Comparative proteomic analysis of hemolymph proteins from Autographa californica multiple nucleopolyhedrovirus (AcMNPV)-sensitive or -resistant silkworm strains during infections

    Comparative proteomic analysis of hemolymph proteins from Autographa californica multiple nucleopolyhedrovirus (AcMNPV) -sensitive or -resistant silkworm strains during infections Jian Xu, Pingbo Zhang, Takahiro Kusakabe, Hiroaki Mon, Zhiqing Li, Li Zhu, Kazuhiro Iiyama, Yutaka Banno, Daisuke Morokuma, Jae Man Lee PII: DOI: Reference:

S1744-117X(15)00051-9 doi: 10.1016/j.cbd.2015.07.003 CBD 371

To appear in:

Comparative Biochemistry and Physiology - Part D: Genomics and Proteomics

Received date: Revised date: Accepted date:

16 March 2015 21 July 2015 26 July 2015

Please cite this article as: Xu, Jian, Zhang, Pingbo, Kusakabe, Takahiro, Mon, Hiroaki, Li, Zhiqing, Zhu, Li, Iiyama, Kazuhiro, Banno, Yutaka, Morokuma, Daisuke, Lee, Jae Man, Comparative proteomic analysis of hemolymph proteins from Autographa californica multiple nucleopolyhedrovirus (AcMNPV) -sensitive or -resistant silkworm strains during infections, Comparative Biochemistry and Physiology - Part D: Genomics and Proteomics (2015), doi: 10.1016/j.cbd.2015.07.003

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Comparative proteomic analysis of hemolymph proteins from Autographa californica multiple nucleopolyhedrovirus (AcMNPV) -sensitive or -resistant

PT

silkworm strains during infections Jian Xua, Pingbo Zhangb, Takahiro Kusakabea, Hiroaki Mona, Zhiqing Lic, Li

a

SC RI

Zhua, Kazuhiro Iiyamad, Yutaka Bannob, Daisuke Morokumaa, Jae Man Leea*

Laboratory of Insect Genome Science, Kyushu University Graduate School of

Bioresource and Bioenvironmental Sciences, 6-10-1 Hakozaki Higashi-ku, Fukuoka b

NU

812-8581, Japan

Laboratory of Silkworm Genetic Resources, Institute of Genetic Resources, Graduate

ku, Fukuoka 812-8581, Japan c

State Key Laboratory of Silkworm Genome Biology, Southwest University,

ED

Chongqing 400716, P.R. China d

MA

School of Bio Resources and Bioenvironmental Science, Kyushu University, Higashi-

Laboratory of Insect Pathology and Microbial Control, Institute of Biological

PT

Control, Faculty of Agriculture, Graduate School, Kyushu University, Hakozaki 6-10-

CE

1, Higashi-ku, Fukuoka 812-8581, Japan

AC

Running title: Hemolymph proteins responsible for AcMNPV infection

m.s. has 40 pages, 6 figures, 3 tables, 3 suppl. files

*Corresponding author: Dr. Jae Man Lee Laboratory of Insect Genome Science, Kyushu University Graduate School of Bioresource and Bioenvironmental Sciences, 6-10-1 Hakozaki Higashi-ku, Fukuoka 812-8581, Japan Tel/Fax: +81 92 642 2842 E-mail: [email protected]

1

ACCEPTED MANUSCRIPT Abstract We reported previously that baculovirus AcMNPV host-ranges in silkworm strains are controlled by a novel third chromosomal locus. To further isolate the potential

PT

host factor and uncover the functional pathway involved, in this study we analyzed hemolymph proteins from AcMNPV-resistant or -sensitive silkworm strains infected

SC RI

with baculoviruses. All the protein spots from 2D electrophoresis were characterized by MALDI-TOF MS and further systematically assessed for differentially regulated proteins at different stages of infection. Subsequently, six candidates were selected for functional analysis using Bm5 cells, where the candidates were knocked-down or We

observed

that

mRNA

expression

levels

of

beta-N-

NU

overexpressed.

acetylglucosaminidase and prophenoloxidase subunit 2 are significantly upregulated

MA

during AcMNPV infections in Bm5 cells. Ultimately, we found that RNA interference of ribosomal protein RpL34 causes serious damages to cell viability as well as abortive infection, indicating that ribosomal components are essential for productive

ED

baculovirus infection.

CE

1. Introduction

PT

Keywords: Baculovirus, Hemolymph proteins, Silkworm, Proteomic analysis

Baculoviruses are insect-specific double-stranded DNA viruses generally encountered

AC

in nature. The virions of Nucleopolyhedroviruses (NPVs) are present as two types: occlusion-derived virions (ODVs) and budded virions (BVs) (Blissard and Rohrmann, 1990). ODVs are responsible for the primary infection and spread the infection between insect hosts whereas BVs transmit the infections withi h st ce s

ei y

et al., 1992). Due to the strict host specificity, NPVs are largely researched for their applications in pest management and in mass-production of exogenous recombinant proteins. The BV of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) can efficiently infect/transduce, but not replicate, a wide variety of insect and mammalian cells and organisms; thus it could possibly be utilized as a promising safe vector for gene delivery (Hofmann et al., 1995; Boyce et al., 1996; McCall et al., 2005). Bombyx mori strains have been widely researched as unique model insects for various purposes, such as silk production improvement, foreign protein expression and novel 2

ACCEPTED MANUSCRIPT genetic development and immune system analyses (Xia et al., 2014). When exposed to a pathogen, invertebrates rely on their powerful innate but not adaptive immune system to survive (Schmidt et al., 2008, Tsakas and Marmaras, 2010). Cellular

PT

response pathways, such as Toll-like receptor (TLR) and immune deficiency (Imd) signaling, have been described in Drosophila (Buchon et al., 2014; Imler, 2014) and

SC RI

the silkmoth Hyalophora cecropia (Hultmark et al., 1983), in which the secretion of several antimicrobial peptides (AMPs) to the hemolymph was induced (CasanovaTorres and Goodrich-Blair, 2013). This process is initiated by pathogen detection using specific pattern-recognition molecules that bind conserved structures of a

NU

certain microorganism, e.g., the host recognizes bacteria peptidoglycan (PGN) by PGN recognition proteins (PGRPs) (Eleftherianos et al., 2006; Tsakas and Marmaras,

MA

2010; Myllymäki et al., 2014). However, to our knowledge, Lepidopteran hostrecognition proteins for baculovirus have not yet been determined. As described recently by Wang et al (2014), the entry of baculovirus budded virions into host cell is

ED

mediated by two distinct types of envelope fusion proteins (EFPs), GP64 and F protein, via endocytosis or by a low-pH-triggered direct membrane fusion pathway

PT

(Wang et al., 2014). Many reports have demonstrated that many factors from virus (e.g. immediate early genes ie-1/DNA helicase p143 and microRNA) are involved in

CE

viral replication cycles and host-range determinations (Blissard and Rohrmann, 1990; Maeda et al., 1993; Thiem et al., 1996; Argaud et al., 1998; Rahman and Gopinathan, 2003; Ishikawa et al., 2004; Singh et al., 2010; Singh et al., 2012). Meanwhile the

AC

hosts, both plant and animals, take advantage of RNA interference (RNAi)-mediated antiviral responses to suppress replication of diverse viruses (Ding and Voinnet, 2007; Aliyari and Ding, 2009). Notably, RNAi is currently considered as the major antiviral immune defense mechanism in Drosophila (Kemp et al., 2013). In the case of NPVs, no RNAi pathway proteins from Lepidopteran insects have been reported as suppressors limiting viral replications. Interestingly, emerging research shows that potential host factors are also involved in recognition/replication of NPVs (Terenius, 2008; Kang et al., 2011; Jiang et al., 2012; Lü et al., 2013; Turkki et al., 2013; Makkonen et al., 2013; Jin et al., 2014). However, factors affecting host cell permissiveness to BV infection/transduction remain largely unknown. Hence, it is of great interest to study the host gene regulations upon viral infections. It is well known that BmNPV but not AcMNPV is a native pathogen of silkworm and its tissue-derived cell lines (Shikata et al., 1998; Yamao et al., 1999). According to 3

ACCEPTED MANUSCRIPT our previous studies on AcMNPV host-ranges in silkworm strains (Xu et al., 2014), a novel third chromosomal locus from silkworm was found to control its susceptibility to AcMNPV. To further identify the potential host factor and uncover the functional

PT

pathway involved, in this study we utilized AcMNPV-resistant and -sensitive strains to analyze the hemolymph proteins expressed against the AcMNPV infection. From

SC RI

2-D gel electrophoresis, we identified 63 hemolymph proteins validated by MALDITOF MS. We assessed the differentially regulated proteins in two strains after the AcMNPV infection. Then we further selected 6 candidate genes and dissected their functions in Bm5 cells where the candidates were knocked-down or overexpressed.

NU

Finally, we found that silkworm ribosomal protein L34 is required for productive

2. Materials and Methods

ED

2.1 Silkworm strains and cell lines

MA

baculoviral replications.

