Conserved Amino Acid Residue Mutations in Epitope of Human Cytomegalovirus Antigen M

CHINESE JOURNAL OF BIOTECHNOLOGY Volume 24, Issue 7, July 2008 Online English edition of the Chinese language journal RESEARCH

Cite this article as: Chin J Biotech, 2008, 24(7), 1128í1132.

PAPER

Conserved Amino Acid Residue Mutations in Epitope of Human Cytomegalovirus Antigen M Benxu Wang1, Zhan Liu2, Yu Liu 3, Beifen Shen3, Chuan Liu3, and Ningsheng Shao3 1

Center of Disease Control and Prevention, Beijing Command, Beijing 100042, China

2

Huairou Maternal and Child Health Hospital, Beijing 101400, China

3

Institute of Basic Medical Sciences, Academy of Military Medical Sciences, Beijing 100850, China

Abstract: We identified the critical amino-acid residues in antigen M determinant (MAD) epitope of human cytomegalovirus protein M. On the basis of the peptide sequence of MAD, some conservative residues were mutated into the glycine residue. Then the gene fragment of mutants linked to amino terminal of Fc were cloned into the plasmid pET32-Fc and expressed by fusion with Fc. After purified by protein A affinity chromatography, the activity of mutants binding the goat polyclonal antibodies against human cytomegalovirus (HCMV) were detected by ELISA and Western blotting. Our results showed that when glutamine residue was mutated into glycine residue, the activity of MADQĺG binding the goat polyclonal antibodies against HCMV was reduced apparently. Other mutants did not have the same characteristics. The activity of MAD was closely related to the conformation of glutamine residue. Keywords: human cytomegalovirus (HCMV); epitope; mutant

Introduction Although human cytomegalovirus (HCMV), a E herpesviridae, commonly causes subclinical infections in healthy adults, HCMV infection remains of considerable importance as a cause of disease in infants infected in utero and immunocompromised populations including patients with acquired immune deficiency syndrome (AIDS), patients exposed to rays, patients with malignant tumor, and recipients of organ transplantation. In view of the hazard of HCMV to human, many articles about HCMV infection have been reported, especially about the membrane glycoprotein B (gB) and gH. There are three neutralizing epitope sites on gB, AD1: 552–630aa, AD2: 50–54aa (site I) and 67–86aa (site II), AD3: 798–805aa[1,2]. Also there are three sites on gH[3]. In the this article, the ability of the

polyclonal antibody against gM/gN complex inhibiting HCMV particles from infecting susceptive cells proving that gM also contain neutralizing epitopes have been studied, but there are no reports about them[4,5]. In our previous study, a new neutralizing epitope, termed MAD, on gM of HCMV was screened from random phage peptide library by subtractive strategy targeted on goat polyclonal antibody against HCMV. The peptide sequence of MAD was highly homologous with 31–37 amino acids of HCMV gM, and the polyclonal antibody against MAD binded the recombinant gM30-78 peptide[6]. As the specificity and activity of epitope are closely correlative with conformation of some specific amino acids, we tried to find out the major conservative amino acids in MAD by artificial site-specific mutation into glycine residue. Then, we detected the activity of mutations to bind the goat

Received: November 14, 2007; Accepted: January 17, 2008 Supported by: the National Natural Science Foundation of China(No. 30471556). Corresponding author: Ningsheng Shao. Tel: +86-10-66932313; E-mail: [email protected] Chuan Liu. E-mail: [email protected] Copyright © 2008, Institute of Microbiology, Chinese Academy of Sciences and Chinese Society for Microbiology. Published by Elsevier BV. All rights reserved.

Benxu Wang et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1128–1132

polyclonal antibody against HCMV.

