Cocaine-and amphetamine-regulated transcript modulates peripheral immunity and protects against brain injury in experimental stroke

Brain, Behavior, and Immunity 25 (2011) 260–269

Contents lists available at ScienceDirect

Brain, Behavior, and Immunity journal homepage: www.elsevier.com/locate/ybrbi

Cocaine-and amphetamine-regulated transcript modulates peripheral immunity and protects against brain injury in experimental stroke Leilei Chang a, Yanting Chen b, Jie Li a, Zhuo Liu a,b,c,d, Zhongyuan Wang b,c,d, Junhao Chen d, Wangsen Cao b,c,⇑, Yun Xu a,b,c,d,⇑ a

Department of Neurology, Affiliated Drum Tower Hospital, Nanjing Medical University, PR China Department of Neurology, Affiliated Drum Tower Hospital, Nanjing University Medical School, PR China The State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, PR China d Jiangsu Key Laboratory for Molecular Medicine, PR China b c

a r t i c l e

i n f o

Article history: Received 29 July 2010 Received in revised form 20 September 2010 Accepted 20 September 2010 Available online 30 September 2010 Keywords: Catecholamins CART Ischemia Peripheral immunity SNS Stroke

a b s t r a c t Ischemic stroke can induce immediate activation and later inhibition of the peripheral immune system which may contribute to a worse outcome. Cocaine-and amphetamine-regulated transcript (CART) peptides have been reported to have neuroprotective and immunomodulatory effects in various cell and animal experimental models, respectively. In this study, CART’s role in experimental stroke and the relevant immune-regulating mechanisms was investigated. In male C57BL/6 mice subjected to 120 min of middle cerebral artery occlusion (MCAO), with or without CART treatment or sham operation, peripheral immune parameters and serum catecholamins (CAs) were analyzed. CART reduced blood CD4+/CD8+ ratio and pro-inflammatory cytokine expression in MCAO mice at 24 h, while upregulated spleen CD4+/CD8+ ratio and enhanced anti-inflammatory cytokines expressions in MCAO mice at 96 h. In addition, in comparison to control mice, CART-treated mice demonstrated elevated serum CAs at 6 and 24 h, whereas reduced serum levels of CAs and blood regulatory T (Treg) cells at 96 h. The cytokine expression, infarct volume and neurological deficits in mouse brain were also measured. CART reduced post-stroke infarct volume and improved neurological functions, with reduced expression of inflammatory factors in the injured brain. Findings indicate that CART plays an important role in modulating post-stroke immune response and exerts a neuroprotective effect in experimental stroke. Findings also suggest that the possible mechanism of CART’s protective action in stroke is the regulation of the sympathetic nervous system (SNS) pathway since CAs, Treg cells and interleukin (IL)-10 are the major modulators of SNS. Ó 2010 Elsevier Inc. All rights reserved.

1. Introduction Increasing evidence suggests that post-ischemic inflammation extends far beyond the local ischemic brain. Stroke also induces rapid systemic inflammation and later long-lasting global immunodepression, both of which contribute to secondary cerebral damage and worse outcomes (Emsley and Hopkins, 2010; Offner et al., 2006a,b; Prass et al., 2003). T-lymphocytes (T-cells) include CD4+ helper T (Th) lymphocytes and CD8+ cytotoxic T lymphocytes (CTL). CD4+ T-helper 1 (Th1) cells, which secrete pro-inflammatory cytokines, including interferon-c (IFN-c), and tumor necrosis factor-a (TNF-a), interleukin-2 (IL-2), IL-12, may contribute to the pathogenesis of stroke, whereas CD4+ Th2 cells may exert a protective effect through anti-inflammatory cytokines such as IL-4 and, ⇑ Corresponding authors. Address: Department of Neurology, Affiliated Drum Tower Hospital, Nanjing University Medical School, 321 Zhongshan Road, Nanjing, Jiangsu 210008, PR China. Fax: +86 25 83317016. E-mail address: [email protected] (Y. Xu). 0889-1591/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.bbi.2010.09.017

IL-10. CD8+ CTL recognize their antigen presented by major histocompatibility class I (MHC-I) on the surface of target cells. CD4+ CD25+ forkhead box p3+ T cells, the major form of regulatory T (Treg) cells, play a key role in controlling immune response under physiological conditions and in various systemic and CNS inflammatory diseases, through anti-inflammatory cytokines such as transforming growth factor-b (TGF-b) and IL-10 (Arumugam et al., 2005; Jin et al., 2010). CNS resident cells (mainly microglia) are activated following stroke and produce pro-inflammatory mediators including TNF-a, IL-1b and other chemokines, which may enhance the appearance of adhesion molecules and mediate the recruitment of T-cells (Lakhan et al., 2009). Stroke-induced early activation of the peripheral immune system is likely transient, followed by systemic immunodepression, including reduced mononuclear phagocyte and natural killer cell function, induction of anti-inflammatory cytokines, apoptotic lymphocyte loss and altered T lymphocyte activity. All of these increase susceptibility to infection and results in worse outcomes (Emsley and Hopkins, 2010). Stroke led to a state of profound