The silkworm strains, d17 (AcMNPV-sensitive) and w05 (AcMNPV-resistant), were

PT

supplied by the silkworm stock center of Kyushu University supported by the National

BioResource

Project

(NBRP,

CE

http://www.shigen.nig.ac.jp/silkwormbase/index.jsp). The silkworms were reared at 25-27 °C on fresh mulberry leaves. The B. mori Bm5, Bm5-SID1 and S. frugiperda Sf9 (Life Technologies, New York, NY) cell lines were maintained at 27 °C in IPL-

AC

41 medium (Sigma-Aldrich, St. Louis, MO) and Grace insect medium (Life Technologies), respectively, both supplemented with 10 % fetal bovine serum (Gibco, Grand island, NY).

2.2 Viruses, inoculation and sample preparation The recombinant bacmids, AcMNPV-null, AcMNPV-Luciferase (Luc), AcMNPVmCherry and BmNPV-Luc were prepared in Sf9 and Bme21 cells (Lee et al., 2012) following the manufacturer’s instruction (Life Technologies). The high concentration viral stocks (P3) were kept in the dark at 4 °C until use. The viral titer was determined by the end-point dilution method ( ’ ei y et al., 1992). The d17/w05 fifth instar larvae at day 3 were inoculated by hemolymph injection with 10 μ

f rec mbi a t

AcMNPV-null baculovirus. The hemolymph was collected from 24, 48, or 72 hours after AcMNPV infection and samples from 10 larvae were mixed and centrifuged at 4

ACCEPTED MANUSCRIPT 15 000 g at 4 °C. The supernatant was buffered in a lysis solution (8 M urea, 4% (w/v) CHAPS, protease inhibitors cocktail (Roche Diagnostics GmbH, Mannheim, Germany), and 30 mM 1,4-dithiothreitol). The protein samples were then adjusted to

PT

a final concentration of about 10 mg/mL, which was determined by Bio-Rad protein assay kit (Bio-Rad, Hercules, CA, USA). All the samples were stored at -80 °C until

SC RI

use.

To analyze the dynamic responses of candidate genes against viral infections, we collected total RNAs from mock-infected or AcMNPV-mCherry-infected (MOI=1)

NU

Bm5 cells at 24, 48 and 72 hpi, respectively. Then semi-quantitative RT-PCR was performed using gene-specific primers listed in Table 3. The B. mori glyceraldehyde-

MA

3-phosphate dehydrogenase (GAPDH) gene was used as internal control. The expression of mCherry gene driven by polyhedrin promoter was employed to monitor viral replications. The PCR cycles were programmed as follows: initial denaturation

ED

at 95 °C for 5 min, then 25-32 cycles consisting of 95 °C for 15 s, 57 °C for 15 s, and 72 °C for 1 min followed by a final extension step of 5 min at 72 °C. Subsequently,

PT

the PCR products (amplicon length was listed in Table 3) were electrophoresed on a 1 % agarose gel and stained with ethidium bromide. The relative gene expression levels

CE

based on band intensity were quantitated by ImageJ software and normalized to the GAPDH levels. At least three independent replicates were performed for each sample.

AC

Indicated P va ue was assessed by Stude t’s t-test (*P < 0.05).

2.3 2-D gel electrophoresis Total hemolymph protein (100 μg) was dissolved in rehydration solution (8.0 M urea, 2% CHAPS, 0.8% DTT, 0.5% IPG buffer, pH 3-10, and 0.002% bromophenol blue) at room temperature for about 12 hours and were subjected to a 13 cm pH 3-10 IPG strip (Amersham Pharmacia Biotech, Orsay, France) for Isoelectric focusing (IEF). Then the strips were equilibrated for 15 min in 50 mM Tris-HCl buffer pH 8.8 (6 M urea, 2% SDS, 30% glycerol, and 1% DTT) and re-equilibrated for another 15 min in 2.5% iodoacetamide (instead of DTT) containing Tris-HCl buffer. The 2-DE was performed in 15% resolving polyacrylamide gel using a vertical slab gel apparatus (Eido, Japan). The protein spots were visualized by silver staining according to the ma ufacturer’s i structi

(BioRad Laboratories, Hercules, CA). Spots were

photographed using a digital scanner and analyzed by PDQuest 8.0 program (BioRad 5

ACCEPTED MANUSCRIPT Laboratories, Hercules, CA). At least three replicates were performed for each sample. Stude t’s t-test with 95% significance level was performed in program to determine

2.4 MALDI-TOF MS analysis and Database search

PT

which proteins were differentially expressed.

SC RI

Protein spots were excised from the 2-D gel, washed twice with Milli-Q water, destai ed with 100 μL f 1:1 v/v) s uti

f 30 mM p tassium ferr cya ide a d 100

mM sodium thiosulfate. The supernatant was discarded and the gel pieces were dehydrated with 100% ACN for 5 min, then rehydrated with 15 μL f 50 mM ium bicarb

ate c

tai i g 20 μg/mL f trypsi

Seque ci g Grade, Promega,

NU

amm

Madison, WI, USA) at 37° C for overnight digestion. Then the resulting peptides ected a d further mixed with a equa v ume f saturated α-Cyano-4-

MA

were c

hydroxycinnamic acid (CHCA, sigma) solution containing 0.1% TFA and 50% ACN. The mixture was analyzed with MALDI-TOF MS (Applied Biosystems, Tokyo,

ED

Japan) using a delayed ion extraction. All the spectra were calibrated with trypsin auto-digestion ion peak m/z (842.510 and 2211.1046), which were used as internal

PT

standards. As for the protein identifications, the local database was built from the silkworm predicted protein sequences (14623 records) available from SilkDB

CE

(http://silkworm.swu.edu.cn/silkdb/doc/download.html). Then the processed peptide mass fingerprints were used for protein/mass analysis using GPMAW software 6.0.

AC

2.5 RNA interference, cell proliferation assay and reporter assay First-strand cDNA from Bm5/Bm5-SID1 cells was synthesized by reverse transcription (ReverTra Ace, Toyobo, Japan) from 1 µg of RNA isolated using ISOGEN (Nippon Gene, Japan) using an oligo-dT primer according to the ma ufacturer’s i structi

. F r d ub e-stranded RNA (dsRNA) synthesis, all the

fragments were amplified from the first-strand cDNA using the gene-specific primers i c udi g a additi

a T7 pr m ter seque ce at b th 5’ a d 3’ termi us

isted i

Table 3). The dsRNAs were synthesized by in vitro transcription with T7 RNA polymerase (TakaraBio, Shiga, Japan) as described previously (Li et al., 2012). The soaking RNAi in Bm5-SID1 cells were performed according to our previous study (Mon et al., 2012). RT-PCR was performed to confirm the knockdown efficiency except for the gene-specific primers used (Table 3). Detailed PCR parameters and statistical analysis methods were described in Section 2.2. The B. mori GAPDH gene 6

ACCEPTED MANUSCRIPT was used as internal control. Time-course cell proliferation assay after dsRNA treatment was carried out in a 96-well plate through a Cell Counting kit-8 (Dojindo, s.

PT

T ky , Japa ) acc rdi g t the ma ufacturer’s i structi

The dsRNA-treated cells were further infected with recombinant AcMNPV- or

SC RI

BmNPV-Luc. At 4 days post infection (dpi), cells were harvested and the lysates were assayed to monitor viral replications as described previously (Xu et al., 2013). All of the experiments were performed at least in triplicate.

NU

2.6 DNA construct, plasmid transfection and cell imaging

MA

To determine the subcellular localization of silkworm ribosomal protein L34 (BmRpL34), the BmRpL34 gene (NCBI accession No. KP019933) was amplified and cloned to a pENTRTM11 (Invitrogen) vector. The nucleotide sequences of plasmids

ED

were confirmed by DNA sequencing. The piggyBac-based transposition vector, pPBO-ie2GW (N-terminal EGFP-fused, Li et al., 2013), was used to generate

PT

expression cassette for silkworm cells. Transfection was performed using Fugene HD Transfection Reagent (Promega) according to the manufacturer's protocols. The

CE

fluorescence microscopy images were captured using Biozero BZ-8000 microscope

AC

(Keyence, Osaka, Japan).

3. Results

3.1 Identification of hemolymph proteins from AcMNPV-sensitive and -resistant silkworm strains We reported previously that silkworm strains demonstrated diverse response to AcMNPV infection due to certain potential unknown mechanisms (Xu et al., 2014). Since the d17 and w05 strains demonstrated totally different responses to AcMNPV infection, here we selected these strains as AcMNPV-sensitive or -resistant models for comparative proteomic analysis of hemolymph. Hemolymph proteins from the two strains were obtained at different phases of AcMNPV or mock infection and further separated on 2D-E gels (Supplementary Figure S1). Subsequently, a total of 63 proteins, 53 common proteins, and 6 and 4 proteins specific to w05 and d17,

7

ACCEPTED MANUSCRIPT respectively, were found (Figure 1), and all the protein spots were verified through MALDI-TOF MS as described in Materials and Methods. Subsequently, the calibrated spectra were analyzed with a local database from SilkDB (see details in

PT

Materials and Methods); the results are listed in Table 1. Functional categories for hemolymph proteins are termed according to their GO annotations and can be divided

SC RI

into three major groups, cellular component, molecular function and biological process (Supplementary Figure S2A). The SilkDB entry numbers of all identified spots were utilized to determine their chromosome loci in silkworm genomes. In our previous report, we concluded that unknown host factors regulating AcMNPV

2014).