1

Materials and methods

1.1 Materials pET28-Fc was kindly provided by Dr. Hong Chang (Beijing institute of Basic Medical Sciences) and pET32a by Dr. Ruonan Xu (Beijing institute of Basic Medical Sciences); Competent cell BL21(DE3){F-ompT hsaSB (rB-MB-)gal dcm(DE3)} and BL21(DE3)pLysS {F-ompT hsaSB (rBíMBí)gal dcm(DE3) pLysS Camr} (our lab stock); the plasmid extracting kit and gel kit were purchased from Promega and Nco I, BamH I, EcoR I from TaKaRa; Goat polyclonal antibody (No. B65275G) was obtained from Biodesign; goat-anti-mouse antibody conjugated to horseradish peroxidase (Zhongtong biotech); Protein A medium (Benyuanzhengyang Biotech). 1.2 Methods 1.2.1 Synthesis and annealing of the complement gene fragment of MAD: The positive and minus strands were dissolved in sterile water to 100 pmol/mL, respectively. Then, 5 ȝL of each together with 5 ȝL 10 × annealing Buffer (10 mM Tris, pH 8.0, 50 mM NaCL, 1 mM EDTA) was added to an eppendorf tube, then sterile water was added until the solution reached 50 ȝL, and then it was subjected to denaturation for 5 min in boiling water and cooled to room temperature slowly. 1.2.2 Preparation of competent cell, ligation, transformation, extraction, digestion of plasmid, and identification of bacterial clone were conducted as . 1.2.3 Construction of plasmid vector: MAD and mutants digested by Nco I and BamH I, respectively, were ligated into the pET28-Fc plasmid digested by the same two restriction enzymes. The smaller fragment extracted from the recombinant plasmid pET28-Fc digested by Nco I and EcoR I enzymes was then ligated into the plasmid pET32a digested by Nco I and EcoR I enzymes. The recombinant plasmid was identified by digesting with Nde I enzyme, and the positive clones were sequenced. 1.2.4 Expression of recombinant protein: The

Tab.

bacterial clone was amplified in LB medium with Ampicillin for 16 hours. One microlitre of bacterial culture was then transferred into 99 mL fresh LB medium with Ampicillin and cultured at 37oC. One microlitre IPTG (1 mM) was added into the culture when OD600 value approached 0.5 and continued to cultivated for 20 h at 20oC. The supernatant was then removed after ultracentrifugation, and the proteins of recombinant germs were identified by 12% SDS-PAGE after ultrasonication. 1.2.5 Purification of recombinant protein: The recombinant protein was purified by protein A affinity chromatography as MAD was ligated to amino terminal of Fc fragment with linker (Gly-Gly-Gly-Gly-Ser). 1.2.6 Activity detection of MAD and its mutants binding goat polyclonal antibody B65275G by ELISA method: Microwell plates (Coster) were coated with 100 ȝL/well of MAD at concentration of 10 ȝg/mL in PBS overnight at 4oC and subsequently blocked with 3% BSA for 1 h. Then, 100 ȝL B65275G antibody at a 1:500 dilution was transferred in duplicated to the coated blocked wells and incubated for 1 h at 37oC. The wells were washed 5 times using PBS containing 0.05% Tween-20 (PBST), and 100 ȝL rabbitanti-goat polyclonal antibody conjugated to horseradish peroxidase at a 1:8000 dilution was added to each well and was incubated for 1 h. After further washing, the bound B65275G antibody was detected with TMB. 1.2.7 Activity of MAD and its mutants binding B65275G antibody by Western blotting assay: After SDS-PAGE gel electrophoresis, 2 ȝg MAD or its mutants were transferred into wells. Other procedures were carried out as . 1.2.8 Activity detection of MAD and its mutants binding B65275G antibody by competitive ELISA assay: Microwell plates were coated with 100 ȝL/well MAD at a concentration of 10 ȝg/mL in PBS and was kept overnight at 4oC and subsequently, blocked with 3% BSA for 1 h at 37oC. Then, B65275G antibody at a 1:500 dilution mixed with 0.1, 0.5, 1.0, 5.0, and 10.0 ȝg mutants, respectively, was transferred into the coated blocked wells and incubated for 1 h at 37oC. Other procedures were carried out as mentioned in the section 1.2.6.

