Comparative proteomics of mitosis and meiosis in Saccharomyces cerevisiae

JO U R N A L OF P ROTE O MI CS 1 09 (2 0 1 4 ) 1 –1 5

Available online at www.sciencedirect.com

ScienceDirect www.elsevier.com/locate/jprot

Comparative proteomics of mitosis and meiosis in Saccharomyces cerevisiae Ravinder Kumar a , Snigdha Dhalib , Rapole Srikanth b , Santanu Kumar Ghosha,⁎, Sanjeeva Srivastavaa,⁎⁎ a

Wadhwani Research Center for Biosciences and Bioengineering, Department of Biosciences and Bioengineering, Indian Institute of Technology Bombay, Powai, Mumbai 400076, India b Proteomics Lab, National Centre for Cell Science, Ganeshkhind, Pune 411007, Maharashtra, India

AR TIC LE I N FO

ABS TR ACT

Article history:

Precise and timely segregation of genetic material and conservation of ploidy are the two foremost

Received 26 December 2013

requirements for survival of a eukaryotic organism. Two highly regulated cell division processes,

Accepted 8 June 2014

namely mitosis and meiosis are central to achieve this objective. The modes of chromosome

Avialable online 25 June 2014

segregation are distinct in these two processes that generate progeny cells of equal ploidy and half

Keywords:

intracellular processing of biological cue also differ in these two processes. From this, it can be

the ploidy in mitosis and meiosis, respectively. Additionally, the nutritional requirement and Mitosis

envisaged that proteome of mitotic and meiotic cells will differ significantly. Therefore,

Meiosis

identification of proteins that differ in their level of expression between mitosis and meiosis

Budding yeast

would further reveal the mechanistic detail of these processes. In the present study, we have

Proteomics

investigated the protein expression profile of mitosis and meiosis by comparing proteome of budding yeast cultures arrested at mitotic metaphase and metaphase-I of meiosis using proteomic approach. Approximately 1000 and 2000 protein spots were visualized on 2-DE and 2D-DIGE gels respectively, out of which 14 protein spots were significant in 2-DE and 22 in 2D-DIGE (p < 0.05). All the significant spots were reproducible in all biological replicates and followed the same trend. Identification of the proteins from these spots revealed that nine proteins were common in both 2-DE and 2D-DIGE. These proteins are found to be involved in various cellular processes and pathways such as cytoskeleton function and cytokinesis, carbon, nitrogen, lipid metabolism, general translation and protein folding. Among these, our further study with the cytoskeletal proteins reveals that, compared to mitosis, an up-regulation of actin cytoskeleton and its negative regulator occurs in meiosis. Biological significance Mitosis and meiosis are two different types of cell division cycles with entirely different outcomes with definite biological implication for almost all eukaryotic species. In this work, we investigated, for the first time, the differential proteomic profile of Saccharomyces cerevisiae culture arrested at mitotic metaphase (M) and metaphase-I (MI) of meiosis using 2-DE and 2D-DIGE. Our findings of up-regulation of actin and its negative regulator cofilin

⁎ Corresponding author. Tel.: + 91 22 2576 7766; fax: + 91 22 2572 3480. ⁎⁎ Corresponding author. Tel.: + 91 22 2576 7779; fax: + 91 22 2572 3480. E-mail addresses: [email protected] (S.K. Ghosh), [email protected] (S. Srivastava).

http://dx.doi.org/10.1016/j.jprot.2014.06.006 1874-3919/© 2014 Elsevier B.V. All rights reserved.

2

JO U R N A L OF PR O TE O MI CS 10 9 (2 0 1 4 ) 1 – 15

during meiosis suggest that the rate of actin cytoskeleton turnover is more in meiosis and actin cytoskeleton may play more crucial role during meiosis compared to mitosis. Present study also suggests that actin cytoskeleton and its regulators accumulated during meiosis by forming stable protein structure even though the corresponding mRNAs are degraded as cells enter into meiosis. This is in accordance with recent studies in higher eukaryotes where actin cytoskeleton is found to play vital role during meiotic chromosome segregation. Information generated by this study is significant to reveal that even though a cell that, unlike mitosis, is metabolically inactive with no isotropic bulging of membranes as buds (in meiosis) can require more actin cytoskeleton presumably to support nuclear movements. © 2014 Elsevier B.V. All rights reserved.

1. Introduction The survival strategy of eukaryotic organisms has been to adopt the two precisely regulated processes, mitosis and meiosis that ensure conservation of ploidy during vegetative growth and gamete formation. Error in these processes causes genetic instability or aneuploidy, which leads to various medical consequences including cancer, stillbirth, spontaneous abortion and other developmental related defects [1–4]. Mitosis and meiosis are two different types of cell division cycle with entirely different outcomes. In mitosis that occurs in vegetative cells, a diploid mother cell gives rise to two identical diploid daughter cells. Hence mitosis is also known as equational division. Conversely, meiosis occurs in germ line cells and causes diploid germ cells to produce haploid gametes and hence is known as reductional division. This is possible as in mitosis each round of DNA duplication is associated with one round of chromosome segregation whereas in meiosis one round of DNA duplication is followed by two consecutive rounds of chromosome segregation in meiosis I and II [5]. Unlike higher eukaryotes, in unicellular eukaryotes like budding yeast, the same cell can undergo mitosis as well as meiosis depending on prevailing environmental and nutritional cues. These cells undergo mitosis in presence of fermentable carbon source and plenty of nutrients. Meiosis is triggered under nitrogen starvation condition and in the presence of non-fermentable carbon source. This indicates that switching from mitotic mode to meiotic mode requires reprogramming of metabolic pathways which involves marked changes in gene expression [6–9]. Apart from genome wide studies, few proteomic studies have also been carried out to identify proteins specifically during sporulation as well as to compare the expression of proteins at different stages of the meiotic cell cycle [10–12]. Since the uniqueness of chromosome segregation in meiosis over mitosis lies on the execution of meiosis I, we aimed to compare the proteome of the cells residing within meiosis I to that of the cells proceeding through the equivalent stage in mitosis which was not investigated in previous proteomic studies. Therefore, in this study, we have taken population of cells arrested either at the metaphase of mitosis or at the metaphase I of meiosis I and have performed proteomic analysis of these populations to identify proteins whose change in level of expression is crucial for faithful mitosis or meiosis in budding yeast. We used gel-based assays like 2-DE [13] and 2D-DIGE [14] as a screening tool for the identification of proteins that express differentially during mitosis and meiosis. Using 2D-DIGE, we identified 68 statistically significant protein spots that express differentially in mitosis and meiosis. Out of these, we chose 22

spots for further MS analysis based on fold change (±2.0 as cut off), 3D view and manual confirmation of spots from volume intensity (following same trend in all the replicates). In 2-DE analysis, we found 14 proteins that were statistically significant, out of which 9 were also present in 2D-DIGE (Suppl. Table S1). Identified proteins belong to various cellular processes that include metabolism, protein folding, protein synthesis, protein trafficking, cell division cycle and cytoskeleton function along with one uncharacterized protein. Interestingly, most of the proteins, which expresses differentially during mitosis and meiosis are found to be conserved from budding yeast to humans. Since major difference between mitosis and meiosis lies in dynamics of chromosome segregation, which is presumably governed by the structural proteins, thus we pursued our study with the components of cytoskeleton. Our data revealed an important role of actin cytoskeleton and its negative regulator, cofilin in meiosis.