In

the

current

study,

NU

replication (hfac) is supposed to be located on silkworm chromosome 3 (Xu et al., Spot

No.

4

(BGIBMGA007412),

No.

30

MA

(BGIBMGA007410), and Nos. 42 & 43 (BGIBMGA009028), were found mapped on the third chromosome (Supplementary Figure S2B).

ED

3.2 Differentially regulated proteins

Using PDQuest, the protein expression profiles with AcMNPV infection were

PT

analyzed at three time points (24 hpi, 48 hpi and 72 hpi) according to the volume of spots. Time-dependent fold-changes of all identified hemolymph proteins are further

CE

listed in Supplementary Table S1. Hierarchical cluster analysis was performed to identify proteins with certain patterns of change under AcMNPV infections. The regulated proteins were clustered into three distinguishable groups (Figure 2A).

AC

Cluster I includes 26 proteins downregulated in w05 strain but upregulated in d17 strain and cluster II contains 30 proteins upregulated in w05 strain but downregulated in d17 strain. Cluster III contained 7 proteins that were regulated similarly in both strains, whether up- or down-regulated. For further analysis of regulated proteins, we defined proteins with an expression change of >2.0-fold (up or down) as upregulated. As listed in Table 2, 76 and 54 spot counts were >2-fold-changed in w05 and d17 strains at all three time points, respectively, indicating that the AcMNPV-resistant silkworm strain demonstrates more drastic response to AcMNPV infection.

3.3 Functional analysis of candidate proteins Then we analyzed the proteins at late viral infection phase, 72 hpi. In summary, we found that 4 and 6 proteins were missing in w05 and d17, respectively (termed Type I, Figure 2B). Eleven (termed Type II: downregulated in w05 but upregulated in d17) 8

ACCEPTED MANUSCRIPT and 15 (termed Type III: upregulated in w05 but downregulated in d17) proteins were differentially regulated in w05 and d17, respectively (Figure. 2C, 2D). These differentially regulated hemolymph proteins may contribute to the diverging

PT

sensitivities to AcMNPV infections. Among these differentially regulated proteins, we further selected 6 candidates

baculovirus

infections

Prophenoloxidase

and/or

subunit

2

SC RI

(Figure 3A) for functional analysis of their potential involvement in AcMNPV replications.

The

(ProPO-2/PPO-2,

candidates

Type

I,

selected

Spot

No.

are 60,

BGIBMGA013115), Beta-N-acetylglucosaminidase (Beta-GlcNAcase, Type II, Spot

NU

No. 41, BGIBMGA005899), Ribosomal protein L34 (RpL34, Type III, Spot No. 4, BGIBMGA007412), Beta-1,3-galactosyltransferase 5 (B3GALT5, Type III, Spot No.

MA

26, BGIBMGA005534), Lark-PA (RNA-binding protein LARK, Type III, Spot No. 30, BGIBMGA007410), and Serpin 2 (Type III, Spot No. 34, BGIBMGA007720). Since transcriptome analysis has been reported in BmNPV infected Bm5 cells (Xue et

ED

al., 2012), we validated that all six genes are expressed at mRNA levels in Bm5 cells. Then RT-PCR was performed to verify the dynamic expression changes during the

PT

AcMNPV infection processes, 24 hpi, 48 hpi and 72 hpi, respectively (Figure 3B). From these results, we found that the Beta-GlcNAcase and PPO-2 genes are

CE

considerably upregulated, particularly at a late infection period of 72 hpi, indicating their possible involvement in host defense systems against AcMNPV infections.

AC

Subsequently, each candidate gene was knocked-down in Bm5-SID1 cells by the soaking RNAi method (Xu et al., 2013), after which the cell morphology was investigated (Figure 4A) and RNAi efficiency was checked by RT-PCR (Figure 4B). From these results, we confirmed that mRNA expression of each candidate was successfully depleted in Bm5 cells. Compared with other candidates, only after RNAi of RpL34 (Spot No. 4), cellular vesicles were substantially increased (Figure 4A: ds4) and the cell growth was drastically reduced (Figure 4C). Due to the loss of cell amplification when RpL34 was depleted, considerably decreased luciferase production was detected at 4 dpi after infection with AcMNPV-Luc or BmNPV-Luc, indicating that RpL34 is one of the essential proteins for cell survival and baculovirus gene transcription and/or replication in the baculovirus life cycle (Figure 4D).

3.4 Roles of RpL34 in baculovirus replications 9

ACCEPTED MANUSCRIPT To investigate the functions of RpL34 in silkworm cells in baculovirus infections, we transiently expressed N-terminal EGFP fusion RpL34 in Bm5 cells. To determine its subcellular localization without or with viral infection at early, late and very late

PT

phases, we infected EGFP-RpL34 expressing cells with AcMNPV- or BmNPVmCherry virus. As shown in Figure 5, green fluorescent signals mainly in the

SC RI

cytoplasm and additional nucleoli localization were observed in Bm5 cells, indicating that RpL34 may be involved in many cellular pathways. However, no subcellular translocation was detected through the infection processes (data not shown).

NU

4. Discussion

MA

Building on our previous results (Xu et al., 2014), in the present study we performed a comparative proteomic analysis of AcMNPV-susceptible silkworm strain d17 and AcMNPV-resistant strain w05. After intrahemocoelical inoculation, we identified all

ED

the hemolymph protein spots from 2-DE by mass spectrometry and analyzed the regulations at different time points. There has been considerable recent interest in the

PT

baculovirus‒insect interaction and in particular, the molecular mechanisms for virus infection and host response (Guo et al., 2005; Lee et al., 2007; Bao et al., 2009; Xue

CE

et al., 2012; Xu et al., 2014; Wöltje et al., 2014). Using BmNPV resistant and susceptible silkworm strains, Bao et al., (2009) identified by qRT-PCR that eight genes (gloverin-4, gloverin-3, lebocin, serpin-5, arylphorin, promoting protein,

AC

cathepsin B, and actin A3) were significantly upregulated in the midgut of the resistant (KN) strain. Wöltje et al., (2014) demonstrated that the viral chitinase and cysteine protease cathepsin are necessary to permit viral entry into the silk gland cells of AcMNPV-infected silkworm larvae.

4.1 Storage proteins and 30k lipoproteins, major hemolymph proteins of insect From our results, most storage proteins (e.g. Spots 46-49) and 30k lipoproteins (Spots 16 & 23) increased normally in the resistant w05 strain but downregulated in the permissive d17 strain at 72 hpi of AcMNPV. The expressions of many major proteins in silkworm hemolymph such as storage protein 1 (SP1), SP2 and 30k lipoproteins varied greatly at different developmental stages (Hou et al., 2010). In addition, SP1 and SP2 proteins show a strong sex-differentiation manner and boost during the last instar stage (Tojo et al., 1980; Fujii et al., 1989). In insects, these major hemolymph 10

ACCEPTED MANUSCRIPT proteins have been reported to be immune responders to microbial challenges (Chan et al., 2009; Reichhart et al., 2011; Lourenço et al., 2012; Zhong et al., 2012). Taken together with our observations in this study, it may indicate immune system

PT

impairment in the permissive strain during the late phase of AcMNPV infection. It was also interesting to observe that three 30k lipoproteins (Spots 18, 20, 21) acted

SC RI

oppositely in a downregulated or undetected pattern in the resistant w05 strain, which may suggest the precise functional organization of 30k lipoproteins in silkworm when exposed to different pathogens.

NU

4.2 Prophenoloxidases/Phenoloxidases

Melanization is one of the major immune responses in Arthropods, which is triggered

MA

in insect hemolymph by the recognition of pathogen-associated molecular patterns via pattern recognition receptors (Cerenius et al., 2004; Lu et al., 2014). The resulting melanin would contain a microbial pathogen and/or facilitate wound healing.

ED

Phenoloxidase (PO) is a key enzyme in the melanization process, which is primarily produced as zymogens or prophenoloxidases (PPOs). It is compelling to find that

PT

there is a differential accumulation of PPO1 and PPO2 proteins (spots 62 and 60, respectively, Supplementary Table 1) following baculovirus infection. Significant

CE

stage-dependent PPO2 protein accumulation starting 48 hpi was observed, whereas PPO1 exhibited modestly increased accumulation at 24 and 72 hpi but there was no change at 48 hpi. Consistently, we validated significant upregulated expression (4–6-

AC

fold) of PPO2 in AcMNPV-infected Bm5 cells. In lepidopteran insects, PPO is synthesized mainly by oenocytoids (Jiang et al., 1997). Most studies highlight the role of microbial activators in triggering of the PO cascade (González-Santoyo and Córdoba-Aguilar, 2012; Lu et al., 2014). In Drosophila and Pacifastacus leniusculus, PPO activation is required for survival against bacterial, e.g. Gram-positive, and fungal infections and parasite invasions (Liu et al., 2007; Nappi et al., 2009; Binggeli et al., 2014). Moreover, it is believed that PO activity increase following microbial infection is due to activation of PPO cascade rather than transcriptional regulation of PPO genes themselves (González-Santoyo and Córdoba-Aguilar, 2012). The results observed here lead us to speculate that silkworm shares similar anti-microbial pathway to induce defense gene expressions against both baculovirus and bacterial infections and PO cascade involving PPO2 may be one of the identical elicitors. It is also found that the expressions of PPOs (Spots 60, 61, and 62) seemed to be inhibited 11

ACCEPTED MANUSCRIPT in the d17 strain, indicating that the PPO-activated host defense is deficient in the AcMNPV-sensitive strain, possibly leading to productive viral replications. More detailed experiments are necessary to validate the hemolymph PO activity changes

SC RI

PO/PPO variation is activated using specific antibodies.

