-κ-car. Glycoside hydrolase family 16 κcarrageenase protein sequences were aligned using the Clustal W program and the tree was constructed with the maximum-likelihood method using PHYML software. Note: the red circle indicates the Cly-κcar sequence from C. lytica strain N5-2. Different κ-carrageenases from various organisms are indicated by distinct colors. The β-agarase from C. lytica DSM 7489 was used as the root of the phylogenetic tree. Fig. 4. SDS-PAGE, zymogram and purification of R-Cly-κ-CAR. Lane M, molecular weight markers; Lane 1, R-Cly-κ-CAR expression induced in E. coli BL21 by IPTG at 6 h; Lane 2, R-Cly-κ-CAR expression induced by IPTG at 8 h; Lane 3, R-Cly-κ-CAR induced by IPTG at 24 h; Lane 4, zymogram of R-Cly-κ-CAR; Lane 5, unpurified R-Cly-κ-CAR; Lane 6, purified R-Cly-κ-CAR. Note: the target protein is indicated by red boxes. 12
Fig. 5. Effects of temperature, pH and concentration of substrate and NaCl on the activity and stability of R-Cly-κ-CAR. Data are shown as means ± SD (n = 3). a. The optimal temperature of R-Cly-κ-CAR was determined by measuring the activity in 20 mM sodium phosphate buffer (pH 7.0) at 25-50 °C. b. Thermal stability of R-Cly-κ-CAR. c. The optimal pH of R-Cly-κ-CAR, determined at 35 °C. d. The pH stability of R-Cly-κ-CAR. e. The optimal substrate concentration of R-Cly-κ-CAR determined at 35 °C and pH 7.0. f. The optimal concentration of NaCl for activity determined at 35 °C and pH 7.0. Fig. 6. Thin layer chromatographic analysis of degradation products. a. Enzymatic hydrolysis of κcarrageenan by R-Cly-κ-CAR was conducted in standard conditions for 0 min (1); 6 h (2); 12 h (3); 24 h (4); 48 h (5); and 72 h (6). The degradation products of C. lytica strain N5-2 for 72 h were used as a control sample. b. Enzymatic hydrolysis of κ-carrageenan by C. lytica N5-2 was conducted in standard conditions for 5 min (8); 30 min (9); 1 h (10); 2 h (11); 3 h (12); 6 h (13); 9 h (14); 12 h (15); 24 h (16), 48 h (17), 60 h (18) and 72 h (19). M, marker (galactose). Combined with HPLC and mass spectrometry results (our previous published results), c, d and e were assigned as neo-κ-carraoctaose, neo-κ-carrahexaose and neo-κ-carrabiose respectively.
13
Fig. 1.
14
Fig. 2.
15
Fig. 3.
Fig. 4.
16
Fig. 5.
Fig. 6.
17
Table legends Table 1 Primers used in this study (bp: base pairs). Note: the underlined sequences GAATTC and CTCGAG represent the restriction sites of EcoR I and Xho I, respectively. Cly-κ-car-F1/Cly-κ-car-R1 was used to amplify the κ-carrageenase gene without the predicted signal peptide. Table 2 Effects of chemicals (salt ions, metal ions, surfactants and chelators) on the activity of R-Clyκ-CAR. Notes: Activity without addition of chemicals was defined as 100 %. Data are shown as means ± SD (n = 3).
18
Table 1 Primers used in this study (bp: bases pair). Note: the underlined bp stands for EcoR I and Xho I restriction enzyme cutting site, respectively. Note: The underlined sequences GAATTC and CTCGAG represented the restriction sites of EcoR I and Xho I, respectively. Cly-κ-car-F1/Cly-κ-car-R1 was used to amplified the κ-carrageenase gene sequence without signal peptide. Primer name
Primer sequences (5→3)
2915-F1 2915-R1 2915-F2 2915-R2 Cly-κ-car-F1 Cly-κ-car-R1
AGATTGTGATGTGGGTGGCT ACAGTCCAATAGCATTCTGGCA TCTTGCTTCGCTACCAGCTC CACTTCCCTCCTACGTCGTT GAATTCCAAACATCTAATCCGAATGATAATT CTCGAGCTATTGAATAAGCAGTTGTTTTG
Size (bp) 20 22 20 20 31 29
Product (bp) 3, 096 3, 096 2, 529 2, 529 1, 353 1, 353
Table 1 Effects of chemicals (salt ions, metal ions, surfactants and chelators) on the activity of R-Clyκ-CAR. Notes: Activity without addition of chemicals was defined as 100 %. Data were shown as means ± SD (n=3).