2. Materials and methods 2.1. Yeast strains and culture condition All the strains used in the present study were of SK1 background [15] and diploid. Table 1 is showing a list of all the primers used in the construction of strains used in this study. Table 2 represents list of all the strains used in the present study. For arresting the cells at the metaphase-I (meiotic), we shuffled the promoter of CDC20 with that of CLB2 in the wild type strains as CLB2 is expressed only during mitosis [16]. This causes total depletion of Cdc20, the key factor for metaphase to anaphase transition, during meiosis and arrests the cells at metaphase-I. For metaphase (mitotic) arrest, we degraded Cdc20 through auxin induced degron (AID) system [17]. As a first step, OsTIR1-9myc was integrated in both the haploids of opposite mating type strains of SK1 background. Integration was checked by Western blot using anti-myc antibodies (data not shown). True transformants were further used to make CDC20 degron allele by doing in-frame fusion of Cdc20 with 6HA-AID at the C-terminus. The fusion protein was verified by Western blotting using anti-HA antibodies (data not shown). Resulting haploids harboring OsTIR1-9myc and CDC20-6HA-AID cassettes were mated and zygotes were picked up to construct the diploids. The resulting diploids were arrested at mitosis by degradation of Cdc20 in presence of IAA by auxin induced degron [17] (Fig. S1E). All yeast transformations were carried by method described elsewhere [18]. Promoter shuffling, gene tagging was carried out using standard procedure [16,19].

JO U R N A L OF P ROTE O MI CS 1 09 (2 0 1 4 ) 1 –1 5

3

Table 1 – List of primers used in this study. Primer name

Description

GM45F GM46R GM47F

CDC20-6HA-AID tagging CDC20-6HA-AID tagging Diagnostic PCR for CDC20-6HA-AID tagging Diagnostic PCR for CDC20-6HA-AID tagging pCLB2-CDC20 promoter shuffle pCLB2-CDC20 promoter shuffle Diagnostic PCR for pCLB2-CDC20 Diagnostic PCR for pCLB2-CDC20 Diagnostic PCR for pCLB2-CDC20 (within Clb2 promoter) RT-PCR of ACT1to check ACT1 mRNA level RT-PCR of ACT1 to check ACT1 mRNA level RT-PCR of COF1 to check COF1 mRNA level RT-PCR of COF1 to check COF1 mRNA level Internal control in RT-PCR (NUP85) Internal control in RT-PCR (NUP85) Tagging of COF1 with EGFP Tagging of COF1 with EGFP Diagnostic PCR for COF1-EGFP tagging Diagnostic PCR for COF1-EGFP tagging Tagging of BMH1 with EGFP Tagging of BMH1 with EGFP Diagnostic PCR for BMH1-EGFP tagging Diagnostic PCR for BMH1-EGFP tagging

GM48R MA23 MA24 MA25 MA26 MA27

RK1F RK2R RK3F RK4R RK5F RK6R RK11F RK12R RK13F RK14R RK15F RK16R RK17F RK18R

Sequence GTGAGATTCATACAAGGAGGCCCTCTAGTACCAGCCAATATTTGATCAGG CGTACGCTGCAGGTCGAC AAATTTCATTATATGCCTTGACATGAACTTTTATTTTTTTTATTTTATCA ATCGATGAATTCGAGCTCG GGCAAGGAAGGTTGTCG GTGTGGTGTGTGGGTTC TTTGATTTTTGTGTCCAATTGGAAAGAAACCCAAAAATATAGAAATCGTCGAATTCGAGCTCGTTTAAAC CGGTTACCGCTAATTGCTGCATTTCCCTTATCTCTAGAGCTTTCTGGCATGCACTGAGCAGCGTAATCTG GTTAGCTTTCCTTCACTTCC CTCTAGATGTTGTCGGTTGC GCGAGTGCATTAGCACAGTG

TTCCCATCTATCGTCGGTAGAC AGGGTTCATTGGAGCTTCAGTC CCGAAATCGTTGTCAAGGAAACC GAGACACCGTTTAAGGCTCTTC GATTGGGAACAACCATGC AACGGGCCATAGTTCCTT TTTCTTACGATTCTGTTTTGGAAAGAGTCAGCAGAGGCGCTGGTTCTCATCGTACGCTGCAGGTCGAC ATTTTCATTTTTCTTGAAGATTGTTGTCATTTGTGAAATCATTTACCTTAATCGATGAATTCGAGCTCG AACCTCTACTGACCCATC GGTGTACGGGACCTTAAA AACATCAGCAACAGCAGCCACCTGCTGCCGCCGAAGGTGAAGCACCAAAGCGTACGCTGCAGGTCGAC TTTTTTTTCTTTTTTTTAGTAATTTCTCTTTAGATTTATCAGAATACTTAATCGATGAATTCGAGCTCG GGTCAAGCTGAAGACCAA CTACAAATTATTACACCCCCG

2.2. Frogging assay Frogging assay was performed along with proper control as described briefly. Diploid SK1 (CDC20-6HA-AID, OsTIR1) was inoculated in 5 mL YPD tube along with control strains and tubes were incubated at 30 °C and 200 rpm. Next morning, fresh 25 mL YPD was inoculated such that initial OD 600 nm was 0.2. After inoculation flasks were incubated at 30 °C and 200 rpm till OD 600 nm reaches to 1.0. From each flask 500 μL culture was taken and serial diluted in wells of frogger. Patch was then made on YPD plate having 750 μM IAA and on control plate. Plates were then incubated at 25 °C for 48 h and images were captured after 48 h (Fig. 2A).

YPD flask was inoculated with overnight grown culture such that initial OD 600 nm was 0.2. The flask was then incubated at 25 °C, 200 rpm till OD 600 nm reaches to 0.6. At this OD auxin was added to the flask such that the final concentration of auxin was 750 μM. The flask was then again incubated at 25 °C, 200 rpm for 1 h.

2.4. Meiotic synchronization of budding yeast Meiotic synchronization was performed to arrest cells at metaphase-I [20]. Efficiency of synchrony in both stages was checked and confirmed by DAPI staining (position of nucleus) for mitotic arrest and by immunofluorescence of tubulin for metaphase arrest [21].

2.3. Mitotic synchronization 2.5. Immunofluorescence After confirmation of mitotic arrest in the presence of auxin in culture, we proceeded for mitotic synchronization. 5 mL YPD tube was inoculated at 30 °C and 200 rpm. Next morning 100 mL

Immunofluorescence was performed on metaphase arrested cells as carried out in [21] using 15–20 μL anti-tubulin (rat

4

JO U R N A L OF PR O TE O MI CS 10 9 (2 0 1 4 ) 1 – 15

Table 2 – List of strains used in this study. Name SG40 SG41 SG42 SG68 SG69 SG70 SG236 SG237 SG242 SG262 SG261 SG422 SG434 SG435 SG436 SG437 SG444 SG450 SG205 SG460 SG459 SG462 SG461 SG465 SG464

Description AMya/α

Genotype −

−

Parent strain −

Ura , Leu , His , Trp− AMya Ura−, Leu−, His−, Trp− AMyα Ura−, Leu−, His−, Trp− pCLB2-CDC20 (MAT a) Ura−, Leu−, His−, Trp−, Kan+ pCLB2-CDC20 (MAT α) Ura−, Leu−, His−, Trp−, Kan+ pCLB2-CDC20 (a/α) Ura−, Leu−, His−, Trp−, Kan+ OsTIR1 in SG41 (MAT a) Ura+, Leu−, His−, Trp−, Kan+ OsTIR1 in SG42 (MAT α) Ura+, Leu−, His−, Trp−, Kan+ CDC20-6HA-AID (MAT α) Ura+, Leu−, His−, Trp−, Kan+ CDC20-6HA-AID (MAT a) Ura+, Leu−, His−, Trp−, Kan+ CDC20-6HA-AID (a/α) Ura+, Leu−, His−, Trp−, Kan+ AMya,COF1-EGFP Ura−, Leu−, His−, Trp+ pCLB2-CDC20, Ura−, Leu−, His−, Trp+, Kan+ COF1-EGFP (MAT a) pCLB2-CDC20, Ura−, Leu−, His−, COF1-EGFP (MAT α) Trp+, Kan+ CDC20-6HA-AID, Ura+, Leu−, His−, Trp+, Kan+ COF1-EGFP (MAT α) CDC20-6HA-AID, Ura+, Leu−, His−, COF1-EGFP (MAT a) Trp+, Kan+ pCLB2-CDC20, Ura−, Leu−, His−, Trp+, Kan+ COF1-EGFP (MAT a/α) CDC20-6HA-AID, Ura+, Leu−, His−, COF1-EGFP (MAT a/α) Trp+, Kan+ pCLB2-CDC20, REC8-6HA Ura−, Trp−, His+, Leu−, Kan+ pCLB2-CDC20, Ura−, Leu−, His−, Trp+, Kan+ BMH1-EGFP (MAT α) pCLB2-CDC20, Ura−, Leu−, His−, BMH1-EGFP (MAT a) Trp+, Kan+ CDC20-6HA-AID, Ura+, Leu−, His−, Trp+, Kan+ BMH1-EGFP (MAT α) CDC20-6HA-AID, Ura+, Leu−, His−, BMH1-EGFP (MAT a) Trp+, Kan+ CDC20-6HA-AID, Ura+, Leu−, His−, Trp+, Kan+ BMH1-EGFP (MAT a/α) pCLB2-CDC20, Ura−, Leu−, His−, BMH1-EGFP (MAT a/α) Trp+, Kan+