PT

after AcMNPV infections using melanization assay method, and to determine which

4.3 Serpins

In the current study, we detected that serpin-2 is upregulated in AcMNPV-resistant silkworm strain hemolymph while notably downregulated in the permissive d17

NU

hemolymph at 72 hpi. Serine protease is recognized as a major participant in insect immunity as well as an anti-BmNPV factor (Reichhart et al., 2011; Nakazawa et al.,

MA

2004). Each serine protease inhibitor (serpin) interacts with its target enzyme via an exposed reactive center loop. In Drosophila, microbial challenge induces removal of the serine protease inhibitor Serpin27A from the hemolymph through Toll-dependent

ED

transcription of an acute phase immune reaction component (Ligoxygakis et al., 2002). Besides, some serpins have been reported to function as the main negative

PT

regulators of PO cascade (Kanost, 1999; Tong and Kanost, 2005; An and Kanost, 2010). Serpins could maintain PO cascade in an inactive state in the absence of

CE

immune challenge and downregulate the cascade after infection (Cerenius and Söderhäll, 2004; Tong and Kanost, 2005). Upon infections of bacteria or fungi, serpins-4 and -5 increased 3–8-fold by 24 h in the tobacco hornworm, Manduca sexta.

AC

As discussed above on PPO/POs, these observations indicated that serpins and POs may function together as a perfect cascade to defense pathogens in insects. On the other hand, as reported by Bao et al., (2009), serine protease inhibitor serpin-5 is significantly upregulated in the midgut of a BmNPV-resistant silkworm strain after NPV infection. These results in silkworm suggest that serine protease and serpin family proteins themselves and their dynamic balances, likely serve as mediators to regulate the host defense to baculovirus infection, which is supposed to be largely distinct from bacterial and fungal infections.

4.4 Glycosyltransferases It is interesting to discover two regulated spots specifically involved in glycosylation pathways: B3GALT5 (Spot 26) and Beta-GlcNAcase (Spot 41). Both B3GALT5 and Beta-GlcNAcase were upregulated in the AcMNPV-infected d17 strain. Similarly, we 12

ACCEPTED MANUSCRIPT also validated the increased expressions of both candidates in Bm5 cells, notably Beta-GlcNAcase (2-fold at 72 hpi). It is known that most virion envelopes contain exclusively viral glycoproteins or host glycoproteins, e.g. human immunodeficiency

PT

virus type 1 (HIV-1) (Ward et al., 2015). A systemic study in HIV-1 demonstrated that glycans on envelope glycoproteins play a major role in viral infection and evasion

SC RI

of neutralization by antibodies (Wang et al., 2013). It is also known in NPVs that some viral essential proteins, e.g. glycoprotein 64 (gp64) and Fusion (F) proteins are glycosylated (Kadlec et al., 2008) and some, for instance, BRO-A from BmNPV, interact with host cell glycoproteins (Kang et al., 2003). Until now, there is no

NU

evidence showing that the NPV genome encodes glycosyltransferase enzymes (Rohrmann, 2011). Thus, it is reasonable to infer that without a host cellular

MA

glycosylation system or in disordered glycosylation states, NPVs could not replicate or transmit efficiently. However, it still remains unclear which glycosylation pathway/enzymes

are

employed

in

NPV-infected

cells.

B3GALT5

is

a

ED

galactosyltransferase isoform responsible for the synthesis of type 1 chain carbohydrates in mammals with a preference for the core3 O-linked glycan

PT

GlcNAc(beta1,3)GalNAc structure (Mare and Trinchera, 2007; Trinchera et al., 2014). In human cancer cells, B3GALT5 is regulated by transcription factors and

CE

epigenetic markers through its retroviral long terminal repeat (LTR) reporter (Trinchera et al., 2014). Beta-GlcNAcase catalyzes hydrolysis of terminal nonreducing

N-acetyl-D-hexosamine

residues

in

N-acetyl-beta-D-hexosaminides

AC

(Olszewska et al., 2007). Until now, there has been no report concerning their involvement in host-virus interactions. Our results indicate that the glycosylation pathway may influence viral replication directly through glycosylation enzymes or indirectly through their targeting glycoproteins.

4.5 RNA-binding proteins It has been reported that both cellular and viral proteins have a role in directing selective translation through specific binding to viral mRNA, e.g. human RNAbinding protein GRSF-1 (G-Rich Sequence Factor-1) specifically binds to conserved sequences within the influenza virus mRNA 5′ UT

Kash et al., 2002). Therefore,

certain host RNA-binding proteins would be utilized for selective translation of some essential viral genes. It is of interest that in AcMNPV infected d17 strain LARK was suddenly upregulated at 72 hpi. LARK (known as RBM4 in mammals) is a rhythmic 13

ACCEPTED MANUSCRIPT RNA-binding protein (RBP) translationally regulating the doubletime (dbt) gene in Drosophila, governing circadian-period modulation (Newby and Jackson, 1996; Jackson et al., 1997; McNeil et al., 1999). Over-expression of LARK causes period

PT

lengthening and increases protein abundance for certain targets without affecting the RNA level (Huang et al., 2007; Huang et al., 2014). It is reported that LARK is

SC RI

required for the organization of the actin cytoskeleton during oogenesis (McNeil et al., 2004). In silkworms, it is reported that LARK was upregulated during early response (15 hpi) to Beauveria bassiana challenges (Hou et al., 2014). The similar regulation patterns of LARK in AcMNPV-infected silkworms suggest that baculovirus and fungi

NU

may utilize LARK as translational regulatory machinery to target certain genes in

MA

infected silkworms.

4.6 Ribosomal proteins

In the current study, we found that RpL34 is upregulated in AcMNPV-resistant strain.

ED

Ribosomal proteins (RPs) are essential components of the ribosome, where genes are translated into proteins. RPs regulate gene expression by binding to other genes or

PT

specific transcription factors or their own mRNA/pre-mRNA/promoter and thus some may possess both intra- and extra-ribosomal functions (Brogna et al., 2002). While

CE

the role of RPs in silkworm is still totally unclear, their functions in mammals and fruit flies are largely investigated and somewhat well established (Brogna et al., 2002; Rugjee et al., 2013; Graifer et al., 2015). Spliced and un-spliced viral mRNA in the

AC

cytoplasm is translated by host cell ribosomal translation machinery (Gale et al., 2000; Kash et al., 2006). Upon BmNPV infection in silkworms, ribosomal P0 protein was found to be less extensively expressed in the BmNPV-resistant strain (A35) and was identified as one of the BmNPV-binding proteins, indicating that RP0 may be associated with BmNPV infection by regulating the gene expression of BmNPV (Cheng et al., 2014). Moreover, Xue et al., (2012) found that a large number of ribosomal genes were upregulated in BmNPV infected Bm5 cells, suggesting that ribosomal components are necessary and could facilitate viral gene transcription and translation. RPs from the L34E family including RpL34, are components of the large 60S subunit. Human RpL34 distributes mainly in the cytoplasm with additional location to the nucleoli. It was noted in HeLa cells as a novel interacting partner and an inhibitor of cyclin-dependent kinase 4 (CDK4) and CDK5 (Moorthamer and Chaudhuri, 1999). We identified that silkworm RpL34 locates mostly in nucleoli and 14

ACCEPTED MANUSCRIPT does not translocate in response to BmNPV/AcMNPV infections (Figure 5; Rugjee et al., 2013). After introduction of RNAi against RpL34, cell proliferation was extremely inhibited and remarkably low reporter protein was detected in both

PT

BmNPV/AcMNPV infected Bm5 cells. It is our hypothesis that the upregulated

SC RI

RpL34 may also function as a repressor in NPV-infected silkworms.

In the current study, we selected 6 candidates to analyze their possible involvement in NPV infections in cultured Bm5 cells. On the basis of the reporter assay, no significant influences on AcMNPV/BmNPV replications were detected when PPO-

NU

2/Serpin-2/Beta-GlcNAcase/B3GALT5/LARK was knocked-down in Bm5 cells. We also found that some candidate genes regulated differently in cultured Bm5 cells

MA

compared to silkworm individuals. Since Bm5 cells are ovary-derived and resistant to AcMNPV infection, it is our speculation that in vivo and in vitro immune responses of silkworm may differ significantly in baculovirus recognition and defense. In the light

ED

of current and previous results, we propose a model for the different regulations of AcMNPV-infected susceptive and resistant silkworms (Figure 6). We believe that our

PT

results should contribute to a better understanding of the molecular basis of insect immunity against double-stranded DNA viruses (Nie and Wang, 2013). Taken

CE

together with our previous research (Xu et al., 2014), more research is needed to determine the factor/locus responsible for the AcMNPV replications in silkworms.

