- Email: [email protected]
Complete sequence of the genome of two dsRNA viruses from Discula destructiva
Virus Research 90 (2002) 217 /224 www.elsevier.com/locate/virusres
Complete sequence of the genome of two dsRNA viruses from Discula destructiva Rui Rong a,1, Shujing Rao b, Simon W. Scott c,*, Gerald R. Carner b, Frank H. Tainter a a
Department of Forest Resources, Clemson University, Clemson, SC 29634, USA b Department of Entomology, Clemson University, Clemson, SC 29634, USA c Department of Plant Pathology and Physiology, Clemson University, Clemson, SC 29634, USA Received 22 May 2002; received in revised form 23 July 2002; accepted 23 July 2002
Abstract Complete nucleotide sequences were determined for the four dsRNA segments present in isolate 247 of Discula destructiva from South Carolina. The largest dsRNA (dsRNA 1) was 1787 bp in length with a single open reading frame (ORF) that coded for a putative RNA-dependent RNA polymerase (RdRp). The dsRNA 2 was 1585 bp in length with a single ORF that coded for a putative viral coat protein. Both the dsRNA 3 (1178 bp in length) and dsRNA 4 (308 bp) contained single ORFs. However, neither the nucleotide sequence nor the sequence of the putative translation products, showed any similarity with sequences currently available from GenBank. Although distinct, all 4 dsRNAs showed conserved nucleotides at both the 5? and 3? termini. Sequences of the two dsRNAs in an isolate of D. destructiva (331 originating from Idaho) were similar in length to, and shared similarity with, the dsRNA 1 and dsRNA 2 of isolate 247. However, although the putative RdRps of isolates 247 and 331 are closely related, the putative viral coat proteins coded for by the respective dsRNA 2s are distinct. Thus, the dsRNAs in the two fungal isolates appeared to originate from distinct, but related viruses, which we have named D. destructiva virus 1 and D. destructiva virus 2, respectively. Phylogenetic analysis indicated that the two viruses were most closely related to Fusarium solani virus 1 and should be considered members of the genus Partitivirus. Another isolate of D. destructiva (272.1) contains a 12 kb dsRNA in addition to the 4 dsRNAs found in isolate 247. Partial sequence of this 12 kb molecule showed a relationship to other large dsRNA molecules isolated from plants. # 2002 Elsevier Science B.V. All rights reserved. Keywords: Discula destructiva ; dsRNA; RNA-dependent RNA polymerase; Coat protein; Partitiviridae
* Corresponding author. Tel.: /1-864-656-5745; fax: /1864-656-0274 E-mail address: [email protected] (S.W. Scott). 1 Present address: Department of Microbiology and Molecular Genetics, Univeristy of California, Los Angeles, CA 90095-1489, USA.
dsRNAs have been detected in isolates of the fungus Discula destructiva Redlin, the cause of dogwood anthracnose (McElreath and Tainter, 1991; McElreath et al., 1994; Yao et al., 1994, 1997). The dsRNAs in each isolate varied in number from 0 to 7 and ranged in size from 0.3
0168-1702/02/$ - see front matter # 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 0 2 ) 0 0 1 7 8 - 8
218
R. Rong et al. / Virus Research 90 (2002) 217 /224
to 12 kb. Eighteen different dsRNA banding patterns have recently been characterized among 85 isolates of D. destructiva originating from Alabama (AL), South Carolina (SC) and Idaho (ID) (Rong et al., 2001). Hybridization probes specific to each of the 1.8, 1.6, 1.2, and 0.4 kb dsRNAs from isolate 247 from SC, indicated that the molecules were distinct from each other. The probe to the 1.8 kb dsRNA segment hybridized to dsRNAs of this size in isolates from all three locations, however, the probe against the 1.6 kb dsRNA did not hybridize to dsRNA of corresponding size in isolates from ID (Rong et al., 2001). Virus-like particles of 30/40 nm in diameter had been observed in the cytoplasm of isolates of D. destructiva containing dsRNAs of a similar size (:/1.8 /2.3 kb) and two polypeptides (molecular mass: approximately 52.5 and 46.5 kDa) were detected in viral preparations purified from these isolates (Yao and Tainter, 1996). Thus it had been proposed that the multiple dsRNAs result from co-infection by a number of viruses with dsRNA genomes. To test this hypothesis, and to attempt to identify the components of these putative multiple infections, complete sequences for the dsRNAs from D. destructiva isolates 247 and 272.1 from SC, and isolate 331 from ID were obtained. Isolate 247 contains 4 dsRNAs. Isolate 272.1 contains 4 dsRNAs similar in size to those observed in isolate 247. Hybridization studies have indicated that these dsRNAs were similar to, and sequence analysis showed them to be identical to, the dsRNAs in isolate 247. In addition, isolate 272.1 contains a dsRNA of 12 kb. Isolate 331 contains only 2 dsRNAs similar in size to the two larger dsRNAs of 247 and 272.1. However, although a probe to the 1.8 kb dsRNA of isolate 247 hybridized to the larger dsRNA of isolate 331, a probe to the 1.6 kb dsRNA of 247 did not hybridize to the smaller dsRNA of 331. dsRNAs were extracted from mycelium of D. destructiva, isolates 247 and 272.1 from SC, and 331 from ID using methods described previously (McElreath et al., 1994; Yao et al., 1997; Yao and Tainter, 1996). After extraction and treatment with RNase-free DNase I (Promega, Madison, WI), the dsRNA was fractionated by electrophoresis in a 0.7% agarose gel buffered with Tris /