SG41 SG42 SG68 × SG69 SG41

metaphase-I (Fig. 2C). In all the experiments minimum of 120 cells were calculated to check the degree of synchrony. Cells which did not show DAPI and tubulin staining were considered as “others”, which include cells in which DAPI or tubulin was not visible or both DAPI and tubulin was abnormal. Efficiency of synchrony is shown by percentage of cells arrested at mitosis and metaphase-I (Fig. 2D).

2.7. Protein extraction Protein was extracted from cultures arrested at the mitotic metaphase and the metaphase-I of meiosis using protocol described previously [22]. Protein pellet was finally resuspended in rehydration buffer (7 M urea, 2 M thiourea, 4% CHAPS) and stored at − 20 °C till further use.

SG42 SG237

2.8. IEF and 2-Dimensional gel electrophoresis (2-DE)

SG70

For 2-DE gel, 24 cm, 4–7 pH IPG strip (from GE) with 800 μg protein/strip was rehydrated in 450 μL of rehydration buffer (7 M urea, 2 M thiourea, 4% CHAPS along with 1% DTT and 1% IPG buffer added freshly). Whole content was mixed and centrifuged at 12000 rpm for 5 min. Clear supernatant was used to rehydrate strips. Passive rehydration was performed for 14 h before focusing strips. IEF was performed on an Ettan IPGphore 3 isoelectric focusing unit for an overall ~93800 Vh [22].

SG242

2.9. Two dimensional-difference gel electrophoresis (2D-DIGE)

SG262

A subset of the subjects, metaphase (mitosis) and metaphase-I (meiosis) (n = 3 each) were selected for the 2D-DIGE experiments. Protein labeling for 2D-DIGE was performed using the minimal labeling strategy according to the manufacturer's instructions (GE Healthcare). 24 cm, 4–7 pH IPG strips were rehydrated after pooling Cy2, Cy3 and Cy5 labeled samples and the final volume was adjusted to 450 μL by adding required volume of rehydration buffer. All the steps were carried out in dark condition to prevent photo bleaching of the light-sensitive fluorescent Cy Dyes. Gels were scanned by Typhoon FLA 9500 scanner (GE Healthcare, Sweden) and gel analysis was performed by DeCyder software (from GE) [22,23].

SG236 SG236 × SG237 SG41 SG69

SG434 × SG435 SG436 × SG437 SG177 × SG178 SG69 SG68 SG242 SG262 SG462 × SG461 SG460 × SG459

anti-tubulin 1:1000, Serotec, USA) and 15–20 μL of secondary antibodies (TRITC conjugated goat anti mouse, 1:200 dilution, Jackson, USA).

2.10. Image acquisition and software analysis 2-DE gels were scanned by using LabScan software version 6.0 (GE Healthcare) and analysis was performed by using ImageMaster 2D Platinum 7.0 software (GE Healthcare). 2D-DIGE gels were scanned by using Typhoon FLA 9500 scanner (GE Healthcare) by using appropriate wavelength and filters for Cy2, Cy3 and Cy5 dyes keeping the resolution at 100 μM and 500 PMT [23].

2.6. Culture condition for protein extraction

2.11. In-gel digestion, peptide extraction and MALDI-TOF/TOF analysis

Cultures having more than 90% of cells arrested at metaphase and metaphase-I were taken further for protein extraction. All big budded yeast cells in which nucleus (blue DAPI mass) were at the neck of bud or stretching through the neck were considered to be at the metaphase (Fig. 2B). Round cells with microtubules (pink line) surrounded by blue DAPI mass were considered to be at the

The in-gel digestion was carried out as described previously [22]. Mass spectrometric analysis was performed for protein identification as explained previously [24]. The taxonomy was set as Saccharomyces cerevisiae. Protein identification criteria included at least two unique peptide matches, ion score of more than 95 and ≥95% confidence interval.

JO U R N A L OF P ROTE O MI CS 1 09 (2 0 1 4 ) 1 –1 5

2.12. Correlation between mRNA and protein abundance ACT1 and COF1 were selected out of 26 total distinct proteins identified in 2-DE and 2D-DIGE based on fold change and biological significance for checking correlation between mRNA and protein using RT-PCR. RNA was extracted from cells arrested at the metaphase and the metaphase-I (same strains which were used for protein extraction for 2D-DIGE and 2-DE) using TRIzol reagent (Invitrogen) as per manufacturer instruction.

2.13. cDNA synthesis for RT-PCR First strand was synthesized for RT-PCR as per manufacturer instruction (#K1632, Thermo Scientific, USA) using poly(T18) as primer for cDNA synthesis supplied with kit. RT-PCR was performed by using equal volume of sample from cDNA synthesis tube by using gene specific primers and NUP85 as internal control whose expression remains constant during meiosis and sporulation [25].

5

meiosis, and we choose meiosis-I as this is mechanistically distinct from mitosis. Cells were arrested at the mitotic metaphase by auxin induced degradation of degron tagged CDC20 [17]. Degradation of Cdc20, a co-factor of anaphase promoting complex (APC) causes cells to arrest (Fig. 1B). More than 90% cells were arrested at the metaphase using this strategy as judged by DAPI staining of the large-budded cells (Fig. 2B, D left panel). We verified that the presence of auxin per se does not change the growth regime or proteome of the wild-type strains by analyzing the growth kinetic and proteome of the wild type strain in the presence and absence of auxin (Fig. S1A–D). The fact that the addition of auxin can degrade only the degron allele of Cdc20 has also been tested (Fig. S1E). For meiotic study, cells capable of arresting at the metaphase-I were developed by depleting Cdc20 specifically in meiosis [27]. For this, the endogenous promoter of CDC20 was shuffled with the promoter of a mitotic specific gene CLB2 as described in the Materials and methods section [27]. In the resulting strain, more than 90% cells were arrested at the metaphase-I as judged by tubulin and DAPI staining (Fig. 2C, D right panel).

2.14. Western blot analysis Western blotting was performed to validate proteomics data of Cof1, Bmh1 and Act1 by detecting Cof1-EGFP and Bmh1-EGFP using anti-GFP antibodies (Roche, USA) and actin with human anti-beta actin antibodies (Abcam, USA). Protein was extracted in triplicate from culture grown independently on different days. Extracted protein was run on SDS-PAGE and protein was electroblotted on PVDF membrane. Blots were developed using secondary antibodies (goat anti-mouse IgG, Genei, India) conjugated with HRP for which TMB/H2O2 (Genei, India) was used as substrate.

2.15. Protein stability assay Culture was treated with 20 μg/mL of cycloheximide just after release in SPM. Flasks were incubated at 30 °C, 200 rpm for 10 h along with control flask with no treatment. Protein was extracted and run on SDS-PAGE. Protein was electroblotted on PVDF membrane. Cof1-EGFP and Bmh1-EGFP fusion protein was detected using anti-GFP protein. In control, Rec8-6HA (meiotic specific cohesin subunit) [26] was detected in the presence and absence of cycloheximide (from HiMedia) using anti-HA antibodies. Cycloheximide was added at the time of release of the culture in sporulation medium and the aliquots were harvested at indicated time points following the release of the culture in sporulation medium.