AC

Acknowledgments We thank Dr. Aoki (Kyushu University Graduate School) for providing the Bm5 cell line. This work was supported in part by the Program for Promotion of Basic Research Activities for Innovative Biosciences (PROBRAIN). The cost of publication was supported in part by the Research Grant for Young Investigators of Faculty of Agriculture, Kyushu University. JX was supported by a JSPS Postdoctoral Fellowship (26-14090). The authors have declared that no conflict of interest exists.

References

Aliyari, R., Ding, S.-W., 2009. RNA-based viral immunity initiated by the Dicer family of host immune receptors. Immunol Rev 227, 176–188.

15

ACCEPTED MANUSCRIPT An, C., Kanost, M.R., 2010. Manduca sexta serpin-5 regulates prophenoloxidase activation and the Toll signaling pathway by inhibiting hemolymph proteinase HP6. Insect Biochem. Mol. Biol. 40, 683–689.

PT

Argaud, O., Croizier, L., López-Ferber, M., Croizier, G., 1998. Two key mutations in the host-range specificity domain of the p143 gene of Autographa californica

SC RI

nucleopolyhedrovirus are required to kill Bombyx mori larvae. J. Gen. Virol. 79 (Pt 4), 931–935.

Bao, Y.Y., Tang, X.D., Lv, Z.Y., Wang, X.Y., Tian, C.H., Xu, Y.P., Zhang, C.X., 2009. Gene expression profiling of resistant and susceptible Bombyx mori

NU

strains reveals nucleopolyhedrovirus-associated variations in host gene transcript levels. Genomics 94, 138–145.

MA

Binggeli, O., Neyen, C., Poidevin, M., Lemaitre, B., 2014. Prophenoloxidase activation is required for survival to microbial infections in Drosophila. PLoS Pathog. 10, e1004067.

ED

Blissard, G.W., Rohrmann, G.F., 1990. Baculovirus diversity and molecular biology. Annu. Rev. Entomol. 35, 127–155.

PT

Boyce, F.M., Bucher, N.L., 1996. Baculovirus-mediated gene transfer into mammalian cells. Proc. Natl. Acad. Sci. USA 93, 2348–2352.

CE

Brogna, S., Sato, T.A., Rosbash, M., 2002. Ribosome components are associated with sites of transcription. Mol. Cell 10, 93–104. Buchon, N., Silverman, N., Cherry, S., 2014. Immunity in Drosophila melanogaster -

AC

from microbial recognition to whole-organism physiology. Nat. Rev. Immunol. 14, 796–810.

Casanova-Torres, Á.M., Goodrich-Blair, H., 2013. Immune signaling and antimicrobial peptide expression in Lepidoptera. Insects 4, 320–338. Cerenius, L., Söderhäll, K., 2004. The prophenoloxidase-activating system in invertebrates. Immunol. Rev. 198, 116–126. Chan, Q.W.T., Melathopoulos, A.P., Pernal, S.F., Foster, L.J., 2009. The innate immune and systemic response in honey bees to a bacterial pathogen, Paenibacillus larvae. BMC Genomics 10, 387. Cheng, Y., Wang, X.Y., Hu, H., Killiny, N., Xu, J.P., 2014. A hypothetical model of crossing Bombyx mori nucleopolyhedrovirus through its host midgut physical barrier. PLoS One 9, e115032.

16

ACCEPTED MANUSCRIPT Ding, S.-W., Voinnet, O., 2007. Antiviral Immunity Directed by Small RNAs. Cell 130, 413–426. Eleftherianos, I., Millichap, P.J., ffrench-Constant, R.H., Reynolds, S.E., 2006. RNAi

PT

suppression of recognition protein mediated immune responses in the tobacco hornworm Manduca sexta causes increased susceptibility to the insect

SC RI

pathogen Photorhabdus. Dev. Comp. Immunol. 30, 1099–1107. Fujii, T., Sakurai, H., Izumi, S., Tomino, S., 1989. Structure of the gene for the arylphorin-type storage protein SP 2 of Bombyx mori. J. Biol. Chem. 264, 11020–11025.

NU

Gale, M., Tan, S.L., Katze, M.G., 2000. Translational control of viral gene expression in eukaryotes. Microbiol. Mol. Biol. Rev. 64, 239–280.

MA

González-Santoyo, I., Córdoba-Aguilar, A., 2012. Phenoloxidase: a key component of the insect immune system. Entomol. Exp. Appl. 142, 1–16. Graifer, D., Karpova, G., 2015. Roles of ribosomal proteins in the functioning of

ED

translational machinery of eukaryotes. Biochimie. 109C, 1–17. Guo, T., Wang, S., Guo, X., Lu, C., 2005. Productive infection of Autographa

PT

californica nucleopolyhedrovirus in silkworm Bombyx mori strain Haoyue due to the absence of a host antiviral factor. Virology 341, 231–237.

CE

Hofmann, C., Sandig, V., Jennings, G., Rudolph, M., Schlag, P., Strauss, M., 1995. Efficient gene transfer into human hepatocytes by baculovirus vectors. Proc. Natl. Acad. Sci. USA 92, 10099–10103.

AC

Hou, C., Qin, G., Liu, T., Geng, T., Gao, K., Pan, Z., Qian, H., Guo, X., 2014. Transcriptome analysis of silkworm, Bombyx mori, during early response to Beauveria bassiana challenges. PLoS One 9, e91189.

Hou, Y., Zou, Y., Wang, F., Gong, J., Zhong, X., Xia, Q., Zhao, P., 2010. Comparative analysis of proteome maps of silkworm hemolymph during different developmental stages. Proteome. Sci. 8, 45. Huang, Y., Genova, G., Roberts, M., Jackson, F.R., 2007. The LARK RNA-binding protein selectively regulates the circadian eclosion rhythm by controlling E74 protein expression. PLoS One 2, e1107. Huang, Y., McNeil, G.P., Jackson, F.R., 2014 Translational regulation of the D UBLETIME/CKIδ/ε ki ase by LA K c modulation. PLoS Genet. 10, e1004536.

17

tributes t

circadia

peri d

ACCEPTED MANUSCRIPT Hultmark, D., Engström, A., Andersson, K., Steiner, H., Bennich, H., Boman, H.G. 1983. Insect immunity. Attacins, a family of antibacterial proteins from Hyalophora cecropia. EMBO J. 2, 571–576.

PT

Imler, J.-L., 2014. Overview of Drosophila immunity: a historical perspective. Dev. Comp. Immunol. 42, 3–15.

SC RI

Ishikawa, H., Ikeda, M., Alves, C.A.F., Thiem, S.M., Kobayashi, M., 2004. Host range factor 1 from Lymantria dispar Nucleopolyhedrovirus (NPV) is an essential viral factor required for productive infection of NPVs in IPLBLd652Y cells derived from L. dispar. J. Virol. 78, 12703–12708.

NU

Jackson, F.R., Banfi, S., Guffanti, A., Rossi, E., 1997. A novel zinc finger-containing RNA-binding protein conserved from fruitflies to humans. Genomics 41, 444–

MA

452.

Jiang, L., Wang, G., Cheng, T., Yang, Q., Jin, S., Lu, G., Wu, F., Xiao, Y., Xu, H., Xia, Q., 2012. Resistance to Bombyx mori nucleopolyhedrovirus via

ED

overexpression of an endogenous antiviral gene in transgenic silkworms. Arch. Virol. 157, 1323–1328.

PT

Jin, S., Cheng, T., Jiang, L., Lin, P., Yang, Q., Xiao, Y., Kusakabe, T., Xia, Q., 2014. Identification of a new Sprouty protein responsible for the inhibition of the

CE

Bombyx mori nucleopolyhedrovirus reproduction. PLoS One 9, e99200. Kadlec, J., Loureiro, S., Abrescia, N.G.A., Stuart, D.I., Jones, I.M., 2008. The postfusion structure of baculovirus gp64 supports a unified view of viral

AC

fusion machines. Nat. Struct. Mol. Biol. 15, 1024–1030.

Kang, L., Shi, H., Liu, X., Zhang, C., Yao, Q., Wang, Y., Chang, C., Shi, J., Cao, J., Kong, J., Chen, K., 2011. Arginine kinase is highly expressed in a resistant strain of silkworm (Bombyx mori, Lepidoptera): Implication of its role in resistance to Bombyx mori nucleopolyhedrovirus. Comp. Biochem. Physiol. B, Biochem. Mol. Biol. 158, 230–234. Kang, W.K., Imai, N., Suzuki, M., Iwanaga, M., Matsumoto, S., Zemskov, E.A., 2003. Interaction of Bombyx mori nucleopolyhedrovirus BRO-A and host cell protein laminin. Arch. Virol. 148, 99–113. Kanost, M.R., 1999. Serine proteinase inhibitors in arthropod immunity. Dev. Comp. Immunol. 23, 291–301. Kash, J.C., Cunningham, D.M., Smit, M.W., Park, Y., Fritz, D., Wilusz, J., Katze, M.G., 2002. Selective translation of eukaryotic mRNAs: functional molecular 18

ACCEPTED MANUSCRIPT analysis of GRSF-1, a positive regulator of influenza virus protein synthesis. J. Virol. 76, 10417–10426. Kash, J.C., Goodman, A.G., Korth, M.J., Katze, M.G., 2006. Hijacking of the host-

PT

cell response and translational control during influenza virus infection. Virus Res. 119, 111–120.