acetate (McElreath et al., 1994). The dsRNA was recovered from the gel and purified using mini, siliconized glass wool columns. Linkers 4-14-1 (5? GAGGGATCCAGTTTAAAATCCTCAGAGGA 3?/5? p-TCCTCTGAGGATTTTAAACT-p 3?) and 4-14-pp were added to purified dsRNAs using T4 DNA ligase (Promega) and T4 RNA ligase (New England BioLabs† , Beverly, MA). cDNAs were synthesized using MMLV reverse transcriptase (Promega) and primer 4-14-1 and then amplified with Advantage II PCR enzyme (Clontech, Palo Alto, CA) using primers based on the linker sequences. After an initial denaturation at 95 8C for 90 s, reactions were subjected to 25 cycles of 95 8C for 30 s, 56 8C for 40 s and 70 8C for 2.5 m. PCR products were subjected to electrophoresis and products of appropriate size were excised from the agarose gel and recovered using a GENECLEAN kit (Bio 101, Vista, CA). The purified cDNA was ligated into pBluescript SK/ vector cut with Eco RV. Individual dsRNAs labeled with 32P by random primer extension with M-MLV reverse transcriptase (Ausubel et al., 1998) were used to confirm the presence of inserts within the plasmids by colony hybridization on a positively charged membrane (Hybond /N/, Amersham Pharmacia Biotech, Piscataway, NJ). Rapid amplification of cDNA ends was used to determine the 5? end of clones (Frohman et al., 1988). Clones containing appropriate inserts were sequenced from both directions using M13F and M13R primers and other primers that were designed from the sequencing results of the respective cDNA clones. Sequencing was completed using both dye primer chemistry on a LiCor 4200L-2 sequencer (Li-Cor, Lincoln, NE) and Rhodamine, dye-terminator, and Big Dye chemistry on either an ABI 373 or an ABI 377 sequencer (Applied Biosystems, Foster city, CA). Data were assembled and analyzed using GeneJockey II software (Biosoft, Ferguson, MO), BCM Search Launcher (available from http:// www.hgsc.bcm.tmc.edu/SearchLauncher/), and NCBI Blast search (available from http:// www.ncbi.nlm.nih.gov/BLAST/). dsRNAs from isolates 247 and 272.1 from SC and isolate 331 from ID exhibit different banding
R. Rong et al. / Virus Research 90 (2002) 217 /224
Fig. 1. dsRNA banding patterns of isolates 272.1, 247, and 331 of D. destructiva . Lane (A) Isolate 272.1, Lane (B) Isolate 247 */DdV 1, Lane (C) l DNA digested with Hind III, Lane (D) 1 kb DNA ladder; Lane (E) Isolate 331 */DdV 2. Sizes indicated to the left of the figure are based on sizes indicated by sequencing and by interpolation between the sizes of the l DNA/Hind III marker and the 1 kb DNA ladder.
patterns in agarose gel electrophoresis (Fig. 1). Isolate 247 has four dsRNAs estimated to be approximately 1.8, 1.6, 1.2 and 0.3 kb in size. Isolate 272.1 has 4 dsRNAs similar in size to those possessed by isolate 247 but also has a much larger dsRNA estimated to be approximately 12 kb. Isolate 331 has two dsRNAs similar in size to 1.8 and 1.6 kb molecules of the other two isolates. The complete sequences of the 4 dsRNA segments in isolate 247 of D . destructiva were deposited in GenBank as accessions AF316992, AF316993, AF316994, and AF316995. Sequence analysis revealed that each dsRNA contained a single open reading frame (ORF) on only one of the strands. dsRNA 1 (AF316992) is 1787 bp in length and the ORF (nt 65/1684) codes for a putative polypeptide of 538 amino acids (aa). dsRNA 2 (AF316993) is 1585 bp in length and the ORF (nt 99 /1409), codes for a putative polypeptide of 435 aa. BLAST-X searches indicated that the products of dsRNA 1 and dsRNA 2
219
share identity (56 and 35%) with the RNAdependent RNA polymerase (RdRp) and the coat protein, respectively, coded for by the mycovirus FusoV (Nogawa et al., 1996)*/now referred to as Fusarium solani virus (FsV 1) and listed as an approved member of the genus Partitivirus (Ghabrial, 2002). No match could be found in GenBank for either the nucleotide sequence or the putative amino acid sequence of the ORFs in dsRNA 3 (1178 bp) or dsRNA 4 (308 bp). However, all 4 dsRNAs had conserved nucleotides at both the 5? (G/CGCAAA) and 3? (CTCC) termini. The sequences of the 4 smaller dsRNAs in isolate 272.1 were almost identical to those obtained for the dsRNAs in 247 (data not shown). The partial sequence obtained for the 12 kb molecule (GenBank accessions AF375469 and AF375470) showed no relationship to any of the other 4 dsRNAs. Fragment 1 (AF375469) is 800 bp in length, and fragment 2 is 694 bp in length and both contain a single ORF. The putative translation product of fragment 1 shares 33% identity with the ORF B located towards the 3? end of a 17.6 kb dsRNA found in Vicia faba L. (Pfeiffer, 1998) and 23% with the ORF B located toward the 3? end of a 16 kb dsRNA found in Oryza sativa L. (Fukuhara et al., 1993). No relationship between fragment 2 and any sequences in GenBank could be detected. The sequence for the larger dsRNA of isolate 331 (GenBank accession AY033436) was 1781 bp in length and contained a single ORF (nt 62 / 1681), the putative translation product of which shared 87.6% identity with the product of the single ORF of dsRNA 1 from isolate 247 (Fig. 2). The sequence of the smaller dsRNA from isolate 331 (GenBank accession AY033437) was 1611 bp in length and contained a single ORF (nt 103 / 1431), the putative translation product of which shared 63.5% identity with product of the single ORF of dsRNA 2 from isolate 247 (Fig. 3). Both dsRNAs from isolate 331 had the same conserved nucleotides at the 5? and 3? termini as did the dsRNAs of isolate 247. It is proposed that the dsRNAs from isolate 247 form the genome of a virus that we call D. destructiva virus 1 (DdV 1) and the dsRNAs from isolate 331 form the genome
220
R. Rong et al. / Virus Research 90 (2002) 217 /224
Fig. 2. Multiple alignment of the putative RdRps of DdV 1, DdV 2 and FsV 1. aa conserved at a single position in all viruses are surrounded with a gray box. aa conserved between DdV 1 and DdV 2 are printed in white text surrounded by a black box. The alignment was completed using Clustal W (Thompson et al., 1994). The sequences used in comparison are GenBank accessions AF316992 (DdV 1), AY033436 (DdV 2) and D55668 (FsV 1).