Gene sequences of MAD and its mutants

Mutants

Sequences of gene

MAD

5ƍ- CATGGGCAAGCTTAGTCTGAGTCAGGTTCCGCCGTCTTCGCATGGCGGCGGCG -3ƍ 3ƍ- CCGTTCGAATCAGACTCAGTCCAAGGCGGCAGAAGCGTACCGCCGCCGCCTAG -5ƍ 5ƍ- CATGGGCAAGGGCAGTCTGAGTCAGGTTCCGCCGTCTTCGCATGGCGGCGGCG -3ƍ 3ƍ- CCGTTCCCGTCAGACTCAGTCCAAGGCGGCAGAAGCGTACCGCCGCCGCCTAG -5ƍ 5ƍ- CATGGGCAAGCTTAGTGGCAGTCAGGTTCCGCCGTCTTCGCATGGCGGCGGCG -3ƍ 3ƍ- CCGTTCGAATCACCGTCAGTCCAAGGCGGCAGAAGCGTACCGCCGCCGCCTAG -5ƍ 5ƍ- CATGGGCAAGCTTAGTCTGGGCCAGGTTCCGCCGTCTTCGCATGGCGGCGGCG -3ƍ 3ƍ- CCGTTCGAATCAGACCCGGTCCAAGGCGGCAGAAGCGTACCGCCGCCGCCTAG -5ƍ

2LǻG 4LǻG 5SǻG 6QǻG

5ƍ- CATGGGCAAGCTTAGTCTGAGTGGCGTTCCGCCGTCTTCGCATGGCGGCGGCG -3ƍ 3ƍ- CCGTTCGAATCAGACTCACCGCAAGGCGGCAGAAGCGTACCGCCGCCGCCTAG -5ƍ

Benxu Wang et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1128–1132

2

Results

2.1 Amino acids of MAD mutated into glycine residue The leucine residue at 4 site, serine residue at 5 site, and glutamine residue at 6 site of MAD peptide (N--KLSLSNVPPSGSC--C) were conservative according to the sequence of glycoprotein M, whereas the leucine residue at 2 site and the proline residue at 8 site were not conservative, although they occurred with high frequency in all phage clones. So the leucine residue at 4 site, serine residue at 5 site, and glutamine residue were mutated into glycine residue, respectively, and the leucine residue at 2 site was referred to negative control. They were named by 4LǻG, 5SǻG, 6QǻG, 2LǻG, respectively (Tab.). 2.2 Construction of pET32-MAD-Fc plasmid Four restriction enzymes, Nco I, Nde I, BamH I, and EcoR I, were arranged in order in pET28-Fc, and Fc fragment remains in between BamH I and EcoR I enzymes. After MAD was inserted between Nco I and BamH I enzymes, the Nde Isite was removed from the plasmid. So the positive recombinant plasmid was detected by digesting with Nde I (Fig. 1). However, the recombinant MAD polypeptide expressed by pET32-MAD-Fc was not dissoluble. In order to obtain the soluble recombinant MAD peptide, the smaller gene fragment from pET32-MAD-Fc plasmid digested with Nco I and EcoR I enzymes was inserted into the pET32a plasmid predigested by the same two restriction enzymes. Hence, most of the recombinant MAD-Fc polypeptides were expressed in soluble form with the help of thioredoxin (data not shown). 2.3 Purification of recombinant MAD-Fc polypeptide MAD-Fc The positive pET32-MAD-Fc plasmid preamplified was transferred to LB medium containing Ampicillin at a final concentration of 100 ȝg/mL and continued to cultivate. The recombinant MAD-Fc was expressed in soluble form when IPTG at a final concentration of 0.01 mM was added into the bacterial culture. After digested by enterokinase, the thioredoxin was removed from recombinant TrxA-MAD-Fc protein so the MAD-Fc polypeptide was purified by protein A affinity chromatography again (Fig. 2). 2.4 Actitity detection of MAD and its mutants binding B65275G antibody assayed by ELISA ELISA results showed that the activity of MAD binding B65275G antibody reduced obviously when glutamine residue was mutated into glycine residue. However, the activity of MAD binding B65275G antibody did not show the same results when other conservative amino acids were mutated into glycine residue. So the activity of MAD was closely correlative with the conformation of glutamine residue (Fig. 3).