SC RI

Kemp, C., Mueller, S., Goto, A., Barbier, V., Paro, S., Bonnay, F., Dostert, C., Troxler, L., Hetru, C., Meignin, C., Pfeffer, S., Hoffmann, J.A., Imler, J.-L., 2013. Broad RNA interference-mediated antiviral immunity and virus-specific inducible responses in Drosophila. J. Immunol. 190, 650–658.

NU

Lee, J.M., Mon, H., Takahashi, M., Kawakami, N., Mitsunobu, H., Banno, Y., Koga, K., Uchino, K., Kawaguchi, Y., Kusakabe, T., 2007. Screening of high-

MA

permissive silkworm strains for efficient recombinant protein production in Autographa californica nuclear polyhedrosis virus (AcNPV). J. Insect Biotechnol. Sericology 76, 101–105.

ED

Lee, J.M., Kawakami, N., Mon, H., Mitsunobu, H., Iiyama, K., Ninaki, S., Maenaka, K., Park, E.Y., Kusakabe, T., 2012. Establishment of a Bombyx mori

PT

nucleopolyhedrovirus (BmNPV) hyper-sensitive cell line from the silkworm e21 strain. Biotechnol. Lett. 34, 1773–1779.

CE

Li, Z., Cheng, D., Mon, H., Zhu, L., Xu, J., Tatsuke, T., Lee, J.M., Xia, Q., Kusakabe, T., 2013. Cell cycle-dependent recruitment of polycomb proteins to the ASNS promoter counteracts C/ebp-mediated transcriptional activation in Bombyx

AC

mori. PLoS One 8, e52320.

Li, Z., Tatsuke, T., Sakashita, K., Zhu, L., Xu, J., Mon, H., Lee, J.M., Kusakabe, T., 2012. Identification and characterization of Polycomb group genes in the silkworm, Bombyx mori. Mol. Biol. Rep. 39, 5575– 5588. Ligoxygakis, P., Pelte, N., Ji, C., Leclerc, V., Duvic, B., Belvin, M., Jiang, H., Hoffmann, J.A., Reichhart, J.M., 2002. A serpin mutant links Toll activation to melanization in the host defence of Drosophila. EMBO J. 21, 6330–6337. Liu, H., Jiravanichpaisal, P., Cerenius, L., Lee, B.L., Söderhäll, I., Söderhäll, K., 2007. Phenoloxidase is an important component of the defense against Aeromonas hydrophila Infection in a crustacean, Pacifastacus leniusculus. J. Biol. Chem. 282, 33593–33598. Lourenço, A.P., Martins, J.R., Guidugli-Lazzarini, K.R., Macedo, L.M.F., Bitondi, M.M.G., Simões, Z.L.P., 2012. Potential costs of bacterial infection on storage 19

ACCEPTED MANUSCRIPT protein gene expression and reproduction in queenless Apis mellifera worker bees on distinct dietary regimes. J. Insect. Physiol. 58, 1217–1225. Lu, A., Zhang, Q., Zhang, J., Yang, B., Wu, K., Xie, W., Luan, Y.X., Ling, E., 2014.

PT

Insect prophenoloxidase: the view beyond immunity. Front Physiol. 5, 252. Lü, P., Xia, H., Gao, L., Pan, Y., Wang, Y., Cheng, X., Lü, H., Lin, F., Chen, L., Yao,

SC RI

Q., Liu, X., Tang, Q., Chen, K., 2013. V-ATPase is involved in silkworm defense response against Bombyx mori Nucleopolyhedrovirus. PLoS One 8, e64962.

Maeda, S., Kamita, S.G., Kondo, A., 1993. Host range expansion of Autographa

NU

californica nuclear polyhedrosis virus (NPV) following recombination of a 0.6-kilobase-pair DNA fragment originating from Bombyx mori NPV. J. Virol.

MA

67, 6234–6238.

Makkonen, K-E., Turkki, P., Laakkonen, J.P., Ylä-Herttuala, S., Marjomäki, V., Airenne, K.J., 2013. 6-o- and N-sulfated syndecan-1 promotes baculovirus

ED

binding and entry into Mammalian cells. J. Virol. 87, 11148–11159. Mare, L., Trinchera, M., 2007. Comparative analysis of retroviral and native

PT

promoters driving expression of beta1,3-galactosyltransferase beta3Gal-T5 in human and mouse tissues. J. Biol. Chem. 282, 49–57.

CE

McCall, E.J., Danielsson, A., Hardern, I.M., Dartsch, C., Hicks, R., Wahlberg, J.M., Abbott, W.M., 2005. Improvements to the throughput of recombinant protein expression in the baculovirus/insect cell system. Protein Expr. Purif. 42, 29–

AC

36.

McNeil, G.P., Smith, F., Galioto, R., 2004. The Drosophila RNA-binding protein Lark is required for the organization of the actin cytoskeleton and Hu-li tai shao localization during oogenesis. Genesis 40, 90–100. McNeil, G.P., Zhang, X., Roberts, M., Jackson, F.R., 1999. Maternal function of a retroviral-type zinc-finger protein is essential for Drosophila development. Dev. Genet. 25, 387–396. Mon, H., Kobayashi, I., Ohkubo, S., Tomita, S., Lee, J., Sezutsu, H., Tamura, T., Kusakabe, T., 2012. Effective RNA interference in cultured silkworm cells mediated by overexpression of Caenorhabditis elegans SID-1. RNA Biol. 9, 40–46. Moorthamer, M., Chaudhuri, B., 1999. Identification of ribosomal protein L34 as a novel Cdk5 inhibitor. Biochem. Biophys. Res. Commun. 255, 631–638. 20

ACCEPTED MANUSCRIPT Myllymäki, H., Valanne, S., Rämet, M. 2014. The Drosophila imd signaling pathway. J. Immunol. 192, 3455–3462. Nakazawa, H., Tsuneishi, E., Ponnuvel, K.M., Furukawa, S., Asaoka, A., Tanaka, H.,

PT

Ishibashi, J., Yamakawa, M., 2004. Antiviral activity of a serine protease from the digestive juice of Bombyx mori larvae against nucleopolyhedrovirus.

SC RI

Virology 321, 154–162.

Nappi, A., Poirie, M., Carton, Y., 2009. The role of melanization and cytotoxic byproducts in the cellular immune responses of Drosophila against parasitic wasps. Adv. Parasitol. 70, 99–121.

NU

Newby, L.M., Jackson, F.R., 1996. Regulation of a specific circadian clock output pathway by lark, a putative RNA-binding protein with repressor activity. J.

MA

Neurobiol. 31, 117–128.

Nie, Y., Wang, Y.-Y., 2013. Innate immune responses to DNA viruses. Protein Cell 4, 1–7.

ED

O'Reilly, D.R., Miller, L.K., Luckow, V.A., 1992. Baculovirus expression vectors. In: Freeman WH (ed) A laboratory manual. Oxford University Press, New York,

PT

pp 139–166

Olszewska, E., Olszewski, S., Borzym-Kluczyk, M., Zwierz, K., 2007. Role of N-

CE

acetyl-beta-d-hexosaminidase in cholesteatoma tissue. Acta Biochim. Pol. 54, 365–370.

Rahman, M.M., Gopinathan, K.P., 2003. Analysis of host specificity of two closely

AC

related baculoviruses in permissive and nonpermissive cell lines. Virus Res. 93, 13–23.

Reichhart, J.M., Gubb, D., Leclerc, V., 2011. The Drosophila serpins: multiple functions in immunity and morphogenesis. Meth. Enzymol. 499, 205–225. Rohrmann, G.F., 2011. Baculovirus molecular biology, 2nd ed. National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/books/NBK49500. Accessed 26 January 2011 Rugjee, K.N., Roy, Chaudhury S., Al-Jubran, K., Ramanathan, P., Matina, T., Wen, J., Brogna, S., 2013. Fluorescent protein tagging confirms the presence of ribosomal proteins at Drosophila polytene chromosomes. PeerJ. 1, e15. Schmidt, O., Theopold, U., Beckage, N.E., 2008. Insect and vertebrate immunity: key similarities versus differences. In: Beckage NE (ed) Insect immunology. Academic press, San Diego, pp 1–23 21

ACCEPTED MANUSCRIPT Shikata, M., Shibata, H., Sakurai, M., Sano, Y., Hashimoto, Y., Matsumoto, T., 1998. The ecdysteroid UDP-glucosyltransferase gene of Autographa californica nucleopolyhedrovirus alters the moulting and metamorphosis of a non-target

PT

insect, the silkworm, Bombyx mori (Lepidoptera, Bombycidae). J. Gen. Virol. 79(Pt 6), 1547–1551.

SC RI

Singh, J., Singh, C.P., Bhavani, A., Nagaraju, J., 2010. Discovering microRNAs from Bombyx mori nucleopolyhedrosis virus. Virology 407, 120–128. Singh, C.P., Singh, J., Nagaraju, J., 2012. A baculovirus-encoded MicroRNA (miRNA) suppresses its host miRNA biogenesis by regulating the exportin-5

NU

cofactor Ran. J. Virol. 86, 7867–7879.

Terenius, O., 2008. Hemolin—A lepidopteran anti-viral defense factor? Dev. Comp.

MA

Immunol. 32, 311–316.