of a virus that we call D. destructiva virus 2 (DdV 2). DdV 1 and DdV 2 form a unique cluster with FsV 1 in the phylogenetic tree (Fig. 4) that we developed indicating that the three viruses are related. However, DdV 1 and DdV 2 also form their own unique group, clearly indicating that they are more closely related to each other than to
FsV 1. Although the true extent of the relationships among these three viruses may only become apparent when sequence data from other related viruses becomes available, the phylogenetic tree that we generated suggests that both DdV 1 and DdV 2 belong to the genus Partitivirus . dsRNAs are frequently reported in fungi. However, with the exception of killer toxins in certain
R. Rong et al. / Virus Research 90 (2002) 217 /224
221
Fig. 3. Multiple alignment of the putative coat proteins of DdV 1, DdV 2 and FsV 1. aa conserved at a single position in all viruses are surrounded with a gray box. aa conserved between DdV 1 and DdV 2 are printed in white text surrounded by a black box. The alignment was completed using Clustal W (Thompson et al., 1994). The sequences used in comparison are GenBank accessions AF316993 (DdV 1), AY033437 (DdV 2) and D55669 (FsV 1).
species of yeast and smut, and hypovirulence in Cryphonectria parasitica, no functions are associated with the presence of these molecules (Compel et al., 1999). The original work with dsRNA in D. destructiva was initiated to determine whether differences in morphology between cultures of the fungus could be correlated with differences in the incidence of dsRNA. In addition, the possibility that the large (12 kb) dsRNA was associated with hypovirulence and might offer a means of control of dogwood anthracnose, as was the case with hypovirulence in C. parasitica (Choi and Nuss, 1992), was to be examined (McElreath et al., 1994). No such association was detected and it
seemed likely that the multiple bands of dsRNA, and the variation in band number among isolates, were the result of infection by more than one virus (Yao and Tainter, 1996). Sequence data show that the RdRps in isolates 247 and 331 are closely related to each other (87% identity). The aa sequence of the putative coat proteins coded for by the respective dsRNA 2s are clearly more distantly related (63% identity). Additional evidence of the close relationship between the two viruses is provided by the conserved termini that occur in the dsRNA of both isolates 247 and 331. Viruses in the family Reoviridae have dsRNA genomes, typically of 10 or more fragments, which
222
R. Rong et al. / Virus Research 90 (2002) 217 /224
Fig. 4. An unrooted phylogenetic tree constructed using data for the RdRp of FsV 1 (F. solani virus FusoV dsRNA M1 */Nogawa et al., 1996), DdV 2 (this paper), DdV 1 (this paper), PyrR1 (Pyrus pyrifolia dsRNA 1 */Osaki et al., 1998), BCV-3 (Beet cryptic virus 3 dsRNA 2 */Xie et al., 1993), AhV (A. hypoxylon virus dsRNA 1 */Oh and Hillman, 1995), RsV (R. solani isolate 717 */Strauss et al., 2000), and FpV -1 (F. poae virus 1 dsRNA2 */Compel et al., 1999). The tree was generated using the program Clustal W (Thompson et al., 1994) and plotted using Njplot (Perrie`re, and Gouy, 1996). Numbers along the branches indicate bootstrap values based on 1000 replicates.