Additives Control KCl KCl KCl CaCl2 MgCl2 LiCl SDS EDTA
Concentration (mM)
Relative activity (%) 100±1.23 72.87±1.64 25.6±0.57 23.6±0.32 100.51±3.31 98.12±2.65 99.47±2.32 22.71±0.98 30.65±1.23
10 50 100 1 1 1 1 1
19
S0141-8130(17)31768-3 http://dx.doi.org/doi:10.1016/j.ijbiomac.2017.07.071 BIOMAC 7879
To appear in:
International Journal of Biological Macromolecules
Received date: Revised date: Accepted date:
19-5-2017 10-7-2017 11-7-2017
Please cite this article as: Hongli Cui, Yuxin Peng, Bowen Zhao, Yuqing Liu, Fengjia Chen, Haige Wu, Ziang Yao, Cloning, identification and characterization of a novel -carrageenase from marine bacterium Cellulophaga lytica strain N5-2, International Journal of Biological Macromoleculeshttp://dx.doi.org/10.1016/j.ijbiomac.2017.07.071 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title: Cloning, identification and characterization of a novel κ-carrageenase from marine bacterium Cellulophaga lytica strain N5-2 Authors: Hongli Cui, Yuxin Peng, Bowen Zhao, Yuqing Liu, Fengjia Chen, Haige Wu, Ziang Yao* Author affiliations: School of Life Science and Technology, Dalian University, Dalian 116622, China Key Laboratory of Marine Biotechnology of Dalian City, Dalian 116622, China Key Laboratory of Glycolipid Metabolism of Liaoning Province, Dalian 116622, China Author address: School of Life Science and Technology, Dalian University, 10 Xuefu Street, Dalian Economic Technological Development Zone, Dalian, Liaoning, 116622, China *
Corresponding author.
Email: [email protected]; Tel.: +86-411-8740-2310; Fax.: +86-411-8740-3139.
1
Highlights A novel κ-carrageenase gene (Cly-κ-car) was cloned and heterologously expressed from marine bacterium Cellulophaga lytica strain N5-2. Recombinant Cly-κ-CAR (R-Cly-κ-CAR) had maximum specific activity of 620.08 U/mg at 35 °C, pH 7.0, 0.7 % κ-carrageenan and in the presence of 0.6 % NaCl. R-Cly-κ-CAR hydrolyzed κ-carrageenan into neo-κ-carraoctaose and neo-κ-carrahexaose. R-Cly-κ-CAR could be a valuable tool to produce high degree of polymerization κ-carrageenan oligosaccharides with various biological activities.
Abstract A novel κ-carrageenase gene (Cly-κ-car) was cloned and heterologously expressed from marine bacterium Cellulophaga lytica strain N5-2. The gene comprised an open reading frame of 1,488 bp encoding 495 amino acid residues. The deduced protein had a calculated molecular weight of 55.24 kDa with an estimated isoelectric point of 9.90. Multiple alignment analysis revealed that Cly-κ-CAR shared identity with κ-carrageenases from Zobellia sp. M-2 (46 %), Zobellia galactanivorans (42 %) and Rhodopirellula islandica (38 %). Recombinant Cly-κ-CAR (R-Cly-κ-CAR) had maximum specific activity of 620.08 U/mg at 35 °C, pH 7.0, 0.7 % κ-carrageenan and in the presence of 0.6 % NaCl. It retained >75 % of its initial activity after heat treatment below 35 °C for 2 h. More than 50 % of its activity was maintained after incubation at pH 5.0-8.0 and 4 °C for 6 h. The Km and Vmax values for κcarrageenan were 0.94 mg/ml and 13.42 mM/min/mg, respectively. Thin layer chromatographic analysis of the R-Cly-κ-CAR hydrolysis products revealed that the enzyme hydrolyzed κ-carrageenan into neo-κ-carraoctaose and neo-κ-carrahexaose. R-Cly-κ-CAR is a novel κ-carrageenase enzyme and could be a valuable tool to produce high degree of polymerization κ-carrageenan oligosaccharides with various biological activities. Key words: Carrageenase; Enzyme properties; Heterologous expression 2
1. Introduction Carrageenans are linear sulfated galactans extracted from certain species of red seaweed. Carrageenans share a common backbone of alternating α-1,3-linked β-D-galactopyranosyl and β-1,4-linked α-Dgalactopyranosyl units [1]; they are classified into three types: kappa (κ-), iota (ι-), and lambda (λ-), according to the number and position of sulfate substitutions, as well as the presence of a 3,6-anhydro bridge in α-l,4-linked galactose residues [1]. Carrageenans are widely utilized because of their excellent physical functional properties, such as thickening, gelling and stabilizing abilities [1]. However, the high molecular weight and poor tissue-penetrating ability of carrageenan polysaccharides have greatly limited their further application. Compared with ι- and λ-carrageenans, κ-carrageenan exhibited stronger antioxidant activities, which has attracted increasing interest in developing potential antioxidants [2]. Generally speaking, κ-carrageenan oligosaccharides (κ-COSs) are obtained from degradation of κ-carrageenan and defined as degree of polymerization from 1-5 [3]. In fact, most studies have demonstrated that 1-4 degree of polymerization κ-COSs, i.e., neo-κ-carraoctaose, neo-κcarrahexaose, neo-κ-carratetraose and neo-κ-carrabiose exhibit various biological and physiological activities, including antibacterial [4], antitumor [5], antioxidant [2], and antiangiogenic [6].