Thiem, S.M., Du, X., Quentin, M.E., Berner, M.M., 1996. Identification of baculovirus gene that promotes Autographa californica nuclear polyhedrosis

ED

virus replication in a nonpermissive insect cell line. J. Virol. 70, 2221–2229. Tojo, S., Nagata, M., Kobayashi, M., 1980. Storage proteins in the silkworm, Bombyx

PT

mori. Insect Biochem. 10, 289–303. Tong, Y., Kanost, M.R., 2005. Manduca sexta serpin-4 and serpin-5 inhibit the

CE

prophenol oxidase activation pathway: cDNA cloning, protein expression, and characterization. J. Biol. Chem. 280, 14923–14931. Trinchera, M., Zulueta, A., Caretti, A., Dall'Olio, F., 2014. Control of Glycosylation-

AC

Related Genes by DNA Methylation: the Intriguing Case of the B3GALT5 Gene and Its Distinct Promoters. Biology (Basel) 3, 484–497.

Tsakas, S., Marmaras, V., 2010. Insect immunity and its signalling: an overview. Invertebrate Surv. J 7, 228–238. Turkki, P., Makkonen, K-E., Huttunen, M., Laakkonen, J.P., Ylä-Herttuala, S., Airenne, K.J., Marjomäki, V., 2013. Cell susceptibility to baculovirus transduction and echovirus infection is modified by protein kinase C phosphorylation and vimentin organization. J. Virol. 87, 9822–9835. Wang, M., Wang, J., Yin, F., Tan, Y., Deng, F., Chen, X., Jehle, J.A., Vlak, J.M., Hu, Z., Wang, H., 2014. Unraveling the entry mechanism of baculoviruses and its evolutionary implications. J. Virol. 88, 2301–2311. Wang, W., Nie, J., Prochnow, C., Truong, C., Jia, Z., Wang, S., Chen, X.S., Wang, Y., 2013. A systematic study of the N-glycosylation sites of HIV-1 envelope 22

ACCEPTED MANUSCRIPT protein on infectivity and antibody-mediated neutralization. Retrovirology 10, 14. Ward, A.B., Wilson, I.A., 2015. Insights into the trimeric HIV-1 envelope

PT

glycoprotein structure. Trends Biochem. Sci. 40, 101–107. Wöltje, M., Böbel, M., Rheinnecker, M., Tettamanti, G., Franzetti, E., Saviane, A.,

SC RI

Cappellozza, S., 2014. Transgenic protein production in silkworm silk glands requires cathepsin and chitinase of Autographa californica multicapsid nucleopolyhedrovirus. Appl. Microbiol. Biotechnol. 98, 4571–4580. Xia, Q., Li, S., Feng, Q., 2014. Advances in silkworm studies accelerated by the

NU

genome sequencing of Bombyx mori. Annu. Rev. Entomol. 59, 513–536. Xu, J., Mon, H., Kusakabe, T., Li, Z., Zhu, L., Iiyama, K., Masuda, A., Mitsudome,

MA

T., Lee, J.M., 2013. Establishment of a soaking RNA interference and Bombyx mori nucleopolyhedrovirus (BmNPV)-hypersensitive cell line using Bme21 cell. Appl. Microbiol. Biotechnol. 97, 10435–10444.

ED

Xu, J., Kusakabe, T., Yamamoto, K., Suetsugu, Y., Mon, H., Li, Z., Zhu, L., Iiyama, K., Banno, Y., Yoshimura, K., Lee, J.M., 2014. A novel third chromosomal controls

susceptibility

to

Autographa

californica

multiple

PT

locus

nucleopolyhedrovirus in the silkworm, Bombyx mori. Appl. Microbiol.

CE

Biotechnol. 98, 3049–3058. Xue, J., Qiao, N., Zhang, W., Cheng, R.L., Zhang, X.Q., Bao, Y.Y., Xu, Y.P., Gu, L.Z., Han, J-DJ., Zhang, C.X., 2012. Dynamic interactions between Bombyx

AC

mori nucleopolyhedrovirus and its host cells revealed by transcriptome analysis. J. Virol. 86, 7345–7359.

Yamao, M., Katayama, N., Nakazawa, H., Yamakawa, M., Hayashi, Y., Hara, S., Kamei, K., Mori, H., 1999. Gene targeting in the silkworm by use of a baculovirus. Genes Dev. 13, 511–516. Zhong, X.W., Zhao, P., Zou, Y., Nie, H.Y., Yi, Q.Y., Xia, Q.Y., Xiang, Z.H., 2012. Proteomic analysis of the immune response of the silkworm infected by Escherichia coli and Bacillus bombyseptieus. Insect Sci. 19, 559–569.

Legends

Figure 1. Hemolymph protein spots identified in AcMNPV infected d17 and w05 strains. 2-DE separated proteins from each strain (B, left: d17 strain; right: w05 23

ACCEPTED MANUSCRIPT strain) were spotted and compared in the program PDQuest. (A) A magnified illustration of 2-DE gel of protein spots from the w05 strain. Protein spots were cut from gels and treated as described i ―Materia s a d Meth ds‖, and subsequently

PT

subjected to MALDI-TOF MS analysis. A total of 63 sequenced spots were identified

SC RI

and are listed in Table 1.

Figure 2. Time-dependent fold-changes of hemolymph proteins upon the AcMNPV infection. (A) Spot volumes from AcMNPV infected d17 and w05 strains at three time points (24 hpi, 48 hpi and 72 hpi) were analyzed in PDQuest and are

NU

listed in Supplementary Table S1. Hierarchical cluster analysis was performed in Cluster 3.0 and was viewed in Treeview. All the data sets were normalized to that

MA

without AcMNPV mock infection and the ratio raw data were subsequently Log2 transformed. Upregulated and downregulated proteins are shown in gradient yellow and blue colors, respectively. Missing or undetected proteins are shown in gray.

ED

Proteins detected only in d17 (upper panel) or w05 (lower panel) are summarized and plotted in (B). Proteins downregulated in the AcMNPV infected w05 strain at 72 hpi

PT

while upregulated in the d17 strain are plotted in (C). Proteins upregulated in the AcMNPV infected w05 strain at 72 hpi while down regulated in d17 strain are plotted

CE

in (D).

Figure 3. Expression validation of candidate genes in Bm5 cells. Six candidate

AC

spots (A) were selected to evaluate their possible involvement in the baculovirus infection processes. (B) RT-PCR was performed to confirm the expression changes during AcMNPV infection processes, 24 hpi, 48 hpi and 72 hpi, respectively. All the results were standardized to the expression level of the silkworm GAPDH gene. At least three independent replicates were performed for each sample. Indicated P value was assessed by Stude t’s t-test (*P < 0.05).

Figure 4. Functional analyses of candidate genes in Bm5 cells. The 6 candidates were knocked-down in Bm5-SID1 cells, after which the cell morphology was observed (A) and RNAi efficiency was checked by RT-PCR (B). Compared with other candidates, RNAi of RpL34 (Spot No.4) was associated with a significant increase of cellular vesicles (marked as arrows; c-ds4) and drastically reduced cell growth rate (C). Due to the loss of cell amplification when RpL34 was depleted, 24

ACCEPTED MANUSCRIPT decreased luciferase production was detected at 4 dpi after infection with AcMNPVLuc or BmNPV-Luc. No significant changes in reporter activity were observed with

PT

RNAi of other genes besides RpL34 (D).

Figure 5. Subcellular localization and translocation of BmRpL34 in Bm5 cells

SC RI

after baculovirus infection. Bm5 cells were transfected with the N-terminus EGFPfused expression vector. Subsequently, expressed RpL34 was monitored under f u resce ce micr sc py. Sca e bar, 20 μm.

NU

Figure 6. A proposed model for the different regulations of AcMNPV-infected susceptive and resistant silkworms. Arrows indicate activation of downstream

MA

components or steps. A question mark (?) indicates steps that have not yet been experimentally proved. The symbol ⊣ indicates inhibition. Abbreviations: PGRP, peptidoglycan recognition protein; PRR, pattern-recognition receptor; PO, phenol

PT

activated protein kinase.

ED

oxidase; proPO, prophenoloxidase; IMD, Immune deficiency; MAPK, mitogen-

Legends to supplementary files

CE

Supplementary Figure S1. 2-DE maps of silkworm hemolymph proteins at different time points from AcMNPV infected d17 and w05 strains. 2-DE maps of silkworm hemolymph proteins at different time points from AcMNPV infected d17 and w05

AC

strains. Total of each 100 μg serum samp e fr m d17 r w05 silkworm without (Mock infection, A and E) or with AcMNPV inoculation (24 hpi: B and F; 48 hpi: C and G; 72 hpi: D and H) was loaded onto a IPG strip with a linear gradient of pH 3-10, and then separated by 15% SDS-PAGE gels for 2D electrophoresis. The gels were properly visualized by silver staining.

Supplementary Figure S2. Functional classifications of the hemolymph proteins and their chromosomal distributions in the genome of B. mori. (A) Functional categories for total 63 proteins are termed according to their GO annotations and divided into three major groups, except for AcMNPV-derived or unclassified proteins. The right coordinate axis indicates the number of proteins for each GO annotation, and the left

25

ACCEPTED MANUSCRIPT one represents the proportion of proteins for every GO annotation. (B) The Silk DB entry numbers of all identified spots, which were listed in Table 1, were utilized to their

chromosome

loci

in

silkworm

genomes.