L. Chang et al. / Brain, Behavior, and Immunity 25 (2011) 260–269

immunosuppression in mice 96 h after MCAO, which was accompanied by increased CD4+ CD25+ fox p3+ Treg cells and circulating CD11b+ VLA-4-negative macrophages (Offner et al., 2006b). Treg cells serve as an endogenous counter-regulatory immune mechanism for systemic inflammation occurring after stroke. Emerging evidence indicates that immunoinhibitory CNS pathways, including the hypothalamic–pituitary–adrenal axis (HPAA) and sympathetic nervous system (SNS), play a major role in poststroke immunodepression (Meisel et al., 2005; Woiciechowsky et al., 1999). Because of the deleterious role of systemic inflammation and immunodepression in stroke development, modulation of the peripheral immune response is thought to be a novel and prospective therapy for ischemic stroke. Previous studies showed that Cocaine-and amphetamine-regulated transcript (CART) peptides were neuroprotective in experimental stroke (Jia et al., 2008; Xu et al., 2006). It is noteworthy that immunohistochemical studies reveal a well-defined network of CART-immunoreactive (irCART) neurons organized along the SNS (Dun et al., 2006). Moreover, CART has a short-term immunoinhibitory effect followed by an immunostimulatory function (Bik et al., 2008b). Therefore, the present study investigates the effect of CART on biphasic immune response induced by stroke and the interrelationship between cerebral damages and peripheral immune response in order to identify the possible targets of CART in ischemic stroke. 2. Materials and methods 2.1. Animals and ischemic model The study was conducted on male C57BL/6J mice (body weight 25–30 g) provided by the Animal Center of Drum Tower Hospital. The animal study protocols were approved by the Committee of Experimental Animal Administration of Nanjing Medical University. The mouse MCAO procedures were performed as previously described (Xu et al., 2006). In brief, mice were anesthetized by intraperitoneal injection of Sodium Pentobarbital (1%) at a dose of 45 mg/kg. During the procedure, rectal temperature was maintained at 37 ± 0.5 °C. A 6–0 monofilament nylon suture with heatrounded tip was introduced into a wedge-shaped incision on the external carotid artery (ECA) and advanced to obstruct the origin of the middle cerebral artery. After 120 min of occlusion, reperfusion was initiated by filament withdrawal. Sham-treated mice were subjected to the same procedure without MCAO. CART-treated mice received an injection of CART peptide through vena caudalis at the beginning of reperfusion (CART55-102 2.5 lg/kg) (Xu et al., 2006). Saline was used as a control. The mortality rate of the mice in this study is about 10%. 2.2. Behavior test For investigation of neurological deficit after MCAO, ten mice in each group were evaluated by Neurological Severity Scores (NSS) as described previously (Chen et al., 2010) at 6, 24 and 96 h after MCAO. The inspectors were masked to grouping of the experimental mice. According to the NSS, neurological function was graded on a scale of 0–18, 13–18 points indicate severe injury; 7–12, moderate injury; 1–6, mild injury. One point was awarded for the inability to perform the tasks or for the lack of a tested reflex. 2.3. Measurement of infarct size The brain tissues of six mice in each group were harvested after 6, 24 and 96 h of reperfusion. Five 2-mm-thick coronal sections in each brain were prepared for staining using 2,3,5-triphenyltetrazolium

261

chloride (TTC) (Sigma, St. Louis, MO, USA) in saline (Chen et al., 2010). Slices were photographed with a computer-controlled digital camera (Olympus) and infarct size was calculated by the image analysis software (Image Pro Plus4.5; Media Cybernetics, Silver Spring, MD, USA). To rule out effect of brain edema, the value of infarct volume was provided as a percentage of the contralateral hemisphere. 2.4. Flow cytometric analysis Blood samples were collected in heparinized tubes after 6, 24 and 96 h of reperfusion for cell population analysis by flow cytometry. Spleens were simultaneously harvested, and single-cell suspensions were obtained. Cells were washed with PBS and blood samples were diluted 1:1 in RPMI 1640. All samples were stained with a combination of fluorescently labeled anti-mouse monoclonal antibodies (eBiosciences, San Diego, CA, USA): CD4 (L3T4), CD8a (Ly-2), CD25 for 30 min. After surface staining, the samples were permeabilized by incubation with the fixation/permeabilization buffer (eBiosciences, San Diego, CA, USA) and incubated with anti-Foxp3 monoclonal antibody (mAbs) for 30 min. After incubation with mAbs, cells were analyzed by four-color flow cytometry on a FACSCalibur using CELLQuest Software (BD Biosciences, San Jose, CA) (Offner et al., 2006b). 2.5. RNA isolation and real-time PCR To analyze gene expression of the inflammatory cytokines after stroke, three mice in each group were sacrificed and the brains and spleens were quickly removed at 6, 24 and 96 h of reperfusion. Total RNA was extracted by using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and was transcribed into cDNA using a PrimeScript RT reagent kit (Takara, Dalian, China) according to the manufacturer’s instructions. Quantitative PCR was performed as described previously (Chen et al., 2010), on ABI 7500 instrument (Applied Biosystems, USA) in the presence of a fluorescent dye (SYBR Green I; Takara). Quantity of mRNA was detected as relative units (RE). Primer sequences (Invitrogen, Frederick, MD, USA) follow: IL-1b, F: AAGCCTCGTGCTGTCGGACC, R: TGAGGCCCAAGGC CACAGGT TNF-a, F: CAAGGGACAAGGCTGCCCCG, R: GCAGGGGCTCTTGA CGGCAG IL-10, F: GGCATGAGGATCAGCAGGGGC, R: TGGCTGAAGGCAG TCCGCAG IL-4, F: TCAACCCCCAGCTAGTTGTC, R: TGTTCTTCGTTGCTGTG AGG 2.6. Splenocyte culture in vitro Using sterile methods, spleens were segregated from the three group: sham-treated mice and MCAO mice with or without CART. The manipulation was followed by procedures described previously (Bik et al., 2008a). A single-cell suspension was prepared by passing the tissue through a 200 lm nylon mesh screen. The cells were washed using RPMI 1640 (Gibco-Invitrogen, Carlsbad, CA, USA), red cells were lysed using red cell lysis buffer (8.3 g NH4Cl in 0.01 M Tris–HCl (pH 7.4)) and incubated for 5 min. Supernatant was produced by centrifugation (4 °C, 1200 revolve/min). Splenocytes removal of red blood cells were then washed with RPMI 1640, counted and adjusted to 1  106 cells/ml with RPMI medium. Splenocyte cultures (1  105cells/well in 200 ll) were stimulated with T-Activator CD3/CD28 Dynabeads (1 bead per cell; Invitrogen Dynal AS, Oslo, Norway) in 96-well tissue culture plates (Falcon) at a 1:1ratio. The culture plates were incubated for 72 h at

262

L. Chang et al. / Brain, Behavior, and Immunity 25 (2011) 260–269

37 °C and 5% CO2 incubator. After 3 days, the supernatants were harvested and stored at 80 °C for cytokines detection by ELISA assay.

3. Results

2.7. Enzyme-linked immunosorbent assay

To investigate whether CART could modulate cell-mediated systemic immune response after stroke, CD4+/CD8+ ratio and CD4+CD25+FOXP3+T cells in the blood and spleens of mice from each group were determined at 6, 24 and 96 h by flow cytometry. At 24 h, a substantial increase in CD4+/CD8+ ratio was observed in blood of MCAO mice compared to sham mice (P < 0.05), which was obviously lowered in the presence of CART (P < 0.05). There was no difference of blood CD4+/CD8+ ratio between sham and MCAO mice, with or without CART, at 6 h and 96 h (Fig. 1A and B). In spleens, stroke mice did not show a higher CD4+/CD8+ compared to sham mice at any time intervals. However, percentage of spleen CD4+ T cells began to decrease at 24 h after MCAO (P > 0.05) and a remarkable decline of spleen CD4+/CD8+ ratio was measured at 96 h (P < 0.05). CART treatment reversed this cell population changes (Fig. 1C). To investigate whether CART could affect lymphocyte function after stroke, mononuclear cells isolated from spleen and blood at different time points after MCAO were cultured and stimulated for 24 h with plate-bound anti-CD3/CD28 antibodies. Untreated cell (Sham) was the control. TNF-a and IFN-c levels were assessed by ELISA in supernatants of the cultures. At 6and 24 h after stroke, both pro- and anti-inflammatory cytokines in spleen and blood lymphocytes from stroke-injured mice increased, except that IFN-c in blood cells was unchanged at 6 h (Fig. 2A–D). It was noticeable that CART treatment reversed these changes at 6 and 24 h. By 96 h after MCAO, significant decreases of proinflammatory cytokines (TNF-a, IFN-c) were observed in both activated spleen and blood cells from MCAO mice. However, though a