Carrageenases (κ-, ι-, and λ-) are important enzymes that play essential roles in producing COSs in enzymolysis technologies featuring high substrate specificity and mild reaction conditions. κCarrageenase (EC 3.2.1.83) belongs to family 16 of the glycoside hydrolases (GH16) and specifically cleaves the internal β (1-4) linkages of carrageenans, yielding a series of homologous even-numbered oligosaccharides. Although such enzymes have been purified from several marine bacteria, there are problems in utilizing native carrageenases: low enzyme production and activity, complex culture systems, and a mixture of products. Heterologous expression may be a key way to solving these problems. Some κ-carrageenases have been cloned and heterologously expressed, e.g., cgkZ from Zobellia sp. ZM-2 [7, 8], cgkX and cgkP from Pseudoalteromonas sp. QY203 [9, 10], cgkS from Shewanella sp. KZ7 [11], and cgkK142b from Pseudoalteromonas tetraodonis [12]. Different κcarrageenases possess diverse properties in terms of primary structure, enzymatic characteristics, and 3
productivity [7]. The main products of κ-carrageenan hydrolyzed by most recombinant κ-carrageenases (CgkX, CgkP, and CgkS) had a low degree of polymerization (neo-κ-carratetraose and neo-κcarrabiose), although Zobellia sp. ZM-2 CgkZ produced neo-κ-carrahexaose and neo-κ-carratetraose. Although our previous study has demonstrated that natural κ-carrageenases from Cellulophaga lytica strain N5-2 could hydrolyzed κ-carrageenan into neo-κ-carraoctaose and neo-κ-carrahexaose first, and then broke neo-κ-carraoctaose into neo-κ-carrabiose and neo-κ-carrahexaose [13]. However, recombinant κ-carrageenases producing neo-κ-carraoctaose have not been reported. Therefore, the discovery of novel κ-carrageenases for further utilization in industrial production and purification of higher degree of polymerization κ-COGs is important. In our previous work, a κ-carrageenan degrading bacterial strain, Cellulophaga lytica N5-2, was isolated from the sediment of a carrageenan production base [13]. The fermentation product of this strain could degrade κ-carrageenan. In the present study, we report the cloning and expression of a novel κ-carrageenase from C. lytica N5-2, Cly-κ-CAR, that belongs to the GH16 family. It could effectively degrade κ-carrageenan and yield neo-κ-carraoctaose and neo-κ-carrahexaose as the main products, thus it may have potential to produce high degree of polymerization κ-COGs in industry. 2. Materials and methods 2.1. Strains, plasmids, and culture conditions C. lytica strain N5-2 was now preserved in the China Center for Type Culture Collection (CCTCC no. 10892), Wuhan, China. Escherichia coli strains DH5(Gibco BRL) and BL21 (DE3) (Novagen, USA) were grown in Luria-Bertani (LB) medium. Plasmids pMD18-T (TaKaRa D101A, Dalian, China) and pET-28a(+) (Novagen) were used as cloning and expression vectors, respectively. The nucleotide sequence of the κ-carrageenase-encoding gene of C. lytica strain N5-2 has been deposited in GenBank with accession number KT156767. Purified food-grade κ-carrageenan was purchased from Lubao Biochemistry Co., Ltd. (Jinjiang, China). 2.2. Cloning of the Cly-κ-car gene C. lytica strain N5-2 during the exponential growth phase was harvested. Genomic DNA was isolated following the protocol described by Genomic DNA Extraction Kit (TaKaRa MiniBEST Bacteria 4
Genomic DNA Extraction Kit, TaKaRa, Code NO. 9763). Nuclear acids were quantified by NanoDrop 2000c (Thermo Scientific, USA). DNA solution was stored at -80 °C, if not immediately used. Two pairs of primers (2915-F1/2915-R1 and 2915-F2/2915-R2; Table 1) were designed using PrimerBLAST with reference to three carrageenase genes in the complete genome sequence of C. lytica DSM 7489 (GenBank accession no. NC_015167; Supplementary Table 1). All primers were biosynthesized by Sangon Biotech (Shanghai, China). PCR amplifications were conducted with TaKaRa LA Taq® (TaKaRa DRR002A) according to the manufacturer’s instructions were processed with the following parameters: initial denaturation at 94 °C for 5 min followed by 35 cycles of 94 °C for 30 s, 52-56 °C (according to the Tm value of primers, Tm-5) for 30 s, and 72 °C for 1 min (according to the length of products, 1,000 bp / min), with a final extension at 72 °C for 7 min and cooling to 4 °C. The PCR products were resolved by electrophoresis on 1% agarose gel. Then the fragment of interest was excised and purified using an agarose gel DNA fragment recovery kit (TaKaRa D823A, Dalian, China). The fragment was cloned into pMD-18T and sequenced (Sangon, Shanghai, China). 