3. Results 3.1. Development of mitotic and meiotic arrested cells required for proteomic study To compare the proteome of mitotic and meiotic cells, it is required that the cells arrested at similar stage of the cell cycle should be taken for the study. For this, we decided to harvest the cells from metaphase in mitosis and metaphase-I in

3.2. 2DE and 2D-DIGE analysis of budding yeast cells arrested at mitotic metaphase and metaphase-I of meiosis The comparative proteomic study was performed to identify differentially expressed proteins in mitosis and meiosis in general and at the mitotic metaphase and the metaphase-I of meiosis in particular. Proteome of budding yeast culture arrested at the mitotic metaphase and the metaphase-I of meiosis was analyzed using two gel based proteomic approaches such as classical 2-DE and advanced 2D-DIGE. In both 2-DE and 2D-DIGE methods, minimum three gels were run from both the types of samples. Over 1000 protein spots were detected in each 2-DE gel stained with Coomassie Brilliant Blue dye and analyzed IMP7 software. 14 protein spots exhibited differential expression, and were statistically significant (p < 0.05) (Fig. 3 from spot #s 1 to 5 and Fig. S2 from spot #s 6 to 14). Differentially expressed protein spots identified in gel-based analysis that fulfilled the statistical parameters (t-test; p < 0.05) were further selected for mass spectrometry analysis. For each spot 3D view, raw value of volume intensity was verified and then subjected for mass spectrometric analysis. Further, more advanced gel based proteomic analysis was performed by using 2D-DIGE technique in which samples were first labeled with fluorescent CyDyes dyes before proceeding for first dimension IEF separation. Proteins were separated in second dimension using SDS-PAGE on same gel to minimize gel-to-gel variations. The higher sensitivity of CyDyes compared to conventional Coomassie stain allowed visualization of even those protein spots that were not detected in classical 2-DE and thereby increased the overall coverage of proteome under investigation. Approximately 2000 protein spots were detected on each 2D-DIGE gels analyzed by DeCyder software. In 2D-DIGE based proteomic analysis, total of 68 protein spots were found to be differentially expressed and statistically significant. Further, all 68 spots were again checked for 3D view, fold change, raw value of volume intensity. Finally, we narrowed down to 22 spots that could be excised from preparative 2-DE gel for further MS analysis (Fig. 4 from spot #s 15 to 21 and Fig. S3 from spot #s 22 to

6

JO U R N A L OF PR O TE O MI CS 10 9 (2 0 1 4 ) 1 – 15

Fig. 1 – Schematic showing strategy used for arresting cells at mitosis and meiosis. (A, B) Cdc20 is fused with AID for auxin based degradation. (C) CDC20 is under endogenous promoter. (D) CDC20 is under mitotic specific CLB2 promoter. SPB and spindle are not shown in G1 and G2 cells for simplicity.

36). Out of 22 spots, 11 were found to be up-regulated in mitosis and 11 up-regulated in meiosis (alcohol dehydrogenase, Adh1p was detected twice as spot numbers 25 and 34 in 2D-DIGE). Only those spots were selected which showed fold change more than ± 2. Fold change of protein spots selected for MS analysis ranges from approximately 2 to 16 fold. Further, we verified and selected only those spots in which trend of volume intensity was observed same in all the three gels. Because of higher sensitivity and reproducibility of 2D-DIGE over classical 2-DE we obtained higher number of significant spots in 2D-DIGE as compared to 2-DE.

3.3. Identification of differentially expressed proteins using MALDI-TOF/TOF The present study of proteomic results is in accordance with previous high throughput studies, which shows that proteome of cell changes as cell passes from one phase to another. Not only this, proteome of cell varies with type of cell division. Among the numerous differentially expressed protein spots detected in classical 2-DE, those 14 spots that satisfied the statistical criteria (p < 0.05) were subjected to in-gel trypsin digestion and subsequent MALDI-TOF/TOF analysis to establish the protein identity.

MS followed by MS/MS analysis established the identity of these 14 proteins among which 10 were up-regulated in mitosis and 4 in meiosis (Table 3A). In case of 2D-DIGE, selected protein spots were excised manually from preparative 2-DE gels stained with Coomassie stain containing approximately 1000 μg of protein in each gel. Among the 68 differentially expressed protein spots 22 that could be excised from the preparative gels were selected for in-gel digestion and subjected to MS and MS/MS analysis, which successfully establish the identity of all 22 spots (Table 3B, Fig. 4). These spots revealed identification of 22 proteins by MS/MS analysis and these proteins correspond to 21 distinct proteins (protein Adh1p was detected twice as spot numbers 25 and 34). Out of these 22 proteins, 11 were up-regulated in mitosis and 11 in meiosis. Most of the proteins that were identified in both 2-DE and 2D-DIGE are found to be conserved from single cell budding yeast to higher multicellular eukaryotes, including human. This is something that one anticipates as important proteins are evolutionarily conserved. This also highlights the significance of using single cell budding yeast as a model system to understand cellular process and pathways conserved in all eukaryotes. Out of total 21 distinct proteins we identified

JO U R N A L OF P ROTE O MI CS 1 09 (2 0 1 4 ) 1 –1 5

7

Fig. 2 – Arrest of cells in mitosis and meiosis. (A) Cells with indicated genotypes were spotted with increased dilution on plates in the presence or absence of IAA. Both the plates were incubated at 25 °C for 48 h before photographs were taken. (B) Cells MATa/α OsTIR1, CDC20-6HA-AID were arrested at mitotic metaphase as described in the Materials and methods section. Nuclei were stained with DAPI (blue) and metaphase arrested cells were scored as nucleus at the neck or stretched through the neck. (C) Cells MATa/α pCLB2-CDC20 were arrested at meiotic metaphase I as described in the Materials and methods section. Metaphase I arrested cells were scored as small spindle (red) within single nucleus stained with DAPI (blue). (D) Histogram showing % of cells arrested (are mentioned on top of each bar) at metaphase (left) and metaphase-I (right), respectively.

one uncharacterized protein that corresponds to spot 20 in 2D-DIGE.

3.4. Correlation between mRNA and proteins identified by MS Total 35 proteins were identified (14 from 2-DE and 21 from 2D-DIGE), out of which 9 were expressed in both 2-DE and 2D-DIGE. Therefore, total 26 distinct proteins were identified which expressed differentially between mitosis and meiosis. We selected 2 proteins, actin and cofilin for further validation to correlate the levels of these proteins with the corresponding mRNAs. The rationale of choosing actin was that the level of

expression of actin changed maximally (more than 9 fold) between mitosis and meiosis in our proteomic analysis. Cofilin was chosen as this regulates the dynamics of actin cytoskeleton. Additionally, since we observed an up-regulation of actin and its negative regulator cofilin in meiosis with respect to mitosis, this presumed change in activity and turnover of actin cytoskeleton between mitosis and meiosis was found to be unexplored before. For correlation study, we analyzed the level of actin and cofilin mRNA from the similar meiotic culture used in the proteomic study. Conversely to the proteomic data, decreased levels of actin and cofilin mRNA was obtained in meiosis, whereas the level of NUP85 mRNA, taken as control, remains

8

JO U R N A L OF PR O TE O MI CS 10 9 (2 0 1 4 ) 1 – 15

Fig. 3 – Comparative proteomics of mitosis and metaphase-I using 2-DE. Representative images of 2-DE gel of mitosis (top, a) and metaphase-I or meiosis (bottom, b). Significant protein spots are marked on gel and numbered from 1 to 14. U and D represent up-regulation and down-regulation respectively. (c) Right panel shows 3D views and histograms of representative protein spots (from spot #s 1 to 5 while the remaining spots are given in Fig. S2). On each 3D view of spots, small section of 2-DE gels showing the spots is also indicated by small black arrow pointing the spot. Below 3D view and histogram standard name of protein is also mentioned (as given in Saccharomyces Genome Database http://www.yeastgenome.org/). In schematic M means mitotic metaphase and MI representing meiotic metaphase-I.