Mouse cytokine ELISA kits (R&D Systems, Minneapolis, MN, USA) were used to detect levels of IL-4 (DY404E), IL-10 (DY417E), TNF-a (DY410E) and IFN-c (DY485E). The serum concentrations of Catecholamine (CA) were determined using mouse hormone ELISA kits (R&D Systems, Minneapolis, MN, USA). Hundred milliliter of sample or standard was added to each well of 96-well plates coated with anti-mouse cytokines or hormone antibody. The plates were incubated at 37 °C for 90 min and then washed five times. Hundred milliliter of biotinylated cytokine or hormone-specific antibody was added into each well and incubated at 37 °C for 60 min. Plates were then washed, treated with 100 ll of diluted streptavidin-HRP and incubated at 37 °C for 30-min. After washing, the color was produced by addition of 100 ll substrate solution for 10–15 min. Finally, 100 ll of stop solution was added to terminate reaction. Optical density was measured at 450 nm within 10 min. 2.8. Statistical analysis All data are expressed as means ± standard error of the mean (SEM) and were analyzed by the SPSS 13.0 statistical analytical software (SPSS, Chicago, IL, USA). Differences between multiple groups were analyzed by the one-way analysis of variance (ANOVA) method. Change between two groups was statistically evaluated by Student’s t-test. Comparative differences were considered significant at P < 0.05.

A

sham

3.1. CART regulates system cellular immune response after stroke

MCAO

MCAO+CART

blood

spleen

Blood Sham

*

8

MCAO MCAO+CART

6

**

4 2 0

6h

24h

96h

C CD4+/CD8+Tcell ratio

CD4+/CD8+Tcell ratio

B 10

Spleen 5 4 3

*

2 1 0

6h

24h

96h

Fig. 1. CART modulated the ratio of CD4+/CD8+ T Cells in the periphery after stroke. The ratio of CD4+/CD8+ T Cells of blood cells and splenocytes from Sham, MCAO with or without CART mice at 6, 24, 96 h after MCAO was measured by flow cytometric analysis. (A) Figures for flow cytometry assay (upper for blood, bottom for spleen, the dotblots are at 24 h); (B) the ratio of CD4+/CD8+ T Cells from blood was expressed by bar graph; (C) bar graph for spleen CD4+/CD8+ T Cells ratio. Six separate experiments were finished. P < 0.05 verus the sham group. Values are mean ± SEM.

263

L. Chang et al. / Brain, Behavior, and Immunity 25 (2011) 260–269

12

MCAO

*

400 pg/ml

sham

**

*

MCAO+CART 10

**

8

300

** #

200

**

6

#

pg/ml

*

pg/ml

(A) TNF-α 500

4 100

2

0

0

* **

* **

300

#

*

24h

* **

96h

6h

24h

96h

24h

96h

&

*

80

# **

*

70

50

*

10

24h

*

6h

96h

#

5 0

0

#

6h

pg/ml

pg/ml

100

**

60

6h

15

200

**

90

200

96h

**

*

100

300

#

300

96h

0 24h

0 24h *

24h

*

3

100

6h

#

2

400

#

**

1 6h

&

**

4

#

96h

400 pg/ml

2

pg/ml

pg/ml

(D) IL-10 500

**

3

pg/ml

6h

*

5

0

0

700 600 500 400 300 200 100 0

6

1

100

*

6h

96h

*

4

200

(C) IL-4

24h

5

400 pg/ml

6h

96h

pg/ml

(B) IFN-γ 600 500

24h

pg/ml

6h

8 7 6 5 4 3 2 1 0

6h

spleen

24h blood

96h

10 8 6 4 2 0

24h

*

96h

* **

6h

& **

24h

#

96h

serum

Fig. 2. CART affected lymphocyte function after stroke. Cytokines from stimulated splenocytes, and blood cells, and serum in mice at 6, 24 and 96 h after MCAO were quantified by Elisa. (A) level of TNF-a; (B) IFN-c; (C) level of IL-4; (D) IL-10. Six independent samples were used in the experiments per group. P < 0.05 verus the sham mice,  P < 0.05 verus MCAO mice, #P < 0.05 verus MCAO mice at 24 h.

moderate reduction was also noticed, anti-inflammatory cytokines (IL-4, IL-10) remained at higher levels. CART did not influence levels of TNF-a or IFN-c, but enhanced IL-4 andIL-10 secretion from activated mononuclear cells. Levels of mRNA of IFN-c, TNF-a, IL-4, and IL-10 in spleen at 6, 24 and 96 h after MCAO were measured by real-time PCR. The results indicated that IFN-c, TNF-a, IL-4 and IL-10 were increased at 6 and 24 h Only TNF-a level increased at the 96 h time point (Fig. 3A and B). CART treatment blocked the increases of the cytokine expression at both 6 and 24 h. To further investigate the function of peripheral T-cells after MCAO with or without CART, IFN-c-/IL-4 ratio, which represents the Th1/Th2 T cell ratio, from blood and spleen, was determined. As shown in Fig. 4A, Th1/Th2 ratio from spleen lymphocytes of MCAO mice was lower than that of the sham treated group at 6 h, and shifted downward in a time dependent manner. However, Th1/Th2 ratio from blood of MCAO mice was markedly increased at 24 h, while slightly reduced by 96 h (Fig. 4B). For CD4+ CD25+FoxP3+T (Treg) cells in blood, as shown in Fig. 5A–C, there was no difference at 6 h between MCAO and sham mice. An increased percentage in MCAO mice was observed at both 24 and 96 h (P < 0.05). CART did not affect the changes of Treg cells at 6 and 24 h after stroke, but markedly down-regulated the stroke-induced increase of Treg cells at 96 h (P < 0.01). However, in spleen, no increased percentage of Treg cells was observed in MCAO mice until 96 h after stroke (P < 0.05). CART-treated mice vs MCAO mice showed no significant difference in spleen percentage of Treg cells at any of the time points.