2.3. Bioinformatic analyses The theoretical molecular weight (Mw) and isoelectronic point (pI) of Cly-κ-CAR protein were computed using the ExPASy Compute pI/Mw tool (http://web.expasy.org/computepi). Transmembrane regions were predicted by the "DAS"-Transmembrane Prediction Server (http://mendel.imp.ac.at/sat/DAS/DAS.html). Prediction of signal peptides was conducted using the SignaIP Server 4.0 (http://www.cbs.dtu.dk/services/SignalP). Cly-κ-CAR protein and other known κcarrageenases were aligned using ClustalW. Maximum likelihood phylogenetic trees of some carrageenases were constructed using PhyML. 2.4. Heterologous expression, purification and zymogram analysis of recombinant Cly-κ-CAR Cly-κ-car gene encoding only mature protein was amplified using the primers Cly-κ-car-F1/Cly-κ-carR1 (Table 1). The sequenced products and pET-28a(+) were digested with EcoR I and Xho I and then were ligated and transformed into E. coli BL21 (DE3) competent cells. Transformed E. colipET28a(+)-Cly-κ-car cells, were grown at 37 °C in LB medium containing 30 μg/ml kanamycin until the OD600 reached 0.4-0.6, and then IPTG was added to a final concentration of 0.1 mM. Cultivation was continued at 18 °C and 120 g for 24 h. Cells were harvested by centrifugation (6,000 × g, 10 min), 5
resuspended in 20 mM sodium phosphate buffer containing 5 mM imidazole, 0.2 mg/ml lysozyme, 20 μg/ml DNase and 1 mM MgCl2, and then disrupted by ultrasonication. The supernatant was obtained by centrifugation (10,000 × g, 30 min). The recombinant proteins were purified by loading into a Nisepharose 6FF column (GE Healthcare, USA). His-tagged target proteins were eluted with imidazole at concentrations ranging from 50 to 300 mM in 20 mM sodium phosphate buffer. The purity and molecular weight of R-Cly-κ-CAR were determined using 12 % sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Zymography electrophoresis was applied to test RCly-κ-CAR: a separating gel (15 %) was prepared by adding 0.2 % κ-carrageenan; the content of other reagents was as same as in normal SDS-PAGE. After electrophoresis, the separating gel was renaturated in renaturation solution (0.05 M Tris-HCl, 0.2 M NaCl, 0.01 M CaCl2, 1 % TritonX-100, pH 7.0) at 35 °C for 5 h, then stained with 0.1% alcian blue (in 0.1 M HCl, pH 1.0). 2.5. Activity assay and kinetic study of R-Cly-κ-CAR The enzymatic activity was assayed by measuring the concentration of reducing sugar produced using the dinitrosalicylic (DNS) method of Miller. R-Cly-κ-CAR enzyme solution (100 μl) was incubated with 900 μl substrate solution consisting of 0.2 % (w/v) κ-carrageenan in 20 mM phosphate buffer (pH 7.0) at 35 °C for 30 min. After incubation, 1,000 μl of modified 3,5-dinitrosalicylic acid reagent was added to the solution, and the mixture was heated for 5 min in a boiling water bath and then cooled in ice water. When the sample was cooled, 5 ml of deionized water was added and the absorption at 520 nm was measured in a (NewCentury-T6) spectrophotometer (Purkinje General Instrument Co., Ltd., Beijing, China). One unit of enzyme (U) was defined as the amount of protein needed to release 1 μM reducing sugar (measured as D-galactose) per min. The initial reaction rate of the enzyme was assayed at various concentrations of κ-carrageenan (0.5-10 mg/100 ml) by the DNS method at 35 °C and pH 7.0 for 30 min. The Michaelis constant (Km) and the reaction rate at infinite substrate concentration (Vmax) were determined from Lineweaver-Burk plots. 2.6. Characterization of R-Cly-κ-CAR The optimum temperature for R-Cly-κ-CAR activity was determined under the standard assay condition by varying the incubation temperature from 25 to 50 °C. The thermal stability of R-Cly-κCAR was tested by incubating the enzyme solution at each temperature (25-50 °C) for 0.5 to 2.5 h and 6