R. Rong et al. / Virus Research 90 (2002) 217 /224
possess conserved 5? and 3? nucleotides that aid in reassortment of the genomic fragments. (Suzuki, 1995). DdV 1 possesses a dsRNA 3 and 4 that are absent in DdV 2. No function for the putative translation products of these 2 molecules has been determined. However, although partitiviruses are described as having 2 genomic dsRNAs of approximately 1.4 /2.2 kbp coding for an RdRp and a coat protein, other accepted partitiviruses have been shown to possess dsRNAs smaller than those that code for the RdRp and the coat protein (Ghabrial, 2002). These smaller molecules are apparently satellite RNAs supported by the larger genomic molecules of the virus. While the presence of dsRNA 3 and dsRNA 4 provide a distinctive characteristic for DdV 1, there is no evidence that DdV 2 is unable to support satellites. Thus the situation may be similar to that observed in the genus Cucuomovirus where some isolates of a viral species possess satellites and others do not (Roossinck et al., 1992). However, based on the extent of the similarity between the putative coat proteins of DdV 1 and DdV 2 we suggest that we have sequenced two related but distinct viruses. Although we have described two distinct viruses the argument that the dsRNAs found in some isolates of the D. destructiva result by infection with multiple viruses is still open to debate. The 12 kb fragment that we have identified is associated with a dsRNA that is not currently accepted as a virus. Pfeiffer (1998) has suggested that the 17 kb dsRNA associated with cytoplasmic sterility in Vicia faba , and other dsRNAs of similar size found in non-virus-inoculated plants, are nonencapsidated dsRNA replicons with a plasmid-like life cycle. The copy number of the dsRNA is controlled by the host and may vary with the stage of development. Clearly more research is required before we can determine exactly how this 12 kb dsRNA relates to the other similar molecules reported from plants and also before we can attempt to associate some phenotypic variation in fungal cultures with the presence of the molecule. Interestingly, the two viruses that we have described originate from geographically distinct populations of D. destructiva , raising questions about the origins of the viruses, and how the
223
fungus became infected with related but distinct viruses.
Acknowledgements This research was supported by the McIntireStennis Cooperative Forestry Program. Dr Eugene Van Arsdel, Tijeras, New Mexico, provided significant supplementary funding.
References Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K., 1998. Current Protocols in Molecular Biology. Wiley, New York. Choi, G.H., Nuss, D.L., 1992. Hypovirulence of chestnut blight fungus conferred by an infectious viral cDNA. Science 257, 800 /803. Compel, P., Papp, I., Bibo, M., Fekete, C., Hornok, L., 1999. Genetic interrelationships and genome organization of double stranded RNA elements in Fusarium poae . Virus Genes 18, 49 /56. Frohman, M.A., Dush, M.K., Martin, G.R., 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998 /9002. Fukuhara, T., Moriyama, H., Pak, J.Y., Hyakutake, H., Nitta, T., 1993. Enigmatic double-stranded RNA in Japonica rice. Plant Mol. Biol. 21, 1121 /1130. Ghabrial, S.A., 2002. Partitivirus (Partitiviridae ). In: Tidona, C.A., Darsai, G. (Eds.), The Springer Index of Viruses. Springer, New York, pp. 685 /688. McElreath, S.D., Tainter, F.H., 1991. Detection of dsRNA in the dogwood anthracnose fungus. Phytopathology 81, 1157. McElreath, S.D., Yao, J.M., Coker, P.S., Tainter, F.H., 1994. Double-stranded RNA in isolates of Discula destructiva from the eastern United States. Curr. Microbiol. 29, 57 /60. Nogawa, M., Kageyama, T., Nakatani, A., Taguchi, G., Shimosaka, M., Okazaki, M., 1996. Cloning and characterization of mycovirus double-stranded RNA from the plant pathogenic fungus, Fusarium solani f. sp. robiniae . Biosci. Biotechnol. Biochem. 60 (5), 784 /788. Oh, C., Hillman, B., 1995. Genome organization of a partitivirus from the filamentous ascomycete Atkinsonella hypoxylon . J. Gen. Virol. 76, 1461 /1470. Osaki, H., Kudo, A., Ohtsu, Y., 1998. Nucleotide sequence of seed and pollen-transmitted double stranded RNA which codes a putative RNA-dependent RNA polymerase detected from Japanese pear. Biosci. Biotechnol. Biochem. 62, 2101 /2106.
224
R. Rong et al. / Virus Research 90 (2002) 217 /224
Perrie`re, G., Gouy, M., 1996. WWW-Query: an on-line retrieval system for biological sequence banks. Biochimie 78, 364 /369. Pfeiffer, P., 1998. Nucleotide sequence, genetic organization and expression strategy of the double-stranded RNA associated with the ‘447’ cytoplasmic male sterility trait in Vicia faba . J. Gen. Virol. 79, 2349 /2358. Rong, R., Rao, S., Scott, S.W., Tainter, F.H., 2001. Common multiple dsRNAs are present in populations of the fungus Discula destructiva originating from widely separated geographic locations. Curr. Microbiol. 42, 144 /148. Roossinck, M.J., Sleat, D., Palukaitis, P., 1992. Satellite RNAs of plant viruses: structures and biological effects. Microbiol. Rev. 56, 265 /279. Strauss, E.E., Lakshman, D.K., Tavantzis, S.M., 2000. Molecular characterization of the genome of a partitivirus from the basidiomycete Rhizoctonia solani . J. Gen. Virol. 81, 549 /555. Suzuki, N., 1995. Molecular analysis of the rice dwarf virus genome. Semin. Virol. 6, 89 /95.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucl. Acids Res. 22, 4673 /4680. Xie, W.S., Antoniw, J.F., White, R.F., 1993. Nucleotide sequence of beet cryptic virus 3 dsRNA 2 which encodes a putative RNA-dependent RNA polymerase. J. Gen. Virol. 74, 1467 /1470. Yao, J.M., Tainter, F.H., 1996. Virus-like particles from Discula destructiva . Can. J. Plant Pathol. 18, 433 /438. Yao, J.M., McElreath, S.D., Tainter, F.H., 1994. Genetic relatedness among dsRNAs from different isolates of Discula destructiva . Curr. Microbiol. 29, 145 /149. Yao, J.M., McElreath, S.D., Tainter, F.H., 1997. Doublestranded RNA in isolates of Discula destructiva from the Pacific northwestern United States and British Columbia, Canada. Curr. Microbiol. 34, 67 /69.