same in mitosis and meiosis [25], (Fig. 5A). To further validate our proteomic data that the levels of actin and cofilin are indeed high in meiosis, we analyzed the mitotic and meiotic protein levels of actin and cofilin fused to EGFP (Cof1-EGFP) by Western blotting followed by densitometric analysis (Fig. 6A, B). We obtained an enrichment of actin level, albeit less than our proteomic data, in meiosis compared to mitosis (0.5-fold vs 9-fold). However, in accord with the proteomic data, more than two-fold increase in Cof1-EGFP level was obtained (Fig. 6B). To perform further validation of our proteomic data, we tested the level of Bmh1 fused to EGFP at its C-terminal in mitosis and meiosis using Western blotting. We choose Bmh1 as it was detected in 2-DE as well as in 2D-DIGE methods and our observation that it is up-regulated in meiosis is correlated with a previous study showing that Bmh1 interacts with meiotic specific protein Mam1 [28]. Our Western blot results are in accordance with the proteomics data. Densitometric analysis of Western blot for Bmh1-EGFP shows that its cellular abundance is three-fold more in meiosis compared to mitosis (Fig. 6C), which is in good correlation to proteomics in which Bmh1

was shown to be up-regulated by 3.36- and 5.62-folds in 2-DE and 2D-DIGE, respectively (Table 3A, B). The primary antibodies against EGFP were specific to recognize Bmh1-EGFP (Fig. S4C). From the above results of meiosis-specific up-regulation of actin and cofilin, destabilizer of actin polymer, it appears that polymerization–depolymerization cycle of actin cytoskeleton is high in meiosis, may be more than mitosis. To address our observed results of obtaining opposite levels of protein and mRNA, it can be presumed that actin and cofilin are more stable than their corresponding mRNAs in meiosis. This is fuelled by the earlier observation that budding yeast under static or inactive condition develops actin bodies that are highly stable structure [29].

3.5. Enhanced stability of actin and cofilin in meiosis In the previous section we have demonstrated that in meiosis the levels of actin and cofilin are negatively correlated with their mRNA levels. To investigate that this discrepancy is due

JO U R N A L OF P ROTE O MI CS 1 09 (2 0 1 4 ) 1 –1 5

9

Fig. 4 – Comparative proteomics using 2D-DIGE gel. In this representative gel mitosis was labeled with Cy5 and metaphase-I sample with Cy3. All significant spots are marked on gel from 15 to 36. On the right side and bottom of 2D-DIGE gels, 3D view along with fold change (in the form of graphical view) is also given (from spot #s 15 to 21 while the remaining spots are given in Fig. S3). Y-axis of graph is log-standardized abundance. In the schematic M represents mitotic metaphase, MI metaphase-I of meiosis, S standard for internal control. At the bottom of each 3D view of spots standard name of protein is also given (as given in Saccharomyces Genome Database http://www.yeastgenome.org/).

to increased protein stability, we analyzed the level of the proteins in meiotic cells challenged with cycloheximide, an inhibitor of protein translation in eukaryotes. Following pre-growth regime in YPA the cells were released into the sporulation medium in the presence or absence of the drug. Cells were harvested at indicated time points and were analyzed by Western blot. We could detect cofilin, even after 10 h of cycloheximide addition (Fig. 7B) whereas the control protein Rec8 that expresses only in meiosis I [26,30] remains undetectable from 0 h till 10 h following addition of drug (Fig. 7A). This result suggests that the observed abundance of these proteins despite low level of their mRNA is due to higher stability of these proteins in meiosis. Specificity of anti-HA was checked using blot (Fig. S4D). The data obtained from RT-PCR and protein stability assay together suggest that increased abundance of proteins in meiosis is due to increased stability of proteins in meiosis. To address whether this increased protein stability is specific to actin and cofilin alone or it is true for other proteins as well, we checked the level of Bmh1-EGFP in the presence and absence of cycloheximide (7C). Similar results were obtained for Bmh1-EGFP suggesting that increased abundance of

proteins in meiosis might be due to increased protein stability in meiosis in which cells are mostly metabolically inactive. However, protein degradation machinery is active even in meiosis [31]. Similar observations were made for actin in the presence and absence of cycloheximide (Fig. 7D).

4. Discussion From the mechanistic difference between mitosis and meiosis, it is expected that the proteome of mitosis will differ from meiosis. Since both of these cell divisions are precisely regulated through balanced expression of several proteins, it can be envisaged that the correct expression level of certain subset of proteins may be fundamental for successful execution of these cell division processes. Identification of those proteins may provide significant insight towards better understanding of mitosis and meiosis. To identify such proteins we have taken a proteomic approach through which we have compared the proteome of budding yeast cells arrested at mitosis or meiosis I. For our study we have chosen metaphase of mitosis and meiosis I since these two

10

Table 3 – List of proteins identified by mass spectrometric analysis (A) 2-DE and (B) 2D-DIGE. Spot no.

UniProt ID

(A) 2-DE 1 P23301 2 P38013 3 P35719 4 P00817 5 P27616 P25087 P10591 P54115

9 10 11 12 13 14

P00925 P29311 P38624 Q03048 P34760 P32445

(B) 2D-DIGE 15 Q03048 16 P32445 17 P34760 18 P22943 19 P38013 20 P35719 21 P38624 22 P29311 23 P34730 24 P27616 25 26 27 28 29 30 31 32 33 34 35 36 a b

P00330 P30657 P60010 P22768 P07262 P00925 P10592 P07274 P20081 P00330 P40150 P00445

Protein score

Total ion score

M.W. (kDa) a

pI b

No. of a.a. residue b

Eukaryotic translation initiation factor 5A-1 (Hyp2p) Peroxiredoxin type-2 (Ahp1p) Uncharacterized protein MRP8 (Mrp8p) Inorganic pyrophosphatase (Ipp1p) Phosphoribosylaminoimidazolesuccinocarboxamide synthase (Ade1p) Sterol 24-C-methyltransferase (Erg6p) Heat shock protein (Ssa1p) Magnesium-activated aldehyde dehydrogenase (Ald6p) Enolase 2 (Eno2p) BMH1 (Bmh1p) Proteasome component PRE3 (Pre3p) Cofilin (Cof1p) Peroxiredoxin (Tsa1p) Single-stranded DNA-binding protein (Rim1p)

272 826 397 560 700

232 744 322 431 575

17.21 19.27 25.08 32.33 34.63

4.64 4.87 4.49 5.33 5.80

157 176 219 287 306

NA 16200 1550 68400 4280

4.81 2.76 2.17 5.9 2.02

50 85 68 79 61

Mitosis Mitosis Mitosis Meiosis Mitosis

243 495 902

166 462 706

43.63 69.78 54.77

5.60 4.82 5.18

383 642 500

53800 269000 135000

3.66 11.5 4.25

42 20 67

Mitosis Mitosis Mitosis

474 869 146 553 853 520

398 764 107 500 765 478

46.94 30.18 23.76 15.94 21.69 15.37

5.88 4.65 5.73 4.89 4.87 9.04

437 267 215 143 196 135

2610 158000 7250 19600 378000 3060

3.1 3.36 2.29 4.87 2.69 2.12

49 61 41 75 73 44

Mitosis Meiosis Mitosis Meiosis Mitosis Meiosis

553 520 853 347 826 397 146 869 876 700

500 478 765 285 744 322 107 764 777 575

15.94 15.37 21.69 11.68 19.27 25.08 23.76 30.18 31.09 34.63

4.89 9.04 4.87 5.10 4.87 4.49 5.73 4.65 4.65 5.8

143 135 196 109 176 219 215 267 273 306

19600 3060 378000 4490 16200 1550 7250 158000 47600 4280

11.99 3.64 4.32 10.78 15.7 9.3 2.64 5.62 6.89 2.7

75 44 73 72 85 68 41 61 56 61

Meiosis Meiosis Mitosis Meiosis Mitosis Mitosis Mitosis Meiosis Meiosis Mitosis

658 360 869 452 664 474 329 279 118 829 803 537

572 339 728 365 522 398 301 252 97 741 683 483

37.28 29.42 41.89 47.41 49.88 46.39 69.59 13.72 12.2 37.28 66.66 15.95

6.6 5.81 5.51 5.25 5.5 5.88 4.77 5.63 5.87 6.66 5.24 5.90

348 266 375 420 454 437 639 126 114 348 613 154

NA 16900 NA 1870 77500 2610 364000 NA 43300 NA 104000 519000

5.3 7.94 9.59 6.87 2.08 5.8 2.38 2.94 2.3 8.8 2 5.13

57 38 68 50 63 49 26 42 57 62 45 76

Meiosis Meiosis Meiosis Meiosis Mitosis Mitosis Mitosis Mitosis Mitosis Meiosis Mitosis Meiosis