then measuring the residual enzyme activity. The effect of pH on R-Cly-κ-CAR activity was assayed at pH 4.0-5.0 (20 mM Na2HPO4-citric acid buffer) or at pH 6.0-8.0 (20 mM sodium phosphate buffer) or at pH 9.0 (20 mM Gly-NaOH buffer), respectively. The pH stability of the R-Cly-κ-CAR was determined by pre-incubating the enzyme solution at each pH (4.0-9.0) at 4 °C for 6 h, respectively, and then the enzyme activity was determined in the same pH buffer. The activity of untreated enzyme was regarded as 100 % and relative activity was determined. For the analyses of substrate specificities, κ-, ι-, λ-carrageenan and agar were respectively used as substrates. To discover the effects of ions and chemical reagents on enzyme activity, the enzyme assay was performed in the presence of Na+ (0-250 mM), K+ (10-100 mM), Li+ (1 mM), Mg2+ (1 mM), Ca2+ (1 mM), EDTA (1 mM) and SDS (1 mM), respectively. Reaction systems without addition of ions/chemical reagents were used as controls. 2.7. Analysis of reaction products and hydrolytic pattern Enzymatic hydrolysis of κ-carrageenan was conducted in standard conditions with 0.7 % κ-carrageenan as the substrate, by incubating for 0 min and 6, 12, 24, 48, and 72 h, respectively. Then, the solution mixture was boiled for 10 min and centrifuged at 10,000 × g for 10 min to remove insoluble materials. The reaction products were analyzed by thin-layer chromatography (TLC) with the developing agent composed of butanol-acetic-acid-water (2:1:1, v/v/v) and the saccharide was visualized with a diphenylamine-aniline-phosphate reagent, as described previously [10]. 3. Results and discussion 3.1. Cloning and bioinformatic analysis of Cly-κ-CAR The ORF consisted of 1,488 bp, encoding 495 deduced amino acid residues including a putative signal peptide (Fig. 1); SignaIP 4.0 analysis showed that the most probable cleavage site of the signal peptide was between residues Gly45 and Gln46. "DAS"-Transmembrane Prediction Server analysis suggested that a helical transmembrane motif was located in residues 25-40. The mature protein had a calculated molecular weight of 49.96 kDa and a pI of 9.17. Except for an uncharacterized κ-carrageenase (Celly_2915, from C. lytica), the highest identity of Cly-κ-CAR was 46 % with a κ-carrageenase from Zobellia sp. M-2 (GenBank AGS43006). Multiple alignment analysis (Fig. 2) showed that seventeen active sites (Lys124-Cly164-Val165-Cys166-Pro167-Ser168-Phe169-Trp170-Glu188-Asp190-Glu1937
Asp215-Asn219-Leu220-Lys270-Ser299-Gly301) and three catalytic sites (Glu159-Asp161-Glu164; Fig. 2) were found within 495 aa of Cly-κ-CAR. Among them, three key sites, including the κcarrageenan binding site signatures (black and green boxes) and the active site (red box), were conserved in Cly-κ-car (Fig. 2). A phylogenetic tree was constructed for some predicted and functional identified κ-carrageenases from different bacterial organisms (Fig. 3). Cly-κ-CAR, Celly_2915 (GenBank YP_004263603), CgkA (GenBank YP_004734701), and CgkZ (GenBank AGS43006) formed a deeply monophyletic group (bootstrap support 99 %) when β-agarase from C. lytica DSM 7489 was used as outgroup. The relationships displayed in κ-carrageenases are consistent well with the traditional taxonomy of bacteria organisms. Although different carrageenases have notable distinctions in their primary structures, they usually feature a common catalytic motif [7]. The conserved domain EIDVVE was detected in Cly-κ-CAR (Fig. 2), which is consistent with the characteristic motif E(I/L/V)D(I/V/A/F)(V/I/L/M/F)(0,1)E. 3.2. Expression, productivity, and purification of recombinant