3.2. Effect of CART on stroke-induced changes of circulating cytokines To determine whether CART could influence stroke-induced changes of circulating cytokines, the levels of TNF-a, IFN-c, IL-4 and IL-10 in serum were measured by ELISA. As expected, TNF-a, and IFN-c in MCAO-treated mice were significantly elevated at both 6 h and 24 h compared to sham mice (Fig. 2A and B, P < 0.01). By 96 h, MCAO mice showed remarkable decreases of serum TNF-a and IFN-c (P < 0.01). CART could reduce the increase of serum TNF-a, IFN-c in MCAO mice by 21.4% and 41.6%, respectively, at 6 h (P < 0.01), and 39.2% and 39.8% at 24 h post-ischemia (P < 0.01). As for anti-inflammatory cytokines (IL-4, IL-10), MCAO mice demonstrated similar patterns of change as TNF-a and IFN-c (Fig. 2C and D). However, higher serum levels of IL-4 and IL-10 in MCAO mice stayed high at 96 h compared to sham mice (P < 0.01), while serum TNF-a and IFN-c levels returned to the same level as sham. CART treatment could reduce the rise of IL-10 in serum at 6 h by 39.4% (P < 0.05). Although serum levels of both IL-4 and IL-10 in MCAO mice decreased at 24 h, they elevated at 96 h in the presence of CART (P < 0.05). Th1/Th2 ratio in serum was also analyzed and a relatively prominent change was observed. There was a significant increase in Th1/Th2 ratio in MCAO mice vs sham-treated mice at the 6 h time point. At the 24 h time point, a higher ratio was still observed which substantially declined at 96 h (Fig. 4C). CART reduces the Th1/Th2 ratio in peripheral circulation at both 6 and 24 h time point (Fig. 4B and C), but did not affect Th1/Th2 ratio in the spleen (Fig. 4A).

264

L. Chang et al. / Brain, Behavior, and Immunity 25 (2011) 260–269

A

TNF-α MCAO+CART

#

4

*

*

#

2 sham

6h

24h

IL-4

* #

1 0

sham

6h

sham

* #

#

#

6h

24h

96h

IL-10

*

3 2

*

96h

Mean fold change

0

2.5 2 1.5 1 0.5 0

Mean fold change

Mean fold change

MCAO

6

B4 Mean fold change

IFN-γ

*

8

24h

96h

4

*

3 *

2

#

#

1 0

sham

6h

24h

96h

Fig. 3. CART regulated mRNA expression of cytokines from spleen tissue after stroke. mRNA of spleen from sham, MCAO and MCAO+CART-treated mice at 6, 24 and 96 h after stroke and was measured by real-time PCR analysis. Values were normalized by mouse housekeeping gene GAPDH. Relative expression (RE) of message levels are given for (A) TNF-a, IFN-b; (B) IL-4, IL-10. P < 0.05 verus sham mice, #P < 0.05 verus MCAO mice, n = 6 per group.

1

sham

Spleen

MCAO MCAO+CART

* #

0.8 0.6

*

0.4 0.2 0

IFN-ν/IL-4 ratio

C

0.08

B IFN-γ/IL-4 ratio

IFN-γ/IL-4 ratio

A 1.2

Blood 0.02

*

0.015 0.01

# 0.005 0

6h

24h

6h

24h

96h

Serum

*

0.06

96h

#

* #

0.04

**

0.02 0 6h

24h

96h

Fig. 4. CART changed the ratio of peripheral Th1/Th2 after stroke. The levels of IFN-c and IL-4 from activated blood, spleen lymphocytes and serum were determined by ELISA and used the percentage of IFN-c-/IL-4 to represent Th1/Th2-producing cells ratio. (A) Spleen Th1/Th2 ratio showed a decline tendency at three time points vs that in the sham group. P < 0.05 vs the sham group. (B) Blood Th1/Th2 ratio significantly increased at 24 h and dropped at 96 h after focal brain ischemia, and could be reversed by CART.  P < 0.05 vs the sham group. #P < 0.05 vs MCAO at 24 h. (C) Serum Th1/Th2 ratio significantly increased at 6 h a, 24 h, then declined at 96 h after stroke, but CART peptide treatment could suppress Th1 response at both 6 h and 24 h time point. P < 0.05 vs the sham group. P < 0.05 vs MCAO mice at 6 h and 24 h. #P < 0.05 vs MCAO mice. Values are mean ± SEM, n = 6 per group.

3.3. Neuroprotection of CART in experimental stroke To investigate whether CART reduces ischemic brain injury, a behavioral test was performed. As shown in Fig. 6A, mice that underwent MCAO had worse neurological deficit compared to sham-treated mice (P < 0.05). With CART peptide treatment, MCAO mice had improved neurological function scores from 24 to 96 h (P < 0.05). The Difference of infarct sizes between MCAO mice with and without CART was also compared. As expected, CART apparently reduced the infarct volume of MCAO mice at 6, 24 and 96 h time points (P < 0.05). In order to determine whether CART could modulate inflammatory response in ischemic brain, we assayed the mRNA levels of IL-1b, TNF-a, IL-4 and IL-10 from mouse cortex. MCAO animals demonstrated higher levels of all the cytokines tested from ipsilateral cortex at 6, 24 and 96 h compared to that from sham (Fig. 7A–D). CART downregulated TNF-a and IL-1b expression from 6 to 96 h (Fig. 7A and B), whereas upregulated IL-10 by 34.5% at 6 h and IL-4 by 34.2%, IL-10 by 46.7% at 24 h compared to MCAO mice,

suggesting that CART peptides have an inhibitory role against inflammation by regulating cytokine expression in mouse brain after MCAO. 3.4. Effect of CART on the serum catecholamine (CA) level Whether CART regulates T-cell functions on sympathetic nervous system (SNS) pathway was next investigated (Fig. 8). The results indicated that CA level in serum of MCAO mice increased after stroke from 6 to 96 h compared to that in sham (P < 0.05), while CART-treated mice demonstrated a different curve which began to increase significantly at 6 h (P < 0.05), peaked at 24 h (P < 0.05) and then began to decline at 96 h (P < 0.05). 4. Discussion The present study confirms the hypothesis that CART downregulates local inflammation in the ischemic brain and reduces brain