Cofilin1 (Cof1p) Single stranded DNA binding protein (Rim1p) Peroxiredoxin (Tsa1p) 12 kDa heat shock protein (Hsp12p) Peroxiredoxin type-2 (Ahp1p) Uncharacterized protein (Mrp8p) Protease component (Pre3p) BMH1 (Bmh1p) BMH2 (Bmh2p) Phosphoribosylaminoimidazolesuccinocarboxamide synthase (Ade1p) Alcohol dehydrogenase 1 (Adh1p) Proteasome component (Pre4) Actin (Act1p) Argininosuccinate synthase (Arg1p) NADP specific glutamate dehydrogenase 1 (Gdh1p) Enolase-2 (Eno2p) Heat shock protein SSA2 (Ssa2p) Profilin (Pfy1p) FK506-binding protein 1 (Fpr1p) Alcohol dehydrogenase 1 (Adh1p) Heat shock protein SSB2 (Ssb2p) Superoxide dismutase (Sod1p)

Mol mass as calculated by mass spectrometry analysis. pI, number of protein molecules/cell and number of amino acid residue as given in Saccharomyces Genome Database (SGD).

Molecules/ cell b

Fold change

% sequence coverage

Upregulated in

JO U R N A L OF PR O TE O MI CS 10 9 (2 0 1 4 ) 1 – 15

6 7 8

Protein name

JO U R N A L OF P ROTE O MI CS 1 09 (2 0 1 4 ) 1 –1 5

Fig. 5 – Cellular abundance of mRNA in mitotic and meiotic yeast (A) Showing average Ct value for ACT1, COF1 and NUP85 (internal control) in mitosis (purple bar) and in meiosis (red bar). (B) Graph showing fold change for ACT1 (red bar) and COF1 (light blue bar). NUP85 was used as internal control for calculating fold change. Each experiment was carried out thrice.

stages differ maximally with respect to chromosome dynamics and presence of meiosis specific factors. Our study has revealed that several proteins belonging to stress response, intracellular signaling, protein translation machinery, various metabolic pathways of carbohydrate, protein and lipid metabolism and cytoskeleton function, show different levels of expression between mitosis and meiosis. Hsp12, a 12 kDa protein is found to be up-regulated in meiosis. Hsp12 is required for maintaining membrane organization under stress conditions including heat shock, oxidative stress, osmostress, stationary phase, and glucose depletion and it is regulated by HOG and Ras–Pka pathways. An increase in level of this protein is in accord with the nutrient stress condition in meiosis. Interestingly we noted that Pre4, beta 7 subunit of the 20S proteasome, is up-regulated in meiosis while Pre3, a beta 1 subunit of the 20S proteasome responsible for cleavage after acidic residues in peptides [32,33] is up-regulated in mitosis. This suggests that some of the subunits of proteosomal degradation machinery may be specific to the cell cycle. In our study, we observed that Bmh1 is upregulated in meiosis. BMH proteins are the conserved family of 14-3-3 class of proteins that are important regulatory proteins involved in diverse cellular processes including exocytosis, vesicle transport, Ras/MAPK signaling, aggresome formation, rapamycin-sensitive signaling and cell cycle function [34,35]. In higher eukaryotes, like in vertebrates and plants, 7 and 15 isoforms have been reported,

11

respectively. Budding yeast possesses two isoforms of 14-3-3 viz Bmh1 or major isoforms and Bmh2, minor isoforms [36–39]. In the absence of either Bmh isoforms cell is viable while deletion of both form together is lethal. Our observation of Bmh1 being up-regulated in meiosis I may be relevant to the finding that Bmh1 interacts with some of the meiosis I specific proteins like Mam1 [28] that is required for crucial monopolin function in meiosis I [40]. This suggests that Bmh1 may have important regulatory function in faithful chromosome segregation in meiosis I. This possibility is currently being tested. We found that the enzyme enolase-2 is up-regulated in mitosis. Enolase-2, a phosphopyruvate hydratase that converts 2-phosphoglycerate to phosphoenolpyruvate during glycolysis and carries out the reverse reaction during gluconeogenesis [37,41,42]. This may be related to higher metabolic activity of cells in mitosis. We also found a nine-fold increase in Mrp8, an uncharacterized protein, in mitosis compared to meiosis. It is believed that this protein undergoes sumoylation [43,44]. It will be interesting to address the biological relevance of higher expression of this protein in mitosis. We found two proteins, namely Tsa1 and Ahp1, having anti-oxidative function that are up-regulated in mitosis. Both of these proteins are involved in protecting the cells from oxidative damages. Ahp1, a thiol-specific peroxiredoxin, reduces hydroperoxides to protect cell against oxidative damage [45]. Tsa1, thioredoxin peroxidase, acts as both ribosomes-associated as well as free cytoplasmic antioxidant [46–48]. Up-regulation of both of these antioxidant enzymes in mitosis suggest that cells undergoing mitosis may suffer more oxidative damage presumably due to the higher rate of respiration in mitosis compared to meiosis which is metabolically less active. Our study has revealed a change in expression level of components of cytoskeleton apparatus between mitosis and meiosis. Profilin, a component of actin cytoskeleton was found to be up-regulated in mitosis whereas its negative regulator cofilin has been found to be up-regulated in meiosis. Increased expression of actin and cofilin in meiosis is intriguing since in meiosis, unlike mitosis, there is no polarized isotropic bud growth that might require higher turnover of actin cytoskeleton. Our observation of higher level of actin and cofilin in meiosis was also verified by Western analysis. However, conversely, we observed a reduced level of actin and cofilin mRNA at the same stage. Further analysis revealed that this difference is due to increased stability of actin and cofilin during meiosis. During nutrient deficiency, especially nitrogen, as occurs during meiosis, budding yeast becomes metabolically inactive. Under such condition cells accumulate proteins by forming stable protein structures like actin bodies [29] even when translation stops or reduces drastically and mRNA becomes degraded over time. This observation is consistent to a previous study in which it has been shown that during meiosis in budding yeast, mRNAs are degraded over time whereas the protein level remains high [49]. This may be the reason of obtaining negative correlation between the protein and mRNA levels in our study. In mitosis because of bud formation more actin cables are synthesized than in meiosis. Therefore, an increased level of expression of profilin in mitosis may be due to the fact that profilin is involved in actin cable synthesis.

12

JO U R N A L OF PR O TE O MI CS 10 9 (2 0 1 4 ) 1 – 15

Fig. 6 – High level of expression of actin, Bmh1 and Cof1 in meiosis. Western blots showing the expression and densitometric plots showing the quantitative expression of (A) Actin, (B) Cof1-EGFP and (C) Bmh1-EGFP in mitosis (M) and meiosis I (MI). Lanes, 1–3: M and 4–6: MI. EGFP was detected using anti-GFP antibodies. Volume intensity was calculated for each band using iQTL software and average volume intensity was used to plot the bar graph with standard deviation (n = 3). Asterisk shows the non-specific bands.