Complete sequence of the genome of two dsRNA viruses from Discula destructiva Rui Rong a,1, Shujing Rao b, Simon W. Scott c,*, Gerald R. Carner b, Frank H. Tainter a a
Department of Forest Resources, Clemson University, Clemson, SC 29634, USA b Department of Entomology, Clemson University, Clemson, SC 29634, USA c Department of Plant Pathology and Physiology, Clemson University, Clemson, SC 29634, USA Received 22 May 2002; received in revised form 23 July 2002; accepted 23 July 2002
Abstract Complete nucleotide sequences were determined for the four dsRNA segments present in isolate 247 of Discula destructiva from South Carolina. The largest dsRNA (dsRNA 1) was 1787 bp in length with a single open reading frame (ORF) that coded for a putative RNA-dependent RNA polymerase (RdRp). The dsRNA 2 was 1585 bp in length with a single ORF that coded for a putative viral coat protein. Both the dsRNA 3 (1178 bp in length) and dsRNA 4 (308 bp) contained single ORFs. However, neither the nucleotide sequence nor the sequence of the putative translation products, showed any similarity with sequences currently available from GenBank. Although distinct, all 4 dsRNAs showed conserved nucleotides at both the 5? and 3? termini. Sequences of the two dsRNAs in an isolate of D. destructiva (331 originating from Idaho) were similar in length to, and shared similarity with, the dsRNA 1 and dsRNA 2 of isolate 247. However, although the putative RdRps of isolates 247 and 331 are closely related, the putative viral coat proteins coded for by the respective dsRNA 2s are distinct. Thus, the dsRNAs in the two fungal isolates appeared to originate from distinct, but related viruses, which we have named D. destructiva virus 1 and D. destructiva virus 2, respectively. Phylogenetic analysis indicated that the two viruses were most closely related to Fusarium solani virus 1 and should be considered members of the genus Partitivirus. Another isolate of D. destructiva (272.1) contains a 12 kb dsRNA in addition to the 4 dsRNAs found in isolate 247. Partial sequence of this 12 kb molecule showed a relationship to other large dsRNA molecules isolated from plants. # 2002 Elsevier Science B.V. All rights reserved. Keywords: Discula destructiva ; dsRNA; RNA-dependent RNA polymerase; Coat protein; Partitiviridae
* Corresponding author. Tel.: /1-864-656-5745; fax: /1864-656-0274 E-mail address: [email protected] (S.W. Scott). 1 Present address: Department of Microbiology and Molecular Genetics, Univeristy of California, Los Angeles, CA 90095-1489, USA.
dsRNAs have been detected in isolates of the fungus Discula destructiva Redlin, the cause of dogwood anthracnose (McElreath and Tainter, 1991; McElreath et al., 1994; Yao et al., 1994, 1997). The dsRNAs in each isolate varied in number from 0 to 7 and ranged in size from 0.3
0168-1702/02/$ - see front matter # 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 0 2 ) 0 0 1 7 8 - 8
218
R. Rong et al. / Virus Research 90 (2002) 217 /224
to 12 kb. Eighteen different dsRNA banding patterns have recently been characterized among 85 isolates of D. destructiva originating from Alabama (AL), South Carolina (SC) and Idaho (ID) (Rong et al., 2001). Hybridization probes specific to each of the 1.8, 1.6, 1.2, and 0.4 kb dsRNAs from isolate 247 from SC, indicated that the molecules were distinct from each other. The probe to the 1.8 kb dsRNA segment hybridized to dsRNAs of this size in isolates from all three locations, however, the probe against the 1.6 kb dsRNA did not hybridize to dsRNA of corresponding size in isolates from ID (Rong et al., 2001). Virus-like particles of 30/40 nm in diameter had been observed in the cytoplasm of isolates of D. destructiva containing dsRNAs of a similar size (:/1.8 /2.3 kb) and two polypeptides (molecular mass: approximately 52.5 and 46.5 kDa) were detected in viral preparations purified from these isolates (Yao and Tainter, 1996). Thus it had been proposed that the multiple dsRNAs result from co-infection by a number of viruses with dsRNA genomes. To test this hypothesis, and to attempt to identify the components of these putative multiple infections, complete sequences for the dsRNAs from D. destructiva isolates 247 and 272.1 from SC, and isolate 331 from ID were obtained. Isolate 247 contains 4 dsRNAs. Isolate 272.1 contains 4 dsRNAs similar in size to those observed in isolate 247. Hybridization studies have indicated that these dsRNAs were similar to, and sequence analysis showed them to be identical to, the dsRNAs in isolate 247. In addition, isolate 272.1 contains a dsRNA of 12 kb. Isolate 331 contains only 2 dsRNAs similar in size to the two larger dsRNAs of 247 and 272.1. However, although a probe to the 1.8 kb dsRNA of isolate 247 hybridized to the larger dsRNA of isolate 331, a probe to the 1.6 kb dsRNA of 247 did not hybridize to the smaller dsRNA of 331. dsRNAs were extracted from mycelium of D. destructiva, isolates 247 and 272.1 from SC, and 331 from ID using methods described previously (McElreath et al., 1994; Yao et al., 1997; Yao and Tainter, 1996). After extraction and treatment with RNase-free DNase I (Promega, Madison, WI), the dsRNA was fractionated by electrophoresis in a 0.7% agarose gel buffered with Tris /