Cly-κ-CAR (R-Cly-κ-CAR) R-Cly-κ-CAR was purified to homogeneity with a specific activity of 620.08 U/mg and a final yield of 88 %. As Fig. 4 shows, a single band with an apparent molecular weight of ∼50 kDa was observed on SDS-PAGE, which was in accordance with the calculated. Zymography results further verified that RCly-κ-CAR could degrade κ-carrageenan (Fig. 4). The purified enzyme aggregated into a single band with an apparent molecular weight of ∼50 kDa on SDS-PAGE (Fig. 4). As calculated from Lineweaver-Burk plots, the apparent Km and Vmax values were 0.94 mg/ml and 13.42 mM/min/mg, respectively, similar to those of CgkZ from Zobellia sp. ZM-2 [7, 8]. 3.3. Biochemical characterization of R-Cly-κ-CAR R-Cly-κ-CAR was most active at 35 °C and pH 7.0 in 20 mM phosphate buffer (Fig. 5a and 5c). It retained >75 % of its original activity after incubation below 35 °C for 2 h (Fig. 5b). The optimal temperature for R-Cly-κ-CAR activity was similar to the 36-42 °C observed for CgkZ [4] and lower than the 55 °C reported for CgkX [10]. The enzyme was stable between pH 5.0 and 8.0 (Fig. 5d). More than 50 % of the original activity was maintained after treating the enzyme at pH 5.0–8.0 and 4 °C for 6 h (Fig. 5d), which is consistent with most reports for κ-carrageenases (range from 6.0 to 8.0) [7-9, 12, 13]. R-Cly-κ-CAR showed strict substrate specificity since it was active only toward κ-carrageenan but 8
not ι- or λ-carrageenan, or any other polysaccharides such as agar, alginate, cellulose and starch (data not shown). The optimum concentration of κ-carrageenan was 0.7 % (Fig. 5e). The active of R-Cly-κCAR was in a positive concentration-dependent manner from 0.1-0.7 % and decreased when the concentration was higher than 0.7 %. Under low temperature or high concentration conditions, carrageenan is gelatinous and viscous which impeded the binding efficiency between enzyme (R-Cly-κCAR) and substrate (κ-carrageenan). Further detail information is necessary to test this hypothesis. The R-Cly-κ-CAR activity was enhanced in a concentration-dependent manner in the presence of NaCl from 0.2 to 0.6 % (Fig. 5f). Enhancement by 0.6 % NaCl was higher than the enhancing NaCl concentration observed for κ-carrageenase from Pseudoalteromonas sp. AJ5-13 (0.3 %) [14], and lower than those for Z. galactanovorans (0.9 %) [15] and Zobellia sp. ZM-2 (0.7 %) [7]. The presence of NaCl inhibited the activity of the κ-carrageenases from P. porphyrae LL1 [16] and Tamlana sp. HC4 [17]. R-Cly-κ-CAR activity was strongly inhibited by EDTA (1 mM), SDS (1 mM), and KCl (10-100 mM) (Table 2). At 1 mM, CaCl2, MgCl2 and LiCl had almost no effect on the enzyme activity (Table 2). 3.4. Analysis of hydrolytic pattern and products of R-Cly-κ-CAR After completion of κ-carrageenan hydrolysis by R-Cly-κ-CAR, the degradation products were analyzed by TLC at various time points. The main end products were neo-κ-carraoctaose and neo-κcarrahexaose (Fig. 6a), which are different from the degradation products of C. lytica N5-2 (Fig. 6b) [13]. It was surprising that neo-κ-neocarrabiose was not detected, suggesting that neo-κ-carraoctaose was not broken down into neo-κ-carrabiose and neo-κ-carrahexaose by R-Cly-κ-CAR. Further detailed information is required to fully explain these observations. Most main products of κ-carrageenan hydrolysis by recombinant κ-carrageenases (CgkX, CgkP, and CgkS) had a low degree of polymerization [9-11]. Therefore, R-Cly-κ-CAR could be a valuable tool for the production of higher degree of polymerization κ-COGs. Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 81671243 and 81373429). Conflicts of interest 9
The authors declare no conflict of interest. Author contributions ZA. Yao conceived and designed the experiments; YX. Peng, BW. Zhao and YQ. Liu performed the experiments; HL. Cui and FJ. Chen analyzed the data; HG.Wu contributed wrote the paper.
Addition information text Supplementary material Table 1 Genes encoding carrageenases in Cellulophaga lytica DSM 7489.