From our proteomic data we hypothesize that the high dose of actin/cofilin may be crucial for meiosis but not for mitosis. To investigate this, we planned to measure both mitotic fitness and meiotic fitness of diploid cells harboring single copy of actin or cofilin genes. Fitness was checked by comparing these cells with the normal diploid for the growth regime in mitosis and for sporulation efficiency and spore viability in meiosis. Several earlier studies have elucidated the role of actin cytoskeleton in mitosis and meiosis. Consistent with our

results of finding normal level of actin and cofilin in mitosis, it has been demonstrated earlier that over-expression of actin causes abnormal cell cycle progression and altered nuclear morphology [50,51] leading to loss of cell viability [52]. Similarly over-expression of cofilin in budding yeast leads to impaired cell cycle [51]. Several studies have illustrated the function of actin cytoskeleton in meiosis. Impairment of actin through irradiation leads to erroneous meiotic chromosome movement [53]. Crucial asymmetry in mouse oocytes during mammalian meiosis is believed to be achieved by actin

JO U R N A L OF P ROTE O MI CS 1 09 (2 0 1 4 ) 1 –1 5

13

Fig. 7 – Protein stability assay. (A) Western blot showing expression of Rec8-6HA in the presence and absence of cycloheximide at indicated time points since the addition of the drug in sporulation media. Western blot showing the expression of (B) Cof1-EGFP, (C) Bmh1-EGFP and (D) actin. The levels of expression remain unchanged in the presence or absence of cycloheximide. Time points are marked after the addition of the drug.

cytoskeleton based force [54–56]. Furthermore in meiotic chromosome congression requires actin polymerization and is important for delivery of chromosomes to the meiotic spindle [57]. All these and several other studies signify the importance of actin cytoskeleton in meiotic chromosome movement. It is plausible that to execute these functions a level of actin cytoskeleton higher than what is observed in mitosis may be required. Taking these and our study together, we conclude that up-regulation of actin and cofilin is an important requirement for faithful meiosis. Proteomics has been used to understand the biology of different organisms in a holistic way. In budding yeast, the analysis of the proteomes of different stages of meiosis has revealed that even within meiosis proteome of cell changes as cells pass from one stage of meiosis to another [11,12]. Similar study to compare the proteome of haploid with respect to diploid yeast has revealed that pheromone signaling pathway operates in haploid opposite mating type strains and these pathways are also active in diploid cells during mitotic growth [58]. This study is the first attempt to compare the proteome of mitosis and meiosis in any organism to understand the mechanistic difference between these two cell division processes. To conclude, our proteomic investigation has revealed that the levels of actin and its negative regulator, cofilin increase in meiosis and implicates that the turnover of actin cytoskeleton may be high in meiosis compared to mitosis. We hypothesize that this increased turnover has an important consequence in faithful meiosis. To investigate this we are in the process of comparing the efficiency of mitosis and meiosis in diploid cells where the doses of actin and cofilin genes have been altered. Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.jprot.2014.06.006.

Conflict of interest We would like to mention that all the authors have read the revised draft of the manuscript, agreed with its publication and declared no conflict of interest of any nature.

Acknowledgment We are thankful to Meenakshi Agarwal for preparing metaphase I arrested strain and Gunjan Mehta for helping in microscopy and strain construction used in this manuscript. This research was supported by a start-up grant 09IRCC007 from the IIT Bombay to SS. SKG is supported by DBT, CSIR and IITB, Govt. of India (grant nos. BT/PR13962/BRB/10/798/2010, 38(1267)/10/EMR-II and 09IRCC002, respectively). SR is supported by DBT, Govt. of India (grant nos. BT/PR4152/BRB/10/1003/2011 and BT/PR6384/ GBD/27/409/2012). RK is supported by CSIR fellowship file no. 09/ 087(0707)/2011-EMR-I.

REFERENCES

[1] Rajagopalan H, Lengauer C. Aneuploidy and cancer. Nature 2004;432:338–41. [2] Sen S. Aneuploidy and cancer. Curr Opin Oncol 2000;12:82–8. [3] Compton DA. Mechanisms of aneuploidy. Curr Opin Cell Biol 2011;23:109–13. [4] Jallepalli PV, Lengauer C. Chromosome segregation and cancer: cutting through the mystery. Nat Rev Cancer 2001;1:109–17.

14

JO U R N A L OF PR O TE O MI CS 10 9 (2 0 1 4 ) 1 – 15

[5] Petronczki M, Siomos MF, Nasmyth K. Un menage a quatre: the molecular biology of chromosome segregation in meiosis. Cell 2003;112:423–40. [6] Rubin-Bejerano I, Mandel S, Robzyk K, Kassir Y. Induction of meiosis in Saccharomyces cerevisiae depends on conversion of the transcriptional repressor Ume6 to a positive regulator by its regulated association with the transcriptional activator Ime1. Mol Cell Biol 1996;16:2518–26. [7] Vershon AK, Hollingsworth NM, Johnson AD. Meiotic induction of the yeast HOP1 gene is controlled by positive and negative regulatory sites. Mol Cell Biol 1992;12:3706–14. [8] Mitchell AP. Control of meiotic gene expression in Saccharomyces cerevisiae. Microbiol Rev 1994;58:56–70. [9] Kassir Y, Adir N, Boger-Nadjar E, Raviv NG, Rubin-Bejerano I, Sagee S, et al. Transcriptional regulation of meiosis in budding yeast. Int Rev Cytol 2003;224:111–71. [10] Trew BJ, Friesen JD, Moens PB. Two-dimensional protein patterns during growth and sporulation in Saccharomyces cerevisiae. J Bacteriol 1979;138:60–9. [11] Grassl J, Scaife C, Polden J, Daly CN, Iacovella MG, Dunn MJ, et al. Analysis of the budding yeast pH 4–7 proteome in meiosis. Proteomics 2010;10:506–19. [12] Scaife C, Mowlds P, Grassl J, Polden J, Daly CN, Wynne K, et al. 2-D DIGE analysis of the budding yeast pH 6–11 proteome in meiosis. Proteomics 2010;10:4401–14. [13] Görg A, Obermaier C, Boguth G, Harder A, Scheibe B, Wildgruber R, et al. The current state of two-dimensional electrophoresis with immobilized pH gradients. Electrophoresis 2000;2:1037–53. [14] Unlu M, Morgan ME, Minden JS. Difference gel electrophoresis. A single gel method for detecting changes in protein extracts. Electrophoresis 1997;18:2071–7. [15] Kane SM, Roth R. Carbohydrate metabolism during ascospore development in yeast. J Bacteriol 1974;118:8–14. [16] Longtine MS, McKenzie A, Demarini DJ, Shah NG, Wach A, Brachat A, et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 1998;14:953–61. [17] Nishimura K, Fukagawa T, Takisawa H, Kakimoto T, Kanemaki M. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nat Methods 2009;6:917–22. [18] Güldener U, Heck S, Fielder T, Beinhauer J, Hegemann JH. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res 1996;24:2519–24. [19] Janke Carsten, Magiera Maria M, Rathfelder Nicole, Taxis Christof, Reber Simone, Maekawa Hiromi, et al. A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast 2004;21:947–62. [20] Cha RS, Weiner BM, Keeney S, Dekker J, Kleckner N. Progression of meiotic DNA replication is modulated by interchromosomal interaction proteins, negatively by Spo11 and positively by Rec8p. Genes Dev 2000;14:493–503. [21] Kilmartin JV, Adams AE. Structural rearrangements of tubulin and actin during the cell cycle of the yeast Saccharomyces. J Cell Biol 1984;98:922–33. [22] Panga Jaipal Reddy, Anand Rao Aishwarya, Malhotra Darpan, Sharma Samridhi, Kumar Ravinder, Jain Rekha, et al. A simple protein extraction method for proteomic analysis of diverse biological specimens. Curr Proteomics 2013;10:298–311. [23] Ray S, Renu D, Srivastava R, Gollapalli K, Taur S, Jhaveri T, et al. Proteomic investigation of falciparum and vivax malaria for identification of surrogate protein markers. PLoS One 2012;7: e41751. [24] Rao AA, Patkari M, Reddy PJ, Srivastava R, Pendharkar N, Srikanth R, et al. Proteomic analysis of Streptomyces coelicolor in