265

L. Chang et al. / Brain, Behavior, and Immunity 25 (2011) 260–269

sham

MCAO

MCAO+CART

A Blood

Spleen

B

C

Blood 14 12 10 8 6 4 2 0

Sham MCAO

*

*

MCAO+CART

**

6h

24h

96h

Spleen

16 14 12 10 8 6 4 2 0

*

6h

24h

96h

Fig. 5. Changes of peripheral Treg cells (CD4+CD25+FOXP3+T cell) with/without CART after stroke. Blood cells and Splenocytes were obtained from Sham, MCAO and MCAO+CART-tread mice at 6, 24, and 96 h after stroke. Treg cells were measured by cytometry assay. (A) Figures for flow cytometry assay (upper for blood, bottom for spleen, the dot-blots are at 24 h); (B) bar graph for blood Treg cells; (C) bar graph for spleen Treg cells. P < 0.05 verus the sham group. P < 0.01 vs MCAO mice. Values are mean ± s.e.m., n = 6.

damage, possibly through regulating cellular immunity induced by stroke. This hypothesis was based on studies showing that CART is involved in the regulation of rat immune cell activity and plays a neuroprotective role in experimental stroke (Bik et al., 2008b; Jia et al., 2008; Mao et al., 2007; Xu et al., 2006). Given the potential importance of these findings for revealing that peripheral immune response to stroke may be modulated by CART, the specific sites or pathways targeted by CART need to be further identified. The current study suggests that CART might influence post-stroke immune response by modulating the neuroimmune pathway of the SNS axis. 4.1. CART regulates changes of cellular immunity after stroke The present study confirmed that periphery cellular immunity participates in post-stroke pathogenesis, and provided further insights regarding CART’s modulatory role in these events. In comparison to sham, MCAO mice showed a higher blood CD4+/CD8+ T cell ratio at 24 h after occlusion and enhanced the activity of blood and spleen lymphocytes. In contrast, MCAO mice demonstrated a lower spleen CD4+/CD8+ T cell ratio at 96 h after stroke and inhibited the pro-inflammatory cytokine (TNF-a, IFN-c) expression from activated peripheral lymphocytes, accompanied by an increased peripheral Treg cells. These findings are consistent with previous investigations which revealed that stroke induced a bi-phasic and organ-specific alteration of immune response including early immunostimulatory phase and later immunosuppressive phase

(Offner et al., 2006a,b, 2009). The early consequence of cerebral ischemia is a rapid splenic activation of T lymphocytes and enormous local cytokines elaboration. At 6 and 22 h time points, activated spleen cells from stroke-injured mice secreted significant amounts of the inflammatory factors including TNF-a, IFN-c, IL-6, monocyte chemoattractant protein-1 (MCP-1) and IL-2. At 22 h after stroke the secretion of anti-inflammatory factor IL-10 also increased. The unstimulated spleen tissue from stroke mice had increased expression of MIP-2, CCR2, CCR7, and CCR8 at the 6 h time point, and MIP-2, IP-10, CCR1 and CCR2 at the 22 h time point (Offner et al., 2006a). In the present study, MCAO mice demonstrated a higher blood IFN-c-/IL-4-producing T cells ratio and a lower spleen IFN-c-/IL-4producing T cells ratio over time, suggesting that peripheral immune organs (circulation and spleen) responded differently to stroke than CNS. In addition, MCAO mice showed a significant IFN-c-/IL-4-producing T cells ratio decrease in both spleen and blood at 96 h after stroke. These results confirmed the previous experimental and clinical data demonstrating that stroke could invoke a shift in T cell polarization from Th1 to Th2 cytokine-production profile. In experimental conditions, mice with focal cerebral ischemia showed an extensive apoptotic loss of lymphocytes and a shift from Th1 to Th2 cytokine production at 72 h after stroke (Prass et al., 2003). A later investigation confirmed this in humans. Following mitogenic stimulation with phorbol 12-myristate13-acetate (PMA) (a specific stimulus for T lymphocytes) and ionomycin, peripheral blood T lymphocytes (CD4+ T cells, CD8+ T cells) isolated from

266

L. Chang et al. / Brain, Behavior, and Immunity 25 (2011) 260–269

C

Sham

16

MCAO

14

MCAO+CART

12 10 8

*

6 4 2 0

6h

24h

infarct volume(%)

Neurological Severity Scores

A

96h

MCAO

MCAO+CART

40 35 30 25

*

*

*

20 15 10 5 0

6h

24h

96h

B

sham

MCAO

MCAO+CART

Fig. 6. CART could reduce brain injury in mice after MCAO. (A) NSS increased at three time points after MCAO vs that in the Sham group, and CART reverse it at 24 and 96 h.  P < 0.05 vs the Sham group, P < 0.05 verus MCAO mice. Values are mean ± s.e.m., n = 10. (B) Infarct sizes obtained by TTC staining at 24 h after MCAO. The normal tissue was stained deep red and the infarct area was stained pale gray. (C) Infarct size was expressed by bar graphs at 6, 24, and 96 h after MCAO with CART or not; P < 0.05 vs MCAO mice. Values are mean ± s.e.m., n = 10.

IL-1β

7 6 5 4 3 2 1 0

B

*

*

TNF−α 3 2.5

MCAO+CART

2

*

*

1.5 1 0.5 0

sham

6h

24h

96h

IL-4

C7

sham

D 3.5

*

6 5 4 3 2 1 0

Mean fold change

Mean fold change

MCAO

Mean fold change

Mean fold change

A8

6h

24h

96h

IL-10

3

*

2.5

*

2 1.5 1 0.5 0

sham

6h

24h

96h

sham

6h

24h

96h

Fig. 7. Effects of CART on mRNA of cytokines in ischemic brain. mRNA extracted from ipsilateral (right) cortex in Sham, MCAO and MCAO+CART-treated mice at 6, 24, and 96 h after occlusion, and was measured by real-time PCR. Values were normalized by mouse housekeeping gene GAPDH. Relative expression (RE) of message levels are given for IL-1b (A), TNF-a (B), IL-4 (C), IL-10 (D). P < 0.05 vs MCAO-treated mice, n = 6 per group.

both the ischemic stroke (IS) and the match controls (MC) at the post-acute phase (median post-stroke time 34.5 months) exhibited a similarly strong Th1 response. However, a significant increase in IL-4-producing T cells was observed in the IS groups, compared with the MC group, resulting in a significantly lower ratio of IFN-c-/IL-4-producing T cells (Theodorou et al., 2008). The discrepancy between the former investigation and the present study may be related to the use of different species, initial stroke severity (Hug et al., 2009; Urra et al., 2009), and the different time windows.