10
References [1] V.L. Campo, D.F. Kawano, D.B.D. Silva, I. Carvalho, Carbohydr. Polym. 77 (2009) 167-180. [2] Y. Sun, B. Yang, Y. Wu, Y. Liu, X. Gu, H. Zhang, C. Wang, H. Cao, L. Huang, Z. Wang, Food. Chem. 178 (2015) 311-318. [3] G. Yu, H. Guan, A.S. Ioanoviciu, S.A. Sikkander, C. Thanawiroon, J.K. Tobacman, T. Toida, R.J. Linhardt, Carbohydr Res. 337 (2002) 433-40. [4] F. Wang, Z. Yao, H. Wu, S. Zhang, N. Zhu, X. Gai, Appl. Mech. Mater. 2 (2011) 194-199. [5] H. Yuan, J. Song, X. Li, N. Li, J. Dai, Cancer Lett. 243 (2006) 228-234. [6] Z. Yao, H. Wu, S. Zhang, Y. Du, Carbohydr. Polym. 101 (2014) 359-367. [7] Z. Liu, G. Liu, H. Mou, Appl. Microbiol. Biot. 97 (2013) 1301-1307. [8] Z. Liu, L. Tian, Y. Chen, H. Mou, J. Biotechnol. 185 (2014) 8-14. [9] S. Li, L. Wang, W. Yu, F. Han, J. Ocean. U. China. 12 (2013) 155-159. [10] X. Xu, S. Li, X. Yang, W. Yu, H. Feng, J. Ocean. U. China. 14 (2015) 1082-1086. [11] L. Wang, S. Li, S. Zhang, J. Li, W. Yu, Q. Gong, J. Ocean. U. China. 14 (2015) 759-763. [12] T. Kobayashi, K. Uchimura, O. Koide, S. Deguchi, K. Horikoshi, Biosci. Biotech. Bioch. 76 (2012) 506-511. [13] Z. Yao, F. Wang, Z. Gao, L. Jin, H. Wu, Int. J. Mol. Sci. 14 (2013) 24592-24602. [14] Y. MA,S. Dong, X. Jiang, J. Li, H. Mou, J. Food. Biochem. 34 (2010) 661-678. [15] G. Michel, N.C. Pi, T. Barbeyron, M. Czjzek, W. Helbert, Appl. Microbiol. Biot. 71 (2006) 23-33 [16] G. Liu, Y. Li, Z. Chi, Process. Biochem. 46 (2011) 265-271. [17] F. Sun, Y. Wang, Q. Liu, Chin. J. Oceanol. Limnol. 49 (2009) 1139-1145.
11
Figure legends Fig. 1. The nucleotide and deduced amino acid sequence of Cly-κ-CAR from Cellulophaga lytica strain N5-2. The underlined letters indicate the start codon (ATG) and the stop codon (TAG). The predicted signal peptide sequence is indicated by gray amino acids. N-glycosylation and O-glycosylation sites are indicated by yellow and pink amino acids, respectively. The three conserved domains involved in the catalytic mechanism of κ-carrageenase proteins are underlined, including grayish-blue (GVCPSFW) and green (three conserved Arg) residues involved in κ-carrageenan binding, and red residues (EIDVVE) at the active site. Fig. 2. Multiple alignment of the deduced amino acid sequence of Cly-κ-CAR from Cellulophaga lytica strain N5-2 and functionally characterized κ-carrageenases from other organisms: AGS43006, Zobellia sp. M-2; YP_004734701, Zobellia galactanivorans; YP_004263603, Cellulophaga lytica; WP_008655792, Rhodopirellula europaea; WP_007339445, Rhodopirellula baltica; BAJ61957, Pseudoalteromonas tetraodonis; CGKA_PSEVC, Pseudoalteromonas carrageenovora; ADD92366, Pseudoalteromonas sp. LL1; ADE53467, Coraliomargarita akajimensis; and GAF02139, Cytophaga fermentans. Seventeen columns marked with colored boxes (black, red, and green) indicate key residues, among which the three red boxes represent catalytic residues (E-D-x-x-E). The blue columns indicate regions of high amino acid identity. Fig. 3. Phylogenetic analysis of κ-carrageenase Cly-κ-car. Glycoside hydrolase family 16 κcarrageenase protein sequences were aligned using the Clustal W program and the tree was constructed with the maximum-likelihood method using PHYML software. Note: the red circle indicates the Cly-κcar sequence from C. lytica strain N5-2. Different κ-carrageenases from various organisms are indicated by distinct colors. The β-agarase from C. lytica DSM 7489 was used as the root of the phylogenetic tree. Fig. 4. SDS-PAGE, zymogram and purification of R-Cly-κ-CAR. Lane M, molecular weight markers; Lane 1, R-Cly-κ-CAR expression induced in E. coli BL21 by IPTG at 6 h; Lane 2, R-Cly-κ-CAR expression induced by IPTG at 8 h; Lane 3, R-Cly-κ-CAR induced by IPTG at 24 h; Lane 4, zymogram of R-Cly-κ-CAR; Lane 5, unpurified R-Cly-κ-CAR; Lane 6, purified R-Cly-κ-CAR. Note: the target protein is indicated by red boxes. 12