acetate (McElreath et al., 1994). The dsRNA was recovered from the gel and purified using mini, siliconized glass wool columns. Linkers 4-14-1 (5? GAGGGATCCAGTTTAAAATCCTCAGAGGA 3?/5? p-TCCTCTGAGGATTTTAAACT-p 3?) and 4-14-pp were added to purified dsRNAs using T4 DNA ligase (Promega) and T4 RNA ligase (New England BioLabs† , Beverly, MA). cDNAs were synthesized using MMLV reverse transcriptase (Promega) and primer 4-14-1 and then amplified with Advantage II PCR enzyme (Clontech, Palo Alto, CA) using primers based on the linker sequences. After an initial denaturation at 95 8C for 90 s, reactions were subjected to 25 cycles of 95 8C for 30 s, 56 8C for 40 s and 70 8C for 2.5 m. PCR products were subjected to electrophoresis and products of appropriate size were excised from the agarose gel and recovered using a GENECLEAN kit (Bio 101, Vista, CA). The purified cDNA was ligated into pBluescript SK/ vector cut with Eco RV. Individual dsRNAs labeled with 32P by random primer extension with M-MLV reverse transcriptase (Ausubel et al., 1998) were used to confirm the presence of inserts within the plasmids by colony hybridization on a positively charged membrane (Hybond /N/, Amersham Pharmacia Biotech, Piscataway, NJ). Rapid amplification of cDNA ends was used to determine the 5? end of clones (Frohman et al., 1988). Clones containing appropriate inserts were sequenced from both directions using M13F and M13R primers and other primers that were designed from the sequencing results of the respective cDNA clones. Sequencing was completed using both dye primer chemistry on a LiCor 4200L-2 sequencer (Li-Cor, Lincoln, NE) and Rhodamine, dye-terminator, and Big Dye chemistry on either an ABI 373 or an ABI 377 sequencer (Applied Biosystems, Foster city, CA). Data were assembled and analyzed using GeneJockey II software (Biosoft, Ferguson, MO), BCM Search Launcher (available from http:// www.hgsc.bcm.tmc.edu/SearchLauncher/), and NCBI Blast search (available from http:// www.ncbi.nlm.nih.gov/BLAST/). dsRNAs from isolates 247 and 272.1 from SC and isolate 331 from ID exhibit different banding
R. Rong et al. / Virus Research 90 (2002) 217 /224
Fig. 1. dsRNA banding patterns of isolates 272.1, 247, and 331 of D. destructiva . Lane (A) Isolate 272.1, Lane (B) Isolate 247 */DdV 1, Lane (C) l DNA digested with Hind III, Lane (D) 1 kb DNA ladder; Lane (E) Isolate 331 */DdV 2. Sizes indicated to the left of the figure are based on sizes indicated by sequencing and by interpolation between the sizes of the l DNA/Hind III marker and the 1 kb DNA ladder.
patterns in agarose gel electrophoresis (Fig. 1). Isolate 247 has four dsRNAs estimated to be approximately 1.8, 1.6, 1.2 and 0.3 kb in size. Isolate 272.1 has 4 dsRNAs similar in size to those possessed by isolate 247 but also has a much larger dsRNA estimated to be approximately 12 kb. Isolate 331 has two dsRNAs similar in size to 1.8 and 1.6 kb molecules of the other two isolates. The complete sequences of the 4 dsRNA segments in isolate 247 of D . destructiva were deposited in GenBank as accessions AF316992, AF316993, AF316994, and AF316995. Sequence analysis revealed that each dsRNA contained a single open reading frame (ORF) on only one of the strands. dsRNA 1 (AF316992) is 1787 bp in length and the ORF (nt 65/1684) codes for a putative polypeptide of 538 amino acids (aa). dsRNA 2 (AF316993) is 1585 bp in length and the ORF (nt 99 /1409), codes for a putative polypeptide of 435 aa. BLAST-X searches indicated that the products of dsRNA 1 and dsRNA 2
219
share identity (56 and 35%) with the RNAdependent RNA polymerase (RdRp) and the coat protein, respectively, coded for by the mycovirus FusoV (Nogawa et al., 1996)*/now referred to as Fusarium solani virus (FsV 1) and listed as an approved member of the genus Partitivirus (Ghabrial, 2002). No match could be found in GenBank for either the nucleotide sequence or the putative amino acid sequence of the ORFs in dsRNA 3 (1178 bp) or dsRNA 4 (308 bp). However, all 4 dsRNAs had conserved nucleotides at both the 5? (G/CGCAAA) and 3? (CTCC) termini. The sequences of the 4 smaller dsRNAs in isolate 272.1 were almost identical to those obtained for the dsRNAs in 247 (data not shown). The partial sequence obtained for the 12 kb molecule (GenBank accessions AF375469 and AF375470) showed no relationship to any of the other 4 dsRNAs. Fragment 1 (AF375469) is 800 bp in length, and fragment 2 is 694 bp in length and both contain a single ORF. The putative translation product of fragment 1 shares 33% identity with the ORF B located towards the 3? end of a 17.6 kb dsRNA found in Vicia faba L. (Pfeiffer, 1998) and 23% with the ORF B located toward the 3? end of a 16 kb dsRNA found in Oryza sativa L. (Fukuhara et al., 1993). No relationship between fragment 2 and any sequences in GenBank could be detected. The sequence for the larger dsRNA of isolate 331 (GenBank accession AY033436) was 1781 bp in length and contained a single ORF (nt 62 / 1681), the putative translation product of which shared 87.6% identity with the product of the single ORF of dsRNA 1 from isolate 247 (Fig. 2). The sequence of the smaller dsRNA from isolate 331 (GenBank accession AY033437) was 1611 bp in length and contained a single ORF (nt 103 / 1431), the putative translation product of which shared 63.5% identity with product of the single ORF of dsRNA 2 from isolate 247 (Fig. 3). Both dsRNAs from isolate 331 had the same conserved nucleotides at the 5? and 3? termini as did the dsRNAs of isolate 247. It is proposed that the dsRNAs from isolate 247 form the genome of a virus that we call D. destructiva virus 1 (DdV 1) and the dsRNAs from isolate 331 form the genome
220
R. Rong et al. / Virus Research 90 (2002) 217 /224
Fig. 2. Multiple alignment of the putative RdRps of DdV 1, DdV 2 and FsV 1. aa conserved at a single position in all viruses are surrounded with a gray box. aa conserved between DdV 1 and DdV 2 are printed in white text surrounded by a black box. The alignment was completed using Clustal W (Thompson et al., 1994). The sequences used in comparison are GenBank accessions AF316992 (DdV 1), AY033436 (DdV 2) and D55668 (FsV 1).