The present study found that CART peptides can regulate stroke-induced alteration of CD4+/CD8+ ratio, pro- and antiinflammatory cytokines production and IFNc-/IL-4-producing T cells ratio. CART down-regulated blood CD4+/CD8+ ratio and reduced the production of inflammatory factors at 24 h. Emerging evidence reveals that CD4+ and CD8+ T lymphocytes as well as the pro-inflammatory cytokines contribute to the post-stroke inflammatory responses, brain damage, and neurological deficit (Arumugam et al., 2005; Urra et al., 2009; Vogelgesang et al., 2008; Yilmaz et al., 2006). At the immunosuppressive phase,

L. Chang et al. / Brain, Behavior, and Immunity 25 (2011) 260–269 Sham

Catecholamine (umol/l)

1.2

MCAO

#

#

1 0.8

MCAO+CART

*

*

6h

24h

* #

0.6 0.4 0.2 0 96h

Fig. 8. Effect of CART on the serum catecholamine (CA) level after stroke in different time points. The serum CA level increased significantly at 6, 24 h in MCAO-treated mice, peaked at 96 h and CART could further enhance the level of CA at 6 h and 24 h and decreased at 96 h. P < 0.05 verus the sham group, #P < 0.05 verus MCAO mice, Values are mean ± SEM., n = 6 per group.

stroke-induced decline of T lymphocytes (CD4+ Th cell and CD8+ CTL) and long-lasting suppression of lymphocytic IFN-c production account for stroke associated infections and poor outcome (Hug et al., 2009; Klehmet et al., 2009; Urra et al., 2009). The present data showed that CART could remarkably upregulate spleen CD4+/CD8+ ratio while downregulating the stroke-induced increase of blood Treg cells at 96 h, indicating that CART might have an effect on the immunomodulators Treg cells. Furthermore, Treg cells and immunoinhibitory cytokine IL-10 could be the key mechanisms in brain-induced immunodepression (Chamorro et al., 2006; Klehmet et al., 2009; Lakhan et al., 2009). The study further demonstrated that CART markedly reduced Treg cells at 96 h, while enhancing the level of IL-10 at 96 h after occlusion. Treg cells are a specialized subpopulation of T cells that act to suppress activation of the immune system and thereby maintain immune system homeostasis and tolerance to self-antigens. And Treg cells are major cerebroprotective modulators of post-ischemic inflammatory brain damage. Absence of Treg cells augments the invading T cells and increases deleterious cerebral IFN-c and, as a result, increases delayed brain damage and deteriorated functional outcomes (Liesz et al., 2009). The molecular mechanism by which regulatory T cells exert their regulatory activity has not been definitively characterized. The immunosuppressive cytokines including IL-10 and TGF-b are implicated in Treg cell function. In a mouse MCAO model, there was an obvious induction of Treg cells after the initial surge in inflammatory cytokines. MCAO-treated mice had an increase in FoxP3 message and a noted increase in CD4+CD25+FoxP3+ Treg cells in spleen tissue compared with sham-treated mice (Offner et al., 2006b). Furthermore, Treg cells were demonstrated to play a neuroprotective role in acute ischemic stroke in a mouse model. Stroke-injured mice with no functioning Treg cells in blood had greater brain damage and deteriorated functional outcome than animals with functioning Treg cells. Treg cells prevent secondary infarct growth by counteracting excessive production of pro-inflammatory cytokines and by modulating invasion and/or activation of lymphocytes and microglia in the ischemic brain. Treg cell-derived secretion of IL-10 is the key mediator of Treg cells’ neuroprotective effect by suppression of pro-inflammatory cytokines production. On the other hand, the transfer of genetically modified Treg cells unable to produce IL-10 offered no protection (Liesz et al., 2009). Present study results also confirmed that Treg cells, as immunomodulators in ischemic stroke, may exert a neuroprotective effect. 4.2. CART modulates stroke-induced changes in serum cytokines Findings of the present study corroborate that CART can regulate the cytokine expression provoked by stroke. It is widely ac-

267

cepted that cytokines serve as critical mediators in local inflammatory response, which accounts for secondary ischemic brain injury. Recently, emerging evidence suggests that post-stroke serum cytokines correlate with brain infarct volume and stroke severity and may have a predictive value for stroke outcome (Zaremba and Losy, 2004). As indicated by this study, from 6 to 24 h after occlusion, serum TNF-a and IFN-c in MCAO-treated mice were significantly elevated compared to sham-treated mice. TNF-a is a major pro-inflammatory cytokine involved in systemic inflammation, which is produced mainly by macrophages, but also by a variety of other cell types including lymphoid cells, mast cells, endothelial cells and neuronal tissue. Zaremba et al. found that patients with stroke within 24 h after onset demonstrated significantly higher TNF-a levels in CSF and serum in comparison with a control group (Zaremba and Losy, 2001b). This correlated significantly with the Scandinavian Stroke Scale (SSS) and with Barthel Index (BI) scores (Zaremba and Losy, 2001a), suggesting that the early levels of TNF-a are predictive for the outcomes of stroke. Conversely, an investigation reveals that although patients with cerebral ischemia had an early and prolonged increase in serum TNF-a level after stroke onset, multivariate analysis showed that increased serum TNF-a level was unrelated to the lesion size, neurological impairment, age, sex, vascular risk factors or infectious complications (Intiso et al., 2004). IFN-c is also a pro-inflammatory cytokine which is critical for innate and adaptive immunity against viral and intracellular bacterial infections. In contrast to TNF-a, which can be expressed by all cells, IFN-c is produced predominantly by Th1 cells, CTL, dendritic cells and NK cells. Previous data demonstrated a plasma elevation of IFN-c and MCP-1 in MCAO mice compared to sham mice at 6 h after occlusion, as well as IL-6 at both 6 and 22 h time point (Offner et al., 2006a). Thus, CART might protect injured brain and improve stroke outcome through downregulating pro-inflammatory cytokines. By 96 h after stroke, a dominant role of anti-inflammatory cytokines (IL-4, IL-10) was still observed in MCAO mice suggesting that CART could further enhance serum anti-inflammatory cytokine levels. IL-4 is a cytokine that induces differentiation of naive helper T cells to Th2 cells. It is widely accepted as a key regulator in humoral and adaptive immunity, though its source has not been identified. IL-10 is another anti-inflammatory cytokine produced primarily by monocytes and to a lesser extent by lymphocytes and has pleiotropic effects on immunoregulation and inflammation. Anti-inflammatory cytokines act in a feedback loop to inhibit continued pro-inflammatory cytokine production and may protect the ischemic brain from inflammation-mediated injury. Vila reported that in patients with acute ischemic stroke, lower plasma concentrations of IL-10, not IL-4 on admission were associated with clinical worsening (higher Canadian stroke scale score) 48 h after stroke onset on multivariate analysis independent of hyperthermia, hyperglycemia, or neurological condition on admission (Vila et al., 2003). That indicates that IL-10 could provide neuroprotection in acute ischemic stroke. CART’s enhancement on anti-inflammatory cytokine expression might contribute to its protection against stroke-induced brain damage. 4.3. CART exerts neuroprotection in experimental stroke CART as a pleiotropic transmitter is implicated in the regulation of many physical processes and its prospective function is still under extensive investigation. A previous study identified the induction of CART expression in cerebral cortical neurons by estrodiol after experimental ischemia in a MCAO mice model and demonstrated CART peptide could reduce neuron injury in vivo and in vitro (Xu et al., 2006). However, the underlying mechanisms for CART’s neuroprotective effect were not fully explained. It has been reported that CART’s neuroprotective effect may involve acti-