Fig. 5. Effects of temperature, pH and concentration of substrate and NaCl on the activity and stability of R-Cly-κ-CAR. Data are shown as means ± SD (n = 3). a. The optimal temperature of R-Cly-κ-CAR was determined by measuring the activity in 20 mM sodium phosphate buffer (pH 7.0) at 25-50 °C. b. Thermal stability of R-Cly-κ-CAR. c. The optimal pH of R-Cly-κ-CAR, determined at 35 °C. d. The pH stability of R-Cly-κ-CAR. e. The optimal substrate concentration of R-Cly-κ-CAR determined at 35 °C and pH 7.0. f. The optimal concentration of NaCl for activity determined at 35 °C and pH 7.0. Fig. 6. Thin layer chromatographic analysis of degradation products. a. Enzymatic hydrolysis of κcarrageenan by R-Cly-κ-CAR was conducted in standard conditions for 0 min (1); 6 h (2); 12 h (3); 24 h (4); 48 h (5); and 72 h (6). The degradation products of C. lytica strain N5-2 for 72 h were used as a control sample. b. Enzymatic hydrolysis of κ-carrageenan by C. lytica N5-2 was conducted in standard conditions for 5 min (8); 30 min (9); 1 h (10); 2 h (11); 3 h (12); 6 h (13); 9 h (14); 12 h (15); 24 h (16), 48 h (17), 60 h (18) and 72 h (19). M, marker (galactose). Combined with HPLC and mass spectrometry results (our previous published results), c, d and e were assigned as neo-κ-carraoctaose, neo-κ-carrahexaose and neo-κ-carrabiose respectively.
13
Fig. 1.
14
Fig. 2.
15
Fig. 3.
Fig. 4.
16
Fig. 5.
Fig. 6.
17
Table legends Table 1 Primers used in this study (bp: base pairs). Note: the underlined sequences GAATTC and CTCGAG represent the restriction sites of EcoR I and Xho I, respectively. Cly-κ-car-F1/Cly-κ-car-R1 was used to amplify the κ-carrageenase gene without the predicted signal peptide. Table 2 Effects of chemicals (salt ions, metal ions, surfactants and chelators) on the activity of R-Clyκ-CAR. Notes: Activity without addition of chemicals was defined as 100 %. Data are shown as means ± SD (n = 3).
18
Table 1 Primers used in this study (bp: bases pair). Note: the underlined bp stands for EcoR I and Xho I restriction enzyme cutting site, respectively. Note: The underlined sequences GAATTC and CTCGAG represented the restriction sites of EcoR I and Xho I, respectively. Cly-κ-car-F1/Cly-κ-car-R1 was used to amplified the κ-carrageenase gene sequence without signal peptide. Primer name
Primer sequences (5→3)
2915-F1 2915-R1 2915-F2 2915-R2 Cly-κ-car-F1 Cly-κ-car-R1
AGATTGTGATGTGGGTGGCT ACAGTCCAATAGCATTCTGGCA TCTTGCTTCGCTACCAGCTC CACTTCCCTCCTACGTCGTT GAATTCCAAACATCTAATCCGAATGATAATT CTCGAGCTATTGAATAAGCAGTTGTTTTG
Size (bp) 20 22 20 20 31 29
Product (bp) 3, 096 3, 096 2, 529 2, 529 1, 353 1, 353
Table 1 Effects of chemicals (salt ions, metal ions, surfactants and chelators) on the activity of R-Clyκ-CAR. Notes: Activity without addition of chemicals was defined as 100 %. Data were shown as means ± SD (n=3).
Additives Control KCl KCl KCl CaCl2 MgCl2 LiCl SDS EDTA
Concentration (mM)
Relative activity (%) 100±1.23 72.87±1.64 25.6±0.57 23.6±0.32 100.51±3.31 98.12±2.65 99.47±2.32 22.71±0.98 30.65±1.23
10 50 100 1 1 1 1 1
19