of a virus that we call D. destructiva virus 2 (DdV 2). DdV 1 and DdV 2 form a unique cluster with FsV 1 in the phylogenetic tree (Fig. 4) that we developed indicating that the three viruses are related. However, DdV 1 and DdV 2 also form their own unique group, clearly indicating that they are more closely related to each other than to
FsV 1. Although the true extent of the relationships among these three viruses may only become apparent when sequence data from other related viruses becomes available, the phylogenetic tree that we generated suggests that both DdV 1 and DdV 2 belong to the genus Partitivirus . dsRNAs are frequently reported in fungi. However, with the exception of killer toxins in certain
R. Rong et al. / Virus Research 90 (2002) 217 /224
221
Fig. 3. Multiple alignment of the putative coat proteins of DdV 1, DdV 2 and FsV 1. aa conserved at a single position in all viruses are surrounded with a gray box. aa conserved between DdV 1 and DdV 2 are printed in white text surrounded by a black box. The alignment was completed using Clustal W (Thompson et al., 1994). The sequences used in comparison are GenBank accessions AF316993 (DdV 1), AY033437 (DdV 2) and D55669 (FsV 1).
species of yeast and smut, and hypovirulence in Cryphonectria parasitica, no functions are associated with the presence of these molecules (Compel et al., 1999). The original work with dsRNA in D. destructiva was initiated to determine whether differences in morphology between cultures of the fungus could be correlated with differences in the incidence of dsRNA. In addition, the possibility that the large (12 kb) dsRNA was associated with hypovirulence and might offer a means of control of dogwood anthracnose, as was the case with hypovirulence in C. parasitica (Choi and Nuss, 1992), was to be examined (McElreath et al., 1994). No such association was detected and it
seemed likely that the multiple bands of dsRNA, and the variation in band number among isolates, were the result of infection by more than one virus (Yao and Tainter, 1996). Sequence data show that the RdRps in isolates 247 and 331 are closely related to each other (87% identity). The aa sequence of the putative coat proteins coded for by the respective dsRNA 2s are clearly more distantly related (63% identity). Additional evidence of the close relationship between the two viruses is provided by the conserved termini that occur in the dsRNA of both isolates 247 and 331. Viruses in the family Reoviridae have dsRNA genomes, typically of 10 or more fragments, which
222
R. Rong et al. / Virus Research 90 (2002) 217 /224
Fig. 4. An unrooted phylogenetic tree constructed using data for the RdRp of FsV 1 (F. solani virus FusoV dsRNA M1 */Nogawa et al., 1996), DdV 2 (this paper), DdV 1 (this paper), PyrR1 (Pyrus pyrifolia dsRNA 1 */Osaki et al., 1998), BCV-3 (Beet cryptic virus 3 dsRNA 2 */Xie et al., 1993), AhV (A. hypoxylon virus dsRNA 1 */Oh and Hillman, 1995), RsV (R. solani isolate 717 */Strauss et al., 2000), and FpV -1 (F. poae virus 1 dsRNA2 */Compel et al., 1999). The tree was generated using the program Clustal W (Thompson et al., 1994) and plotted using Njplot (Perrie`re, and Gouy, 1996). Numbers along the branches indicate bootstrap values based on 1000 replicates.