268

L. Chang et al. / Brain, Behavior, and Immunity 25 (2011) 260–269

vation of the ERK signal pathway (Jia et al., 2008) and demonstrated a mitochondrial-based mechanism of CART-induced neuroprotection, showing CART improved energy production in ischemia (Mao et al., 2007). The data of the present study indicate that CART’s neuroprotective effect is accompanied by less expression of pro-inflammatory cytokines in the ischemic brain, suggesting that CART might exert neuroprotection in part through an inflammation modulating mechanism. 4.4. Interrelationship between CART’s neuroprotection, immunomodulation and SNS pathway in the mouse MCAO model Reciprocal relationships between CART and immune system function have not been established. As mentioned above, CART could modulate peripheral immune response and inflammation after stroke. In addition, in a recent study which investigated the immunomodulatory activity of CART in rats (Bik et al., 2008b), CART showed a transient immunosuppressive effect which lasted no more than 120 min after icv infusion. This short-lasting immunoinhibitory effect seemed to not result from a direct action of CART on immune cells, indicating CART may exert immunomodulation indirectly through immunoinhibitory neuroimmune pathways or immunosuppressive cells/molecules. Therefore, based on the immune cell accumulation, cytokine molecule and hormone expression changes observed in this study, it is speculated that CA (the end product of SNS axis), Treg cells and IL-10 might be mediators of CART’s immunomodulatory effect in stroke. Primary and secondary lymphoid organs are innervated extensively by noradrenergic sympathetic nerve fibers. Furthermore, immune cells bear functional adrenoreceptors. Through stimulation of these receptors, locally released NE, or circulating CAs can regulate cellular and humoral immunity. CAs seem to inhibit selectively Th1 activities and cellular immunity and to boost Th2 and humoral responses (Elenkov et al., 2000). This can explain the leading role of Th2 type response at 96 h in the present study, with early increased serum CAs levels at 6, 24 h. Although the immunoinhibitory CNS mechanisms after stroke have not been completely understood, activation of key neuroimmune pathways including hypothalamo-pituitary-adrenal (HPA) axis and sympathetic nervous system (SNS) axis have been identified (Emsley and Hopkins, 2010; Meisel et al., 2005; Woiciechowsky et al., 1999). The counter-inflammatory responses may ultimately compromise immune responses required to cope with pathogens and lead to post-stroke infection. An immunohistochemical study revealed a well-defined network of CART-immunoreactive (irCART) neurons organized along the sympatho-adrenal axis (Dun et al., 2006). Sympathetic preganglionic neurons in the lateral horn area were CART-positive, which in turn innervated postganglionic neurons in the paravertebral and prevertebral sympathetic ganglia as well as the adrenal medulla. Intracerebroventricular injections of CART 55–102 to conscious rabbits increased plasma levels of CA (epinephrine and norepinephrine), which could be blocked by a ganglion-blocking agent, suggesting that CART may have a role in regulation of SNS (Matsumura et al., 2001). This study showed an increased serum CA over a 96 h time course in MCAO mice, suggesting that SNS axis was activated after stroke. An additional notable finding of this study was that CART can modulate stroke-induced activation of the SNS pathway. It is interesting to note that in the present investigation iv injection of CART 55–102 could upregulate post-stroke serum CA level at both 6 h and 24 h, while downregulating poststroke serum CA level at 96 h, indicating a bi-phase regulatory effect of CART on serum CA in stroke. However, CART does not affect serum CA in sham group (data did not show). Taken together, CART may modulate post-stroke immune response by affecting the neuroimmune pathway of SNS and there-