[25]

[26]

[27] [28]

[29]

[30]

[31]

[32]

[33]

[34] [35]

[36] [37]

[38]

[39] [40]

[41]

[42]

[43]

[44]

response to Ciprofloxacin challenge. J Proteomics 2013;97:222–34. Govin J, Dorsey J, Gaucher J, Rousseaux S, Khochbin S, Berger SL. Systematic screen reveals new functional dynamics of histones H3 and H4 during gametogenesis. Genes Dev 2010;24:1772–86. Klein F, Mahr P, Galova M, Buonomo SB, Michaelis C, Nairz K, et al. A central role for cohesins in sister chromatid cohesion, formation of axial elements, and recombination during yeast meiosis. Cell 1999;98:91–103. Lee BH, Amon A. Role of Polo-like kinase CDC5 in programming meiosis I chromosome segregation. Science 2003;300:426–82. Wong J, Nakajima Y, Westermann S, Shang C, Kang JS, Goodner C, et al. A protein interaction map of the mitotic spindle. Mol Biol Cell 2007;18:3800–9. Sagot I, Pinson B, Salin B, Daignan-Fornier B. Actin bodies in yeast quiescent cells: an immediately available actin reserve? Mol Biol Cell 2006;17:4645–55. Buonomo SB, Clyne RK, Fuchs J, Loidl J, Uhlmann F, Nasmyth K. Disjunction of homologous chromosomes in meiosis I depends on proteolytic cleavage of the meiotic cohesin Rec8 by separin. Cell 2000;103:387–98. Okaz E, Argüello-Miranda O, Bogdanova A, Vinod PK, Lipp JJ, Markova Z, et al. Meiotic prophase requires proteolysis of M phase regulators mediated by the meiosis-specific APC/ CAma1. Cell 2012;151:603–18. Groll M, Heinemeyer W, Jäger S, Ullrich T, Bochtler M, Wolf DH, et al. The catalytic sites of 20S proteasomes and their role in subunit maturation: a mutational and crystallographic study. Proc Natl Acad Sci U S A 1999;96:10976–83. Jäger S, Groll M, Huber R, Wolf DH, Heinemeyer W. Proteasome beta-type subunits: unequal roles of propeptides in core particle maturation and a hierarchy of active site function. J Mol Biol 1999;291:997–1013. Paul GH, van Heusden H, Steensma Yde. Yeast 14-3-3 proteins. Yeast 2006;23:159–71. Haian Fu, Subramanian Romesh R, Masters Shane C. 14-3-3 proteins: structure, function, and regulation. Annu Rev Pharmacol Toxicol 2000;40:617–47. van Hemert MJ, van Heusden GP, Steensma HY. Yeast 14-3-3 proteins. Yeast 2001;18:889–95. Byrne KP, Wolfe KH. The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res 2005;15:1456–61. Bruckmann A, Hensbergen PJ, Balog CI, Deelder AM, de Steensma HY, van Heusden GP. Post-transcriptional control of the Saccharomyces cerevisiae proteome by 14-3-3 proteins. J Proteome Res 2007:1689–99. Burbelo PD, Hall A. 14-3-3 proteins. Hot numbers in signal transduction. Curr Biol 1995;5:95–6. Tóth A, Rabitsch KP, Gálová M, Schleiffer A, Buonomo SB, Nasmyth K. Functional genomics identifies monopolin: a kinetochore protein required for segregation of homologs during meiosis I. Cell 2000;103:1155–68. Entian KD, Meurer B, Köhler H, Mann KH, Mecke D. Studies on the regulation of enolases and compartmentation of cytosolic enzymes in Saccharomyces cerevisiae. Biochim Biophys Acta 1987;923:214–21. Cohen R, Yokoi T, Holland JP, Pepper AE, Holland MJ. Transcription of the constitutively expressed yeast enolase gene ENO1 is mediated by positive and negative cis-acting regulatory sequences. Mol Cell Biol 1987;7:2753–61. Abraham PR, Mulder A, Van 't Riet J, Planta RJ, Raué HA. Molecular cloning and physical analysis of an 8.2 kb segment of chromosome XI of Saccharomyces cerevisiae reveals five tightly linked genes. Yeast 1992;8:227–38. Zhou W, Ryan JJ, Zhou H. Global analyses of sumoylated proteins in Saccharomyces cerevisiae. Induction of protein

JO U R N A L OF P ROTE O MI CS 1 09 (2 0 1 4 ) 1 –1 5

[45]

[46] [47]

[48]

[49]

[50]

[51]

[52]

sumoylation by cellular stresses. J Biol Chem 2004;279:32262–8. Lee J, Spector D, Godon C, Labarre J, Toledano MB. A new antioxidant with alkyl hydroperoxide defense properties in yeast. J Biol Chem 1999;274:4537–44. Chae HZ, Chung SJ, Rhee SG. Thioredoxin-dependent peroxide reductase from yeast. J Biol Chem 1994;269:27670–8. Wong CM, Zhou Y, Ng RW, Kung Hf HF, Jin DY. Cooperation of yeast peroxiredoxins Tsa1p and Tsa2p in the cellular defense against oxidative and nitrosative stress. J Biol Chem 2002;277:5385–94. Trotter EW, Rand JD, Vickerstaff J, Grant CM. The yeast Tsa1 peroxiredoxin is a ribosome-associated antioxidant. Biochem J 2008;412:73–80. Cores AF. Induction of meiosis in yeast I. Timing of cytological and biochemical events. Planta (Berl) 1967;76:209–26. Niu W, Li Z, Zhan W, Iyer VR, Marcotte EM. Mechanisms of cell cycle control revealed by a systematic and quantitative overexpression screen in S. cerevisiae. PLoS Genet 2008;4: e1000120. Stevenson LF, Kennedy BK, Harlow E. A large-scale overexpression screen in Saccharomyces cerevisiae identifies previously uncharacterized cell cycle genes. Proc Natl Acad Sci U S A 2001;98:3946–51. Liu H, Krizek J, Bretscher A. Construction of a GAL1-regulated yeast cDNA expression library and its application to the

[53]

[54]

[55]

[56]

[57]

[58]

15

identification of genes whose overexpression causes lethality in yeast. Genetics 1992;132:665–73. Illner D, Scherthan H. Ionizing irradiation-induced radical stress stalls live meiotic chromosome movements by altering the actin cytoskeleton. Proc Natl Acad Sci U S A 2013;110:16027–32. Yi K, Rubinstein B, Unruh JR, Guo F, Slaughter BD, Li R. Sequential actin-based pushing forces drive meiosis I chromosome migration and symmetry breaking in oocytes. J Cell Biol 2013;200:567–76. Yi K, Li R. Actin cytoskeleton in cell polarity and asymmetric division during mouse oocyte maturation. Cytoskeleton (Hoboken, NJ) 2012;69:727–37. Azoury J, Lee KW, Georget V, Hikal P, Verlhac MH. Symmetry breaking in mouse oocytes requires transient F-actin meshwork destabilization. Development 2011;138:2903–8. Lénárt P, Bacher CP, Daigle N, Hand AR, Eils R, Terasaki M, et al. A contractile nuclear actin network drives chromosome congression in oocytes. Nature 2005;436:812–8. de Godoy LM, Olsen JV, Cox J, Nielsen ML, Hubner NC, Fröhlich F, et al. Comprehensive mass-spectrometry-based proteome quantification of haploid versus diploid yeast. Nature 2008;455:1251–4.