R. Rong et al. / Virus Research 90 (2002) 217 /224
possess conserved 5? and 3? nucleotides that aid in reassortment of the genomic fragments. (Suzuki, 1995). DdV 1 possesses a dsRNA 3 and 4 that are absent in DdV 2. No function for the putative translation products of these 2 molecules has been determined. However, although partitiviruses are described as having 2 genomic dsRNAs of approximately 1.4 /2.2 kbp coding for an RdRp and a coat protein, other accepted partitiviruses have been shown to possess dsRNAs smaller than those that code for the RdRp and the coat protein (Ghabrial, 2002). These smaller molecules are apparently satellite RNAs supported by the larger genomic molecules of the virus. While the presence of dsRNA 3 and dsRNA 4 provide a distinctive characteristic for DdV 1, there is no evidence that DdV 2 is unable to support satellites. Thus the situation may be similar to that observed in the genus Cucuomovirus where some isolates of a viral species possess satellites and others do not (Roossinck et al., 1992). However, based on the extent of the similarity between the putative coat proteins of DdV 1 and DdV 2 we suggest that we have sequenced two related but distinct viruses. Although we have described two distinct viruses the argument that the dsRNAs found in some isolates of the D. destructiva result by infection with multiple viruses is still open to debate. The 12 kb fragment that we have identified is associated with a dsRNA that is not currently accepted as a virus. Pfeiffer (1998) has suggested that the 17 kb dsRNA associated with cytoplasmic sterility in Vicia faba , and other dsRNAs of similar size found in non-virus-inoculated plants, are nonencapsidated dsRNA replicons with a plasmid-like life cycle. The copy number of the dsRNA is controlled by the host and may vary with the stage of development. Clearly more research is required before we can determine exactly how this 12 kb dsRNA relates to the other similar molecules reported from plants and also before we can attempt to associate some phenotypic variation in fungal cultures with the presence of the molecule. Interestingly, the two viruses that we have described originate from geographically distinct populations of D. destructiva , raising questions about the origins of the viruses, and how the
223
fungus became infected with related but distinct viruses.
Acknowledgements This research was supported by the McIntireStennis Cooperative Forestry Program. Dr Eugene Van Arsdel, Tijeras, New Mexico, provided significant supplementary funding.
References Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K., 1998. Current Protocols in Molecular Biology. Wiley, New York. Choi, G.H., Nuss, D.L., 1992. Hypovirulence of chestnut blight fungus conferred by an infectious viral cDNA. Science 257, 800 /803. Compel, P., Papp, I., Bibo, M., Fekete, C., Hornok, L., 1999. Genetic interrelationships and genome organization of double stranded RNA elements in Fusarium poae . Virus Genes 18, 49 /56. Frohman, M.A., Dush, M.K., Martin, G.R., 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998 /9002. Fukuhara, T., Moriyama, H., Pak, J.Y., Hyakutake, H., Nitta, T., 1993. Enigmatic double-stranded RNA in Japonica rice. Plant Mol. Biol. 21, 1121 /1130. Ghabrial, S.A., 2002. Partitivirus (Partitiviridae ). In: Tidona, C.A., Darsai, G. (Eds.), The Springer Index of Viruses. Springer, New York, pp. 685 /688. McElreath, S.D., Tainter, F.H., 1991. Detection of dsRNA in the dogwood anthracnose fungus. Phytopathology 81, 1157. McElreath, S.D., Yao, J.M., Coker, P.S., Tainter, F.H., 1994. Double-stranded RNA in isolates of Discula destructiva from the eastern United States. Curr. Microbiol. 29, 57 /60. Nogawa, M., Kageyama, T., Nakatani, A., Taguchi, G., Shimosaka, M., Okazaki, M., 1996. Cloning and characterization of mycovirus double-stranded RNA from the plant pathogenic fungus, Fusarium solani f. sp. robiniae . Biosci. Biotechnol. Biochem. 60 (5), 784 /788. Oh, C., Hillman, B., 1995. Genome organization of a partitivirus from the filamentous ascomycete Atkinsonella hypoxylon . J. Gen. Virol. 76, 1461 /1470. Osaki, H., Kudo, A., Ohtsu, Y., 1998. Nucleotide sequence of seed and pollen-transmitted double stranded RNA which codes a putative RNA-dependent RNA polymerase detected from Japanese pear. Biosci. Biotechnol. Biochem. 62, 2101 /2106.
224
R. Rong et al. / Virus Research 90 (2002) 217 /224
Perrie`re, G., Gouy, M., 1996. WWW-Query: an on-line retrieval system for biological sequence banks. Biochimie 78, 364 /369. Pfeiffer, P., 1998. Nucleotide sequence, genetic organization and expression strategy of the double-stranded RNA associated with the ‘447’ cytoplasmic male sterility trait in Vicia faba . J. Gen. Virol. 79, 2349 /2358. Rong, R., Rao, S., Scott, S.W., Tainter, F.H., 2001. Common multiple dsRNAs are present in populations of the fungus Discula destructiva originating from widely separated geographic locations. Curr. Microbiol. 42, 144 /148. Roossinck, M.J., Sleat, D., Palukaitis, P., 1992. Satellite RNAs of plant viruses: structures and biological effects. Microbiol. Rev. 56, 265 /279. Strauss, E.E., Lakshman, D.K., Tavantzis, S.M., 2000. Molecular characterization of the genome of a partitivirus from the basidiomycete Rhizoctonia solani . J. Gen. Virol. 81, 549 /555. Suzuki, N., 1995. Molecular analysis of the rice dwarf virus genome. Semin. Virol. 6, 89 /95.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucl. Acids Res. 22, 4673 /4680. Xie, W.S., Antoniw, J.F., White, R.F., 1993. Nucleotide sequence of beet cryptic virus 3 dsRNA 2 which encodes a putative RNA-dependent RNA polymerase. J. Gen. Virol. 74, 1467 /1470. Yao, J.M., Tainter, F.H., 1996. Virus-like particles from Discula destructiva . Can. J. Plant Pathol. 18, 433 /438. Yao, J.M., McElreath, S.D., Tainter, F.H., 1994. Genetic relatedness among dsRNAs from different isolates of Discula destructiva . Curr. Microbiol. 29, 145 /149. Yao, J.M., McElreath, S.D., Tainter, F.H., 1997. Doublestranded RNA in isolates of Discula destructiva from the Pacific northwestern United States and British Columbia, Canada. Curr. Microbiol. 34, 67 /69.