fore attenuate the local inflammation in the ischemic brain and protect the injured brain and improve neurological function after stroke. Acknowledgments This work was supported by funding from the National Natural Science Foundation of China (30971010, 30670739), the Doctoral Program Foundation of the Ministry of Education of China (20060284044), Outstanding Researcher Program (RC2007006) and the National Natural Science Foundation (BK2009037) of Jiangsu Province of China, funding from the State Key Laboratory of Pharmaceutical Biotechnology of Nanjing University (KF-GN200901), and the 973 Program from the Ministry of Science and Technology of China (2009CB521906). We thank Brad Brown for editing the paper. References Arumugam, T.V., Granger, D.N., Mattson, M.P., 2005. Stroke and T-cells. NeuroMol. Med. 7, 229–242. Bik, W., Skwarlo-Sonta, K., Szelagiewicz, J., 2008a. Involvement of the cocaineamphetamine regulated transcript peptide (CART 55–102) in the modulation of rat immune cell activity. Neuroendocrinology Letters 29, 359–365. Bik, W., Skwarlo-Sonta, K., Szelagiewicz, J., Wolinska-Witort, E., Chmielowska, M., Martynska, L., Baranowska-Bik, A., Baranowska, B., 2008b. Involvement of the cocaine-amphetamine regulated transcript peptide (CART 55–102) in the modulation of rat immune cell activity. Neuro Endocrinol Lett 29, 359–365. Chamorro, A., Amaro, S., Vargas, M., Obach, V., Cervera, A., Torres, F., Planas, A.M., 2006. Interleukin 10, monocytes and increased risk of early infection in ischaemic stroke. J Neurol. Neurosurg. Psychiatry. 77, 1279–1281. Chen, Z.B., Huang, D.Q., Niu, F.N., Zhang, X., Li, E.G., Xu, Y., 2010. Human urinary kallidinogenase suppresses cerebral inflammation in experimental stroke and downregulates nuclear factor-kappaB. J Cereb Blood Flow Metab. Dun, S.L., Brailoiu, G.C., Yang, J., Chang, J.K., Dun, N.J., 2006. Cocaine- and amphetamine-regulated transcript peptide and sympatho-adrenal axis. Peptides 27, 1949–1955. Elenkov, I.J., Wilder, R.L., Chrousos, G.P., Vizi, E.S., 2000. The sympathetic nerve–an integrative interface between two supersystems: the brain and the immune system. Pharmacol. Rev. 52, 595–638. Emsley, H.C., Hopkins, S.J., 2010. Post-Stroke Immunodepression and Infection: An Emerging Concept. Infect Disord Drug Targets 9. Hug, A., Dalpke, A., Wieczorek, N., Giese, T., Lorenz, A., Auffarth, G., Liesz, A., Veltkamp, R., 2009. Infarct volume is a major determiner of post-stroke immune cell function and susceptibility to infection. Stroke 40, 3226–3232. Intiso, D., Zarrelli, M.M., Lagioia, G., Di Rienzo, F., Checchia De Ambrosio, C., Simone, P., Tonali, P., Cioffi Dagger, R.P., 2004. Tumor necrosis factor alpha serum levels and inflammatory response in acute ischemic stroke patients. Neurol. Sci. 24, 390–396. Jia, J., Chen, X., Zhu, W., Luo, Y., Hua, Z., Xu, Y., 2008. CART protects brain from damage through ERK activation in ischemic stroke. Neuropeptides 42, 653–661. Jin, R., Yang, G., Li, G., 2010. Inflammatory mechanisms in ischemic stroke: role of inflammatory cells. J. Leukoc. Biol. Klehmet, J., Harms, H., Richter, M., Prass, K., Volk, H.D., Dirnagl, U., Meisel, A., Meisel, C., 2009. Stroke-induced immunodepression and post-stroke infections: lessons from the preventive antibacterial therapy in stroke trial. Neuroscience 158, 1184–1193. Lakhan, S.E., Kirchgessner, A., Hofer, M., 2009. Inflammatory mechanisms in ischemic stroke: therapeutic approaches. J. Trans. Med. 7, 97. Liesz, A., Suri-Payer, E., Veltkamp, C., Doerr, H., Sommer, C., Rivest, S., Giese, T., Veltkamp, R., 2009. Regulatory T cells are key cerebroprotective immunomodulators in acute experimental stroke. Nat. Med. 15, 192–199. Mao, P., Ardeshiri, A., Jacks, R., Yang, S., Hurn, P.D., Alkayed, N.J., 2007. Mitochondrial mechanism of neuroprotection by CART. Eur. J. NeuroSci. 26, 624–632. Matsumura, K., Tsuchihashi, T., Abe, I., 2001. Central human cocaine- and amphetamine-regulated transcript peptide 55–102 increases arterial pressure in conscious rabbits. Hypertension 38, 1096–1100. Meisel, C., Schwab, J.M., Prass, K., Meisel, A., Dirnagl, U., 2005. Central nervous system injury-induced immune deficiency syndrome. Nat. Rev. Neurosci. 6, 775–786. Offner, H., Subramanian, S., Parker, S.M., Afentoulis, M.E., Vandenbark, A.A., Hurn, P.D., 2006a. Experimental stroke induces massive, rapid activation of the peripheral immune system. J. Cereb. Blood Flow Metab. 26, 654–665. Offner, H., Subramanian, S., Parker, S.M., Wang, C., Afentoulis, M.E., Lewis, A., Vandenbark, A.A., Hurn, P.D., 2006b. Splenic atrophy in experimental stroke is accompanied by increased regulatory T cells and circulating macrophages. J. Immunol. 176, 6523–6531. Offner, H., Vandenbark, A.A., Hurn, P.D., 2009. Effect of experimental stroke on peripheral immunity: CNS ischemia induces profound immunosuppression. Neuroscience 158, 1098–1111.

L. Chang et al. / Brain, Behavior, and Immunity 25 (2011) 260–269 Prass, K., Meisel, C., Hoflich, C., Braun, J., Halle, E., Wolf, T., Ruscher, K., Victorov, I.V., Priller, J., Dirnagl, U., Volk, H.D., Meisel, A., 2003. Stroke-induced immunodeficiency promotes spontaneous bacterial infections and is mediated by sympathetic activation reversal by poststroke T helper cell type 1-like immunostimulation. J. Exp. Med. 198, 725–736. Theodorou, G.L., Marousi, S., Ellul, J., Mougiou, A., Theodori, E., Mouzaki, A., Karakantza, M., 2008. T helper 1 (Th1)/Th2 cytokine expression shift of peripheral blood CD4+ and CD8+ T cells in patients at the post-acute phase of stroke. Clin. Exp. Immunol. 152, 456–463. Urra, X., Cervera, A., Villamor, N., Planas, A.M., Chamorro, A., 2009. Harms and benefits of lymphocyte subpopulations in patients with acute stroke. Neuroscience 158, 1174–1183. Vila, N., Castillo, J., Davalos, A., Esteve, A., Planas, A.M., Chamorro, A., 2003. Levels of anti-inflammatory cytokines and neurological worsening in acute ischemic stroke. Stroke 34, 671–675. Vogelgesang, A., Grunwald, U., Langner, S., Jack, R., Broker, B.M., Kessler, C., Dressel, A., 2008. Analysis of lymphocyte subsets in patients with stroke and their influence on infection after stroke. Stroke 39, 237–241.

269

Woiciechowsky, C., Schoning, B., Lanksch, W.R., Volk, H.D., Docke, W.D., 1999. Mechanisms of brain-mediated systemic anti-inflammatory syndrome causing immunodepression. J. Mol. Med. 77, 769–780. Xu, Y., Zhang, W., Klaus, J., Young, J., Koerner, I., Sheldahl, L.C., Hurn, P.D., MartinezMurillo, F., Alkayed, N.J., 2006. Role of cocaine- and amphetamine-regulated transcript in estradiol-mediated neuroprotection. Proc Natl Acad Sci USA 103, 14489–14494. Yilmaz, G., Arumugam, T.V., Stokes, K.Y., Granger, D.N., 2006. Role of T lymphocytes and interferon-gamma in ischemic stroke. Circulation 113, 2105– 2112. Zaremba, J., Losy, J., 2001a. Early TNF-alpha levels correlate with ischaemic stroke severity. Acta Neurol. Scand. 104, 288–295. Zaremba, J., Losy, J., 2001b. Tumor necrosis factor alpha (TNF-alpha) in patients with ischemic stroke. Neurol. Neurochir. Pol. 35, 41–46. Zaremba, J., Losy, J., 2004. Cytokines in clinical and experimental ischemic stroke. Neurol. Neurochir. Pol. 38, S57–S62.