Spot

No.4

PT

determine

are found mapped on the third chromosome.

SC RI

(BGIBMGA007412), No.30 (BGIBMGA007410), and No.42&43 (BGIBMGA009028),

Supplementary Table S1. Time-dependent changes of hemolymph proteins upon the

AC

CE

PT

ED

MA

NU

AcMNPV infection in relative quantity (%).

26

ACCEPTED MANUSCRIPT

Table 1 List of AcMNPV Infected silkworm hemolymph proteins identified by MALDI-TOF/MS Protein description

NCBI/SilkDB entry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51

AcMNPV-orf55 Thymosin isoform 2 Ribosomal protein L23 Ribosomal protein L34 Ovary C/EBPg transcription factor AcMNPV-orf31/SOD Ribosomal protein S18 Lysozyme AcMNPV-orf87/p15 NADH dehydrogenase isoform 1 Apolipophorin-III precursor Cytochrome c oxidase polypeptide IV Apolipophorin-III precursor Heat shock protein hsp21.4 ADP-ribosylation factor-like protein Hemolymph lipoprotein protein Inhibitor of apoptosis-2/IAP-2 30 kDa lipoprotein 21G1 Tropomyosin isoform 4 30K protein precursor 30 kDa lipoprotein PBMHP-6 precursor BmLSP-T 30K lipoprotein PBMHP-12 precursor Tropomyosin 1 Elongation factor-1 alpha Beta-1,3-galactosyltransferase 5 30 kDa lipoprotein PBMHPC-23 precursor Transformer-2 protein E Transformer-2 protein F Lark-PA Period Fibroinase precursor 45 kDa immunophilin FKBP45 Serpin 2 Antitrypsin precursor Putative paralytic peptide-binding protein Dopa decarboxylase 6-phosphogluconate dehydrogenase PM-Scl autoantigen-like protein FK506-binding protein FKBP59 homologue Beta-N-acetylglucosaminidase Arylphorin Arylphorin Sex-specific storage-protein 1 precursor Storage protein-1/SP1 Vitellogenin receptor SP1 Sex-specific storage-protein 1 precursor SP1 Hemocytin precursor (Humoral lectin) TRASSc3

gi|9630863 BGIBMGA011334 BGIBMGA009751 BGIBMGA007412 BGIBMGA004336 gi|9630841 BGIBMGA003197 BGIBMGA010439 gi|3745909 BGIBMGA009845 BGIBMGA013108 BGIBMGA013666 BGIBMGA013108 BGIBMGA000944 BGIBMGA010943 BGIBMGA004464 gi|2006998 BGIBMGA004395 BGIBMGA001584 BGIBMGA004394 BGIBMGA004394 BGIBMGA004465 BGIBMGA004399 BGIBMGA001587 BGIBMGA003608 BGIBMGA005534 BGIBMGA004403 BGIBMGA009888 BGIBMGA009888 BGIBMGA007410 BGIBMGA000486 BGIBMGA011342 BGIBMGA001490 BGIBMGA007720 BGIBMGA007720 BGIBMGA010168 BGIBMGA003199 BGIBMGA012298 BGIBMGA000626 BGIBMGA013635 BGIBMGA005899 BGIBMGA009028 BGIBMGA009028 BGIBMGA011266 BGIBMGA011266 BGIBMGA014163 BGIBMGA011266 BGIBMGA011266 BGIBMGA011266 BGIBMGA006692 BGIBMGA013961

8.55/10.04 14.73/4.68 14.83/11.54 13.89/12.47 12.94/9.81 16.32/6.03 17.75/10.93 15.65/10.11 15.08/10.34 17.23/5.90 20.72/9.66 20.50/9.76 20.72/9.66 21.40/5.75 21.26/6.53 29.73/6.26 28.72/9.89 30.18/6.40 29.52/4.62 29.73/6.11 29.73/6.11 30.88/5.48 30.03/7.57 32.54/4.66 33.88/7.69 34.67/8.85 30.33/9.18 32.38/11.87 31.90/11.84 38.51/9.91 36.52/5.44 38.12/5.89 44.67/4.60 44.37/4.87 43.49/5.27 50.01/6.35 49.07/6.52 52.86/7.78 52.14/6.80 51.01/8.88 68.20/5.33 83.44/5.64 83.44/5.64 87.22/6.95 88.28/9.15 84.99/5.81 85.74/6.62 87.22/6.95 87.22/6.95 343.10/5.37 71.97/5.92

SC RI

NU

MA

ED

PT

CE

AC

27

Protein MW (kDa)/pI

PT

Spot ID

Coverage (%) 64.9 68.9 47.9 70.6 61.8 29.8 67.1 35.0 50.8 42.5 30.6 20.2 54.8 29.4 32.1 37.4 27.8 27.4 38.9 30.9 35.5 33.3 42.0 38.0 26.8 29.3 47.0 33.1 53.3 37.6 45.3 17.6 56.5 34.4 28.3 27.3 31.8 33.5 35.7 40.4 22.5 35.1 25.2 25.4 13.3 15.8 26.0 21.7 21.7 10.9 19.8

ACCEPTED MANUSCRIPT 71.78/8.45 38.92/9.70 38.58/6.01 82.41/4.84 35.60/5.10 33.48/8.80 31.32/5.10 81.09/6.69 79.83/5.93 78.53/6.95 78.95/7.23 83.31/10.16

CE

PT

ED

MA

NU

SC RI

PT

Transferrin BGIBMGA011424 Hsp40 BGIBMGA013536 Cysteine proteinase (BCP) BGIBMGA011342 90-kDa heat shock protein BGIBMGA004612 Immune-related Hdd1 BGIBMGA013991 Stathmin BGIBMGA006043 Midgut chymotrypsin BGIBMGA008242 Mcm7 protein BGIBMGA003351 Prophenoloxidase subunit 2 BGIBMGA013115 Prophenoloxidase BGIBMGA012764 Prophenoloxidase subunit 1 BGIBMGA012763 Orphan nuclear receptor E75C BGIBMGA006839 ID: Identity; kDa: kilodalton; MW: molecular weight; pI: Isoelectric point.

AC

52 53 54 55 56 57 58 59 60 61 62 63

28

27.0 37.9 22.4 11.0 22.5 54.0 21.4 22.3 17.6 15.1 17.2 18.1

ACCEPTED MANUSCRIPT

72 h 20 3 23

24 h 10 5 15

d17 48 h 7 12 19

72 h 11 9 20

PT

Upregulated Downregulated Total

w05 48 h 10 15 25

24 h 15 13 28

AC

CE

PT

ED

MA

NU

SC RI

Table 2 Regulated haemolymph proteins in w05 and d17 strains after AcMNPV infections

29

ACCEPTED MANUSCRIPT

Table 3 List of primers used in this study Sense (5’-3’)/Tm (°C)

Antisense (5’-3’)/Tm (°C)

Product length (bp)

4-dsRNA 26-dsRNA 30-dsRNA 34-dsRNA 41-dsRNA 60-dsRNA 4-RT 26-RT 30-RT 34-RT 41-RT 60-RT 4-CDS mCherry GAPDH

GTGCAGCGGCTTACATTCAG/58 TCCAAGCAATACTGGAAGGG/56 ACGGTACGGTCGTAGAATGC/58 CTGATCCTGCACACGAAGAA/56 GAACGCTGTTGGAACTCCTC/57 TTCCACGAGACTACACTGCG/58 GAGCACTAAGTCGGCAAAGA/56 AAGTCGGCTACAGACCATTTC/56 CGATGTGAACGACGCTATCA/56 CGCCGGCCTAATAAACAAATG/56 GATCACCAAGCAGGGAAAGA/56 GCTTCACTCACCTCAACTACAG/56 GTGCAGCGGCTTACATTCAG/58 GTGAGCAAGGGCGAGGAGGATAAC/63 GGCCGCATTGGCCGTTTGGTGCTCCG/72

TTGTAGCCTTCTTTGCCGAC/57 CTGAAAGATCCAGCGAAAGG/54 TCGACCATCATACCGTTCAA/55 ACCAAACGCGTAAACGAATC/55 ATCACCGCTGGACTGTTACC58 TTCCACGAGACTACACTGCG/58 CATGAGAGAGGACACAGTTCAG/56 CGTCACGTCGCTAACGTATT/56 GTGGAGAATCGAACCGTGAA/56 CGGTTGAAGATCGCCTGAATA/56 AACTCTGGCTGTCCGTAATG/56 GCGCGCCTATCAGGATATTT/56 CCGTCGACCTTTGTAGCCTTCTTTGCCGA/67 CTCCCAGCCCATTGTCTTCTTCTG/61 GTGGGGCAAGACAGTTTGTGGTGCAAGAAG/67

352 365 346 337 413 306 523 333 323 498 488 505 362 444 442

AC

CE

PT

ED

MA

NU

SC RI

PT

Spot ID

30

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA

NU

SC RI

PT

Fig. 1

31

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA

NU

SC RI

PT

Fig. 2

32

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA

NU

SC RI

PT

Fig. 3

33

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA

NU

SC RI

PT

Fig. 4

34

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA

NU

SC RI

PT

Fig. 5

35

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA

NU

SC RI

PT

Fig. 6

36