Fig. 1 pET28-MAD-Fc plasmid digested by EcoRĉ and Ndeĉ 1: 1 kb DNA ladder marker; 2: plasmid digested by EcoR I; 3: plasmid digested by Nde I; 4: control plasmid

Fig. 2 SDS-PAGE analysis of fusion proteins digested enterokinase 1: marker; 2: TrxA-MAD-Fc; 3: MAD-Fc; 4: 2LǻG-Fc; 5: 4LǻG-Fc; 6: 5SǻG-Fc; 7: 6QǻG-Fc; 8: NP-Fc

Fig. 3 ELISA results of MAD and its mutants binding goat polyclonal antibody B65275G

2.5 Activity detection of MAD and its mutants binding B65275G antibody assayed by Western blotting From the results of Western blotting, the activity of MAD binding B65275G antibody was not higher than that of negative control and reduced obviously when glutamine residue was mutated into glycine residue. However, other amino acids were not (Fig. 4).

Benxu Wang et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1128–1132

2.6 Activity of MAD and its mutants binding B65275G antibody assayed by competitive ELISA In order to further elucidate the ability of MAD binding B65275G antibody, competitive ELISA was carried out between MAD and its mutants. With increasing of three mutants, 2LƸG, 4LƸG, and 5SƸG, the ability of MAD binding B65275G antibody was weakening sharply. Until the mutants accelerated to 1 ȝg, the ability of MAD binding B65275G antibody was lowest. However, regardless of mutant that glutamine residue was mutated into glycine residue increased, the ability of MAD binding B65275G antibody changed little (Fig. 5).

3

Discussion

Epitopes are prerequisite for TCR or BCR to bind antibody; however, the specificity and activity of epitope are closely correlative with conformation of some specific amino acids in epitopes. In our study, four conservative amino acids of MAD were succeeded in site-specific mutation into glycine residue. From results of ELISA, we found that the activity of MAD binding B65275G antibody reduced obviously when glutamine residue was mutated into glycine residue, whereas other three amino acids did not show the same phenomena, which was confirmed by Western blotting method. All study results elucidated that the confirmation of glutamine residue affected the activity of MAD binding antibody when only simple amino acid was mutated. But in-depth study is required to verify the results when two or more amino acids were mutated. When the secondary structure of MAD was compared with its mutants, it was observed that coil was the major structure in amino terminal of MAD, MAD2LĺG, MAD4LĺG,

and MAD5SĺG, whereas strand was the major structure in amino terminal of MAD6QĺG. It was indicated that the confirmation of MAD changed when glutamine residue was mutated into glycine residue. So the activity of MAD binding specific antibody was altered according to the change of MAD confirmation. Susan M[7] et al reported that the glycoprotein M had eight transmembrane regions, which was predicted using computer software, and MAD just remain in the second extracellular region. Recently, Michael Mach[8] et al proved that the binding of glycoprotein M with glycoprotein N occurred through disulfide bond between the Cys44 of gM and Cys90 of gN. However, Cys44 residue just remains in the sequence of MAD. So we presumed that the changing of the structure of the second extracellular region of gM led to the alteration of the whole confirmation of gM when glutamine residue was mutated into glycine residue. This needed further studies. This study was important for designating the epitopes with strong specificity and high affinity and for further study in HCMV vaccine.

REFERENCES [1]

[2]

[3]

[4]

Fig. 4 Activity of MAD and its mutants binding goat polyclonal antibody B65275G assayed by Western blotting

[5]

[6]

[7]

[8] Fig. 5 Activity of MAD and its mutants binding goat polyclonal antibody B65275G assayed by competitive ELISA

Andrea S, Barbara K, Susanne K, et al. The antigenic domain 1 of human ytomegalovirus glycoprotein B contains an intramolecular disulphide bond. J Gen Virol, 2000, 81: 2659–2663. Norbert K, Michael M, Jaydie F, et al. Distribution of linear antigenic sites on glycoprotein gp55 of human cytomegalovirus. J Virol, 1991, 65: 138–146. Jill AS, Jasmine CC, Jeanne B. Neutralizing monoclonal antibodies that distinguish three antigenic sites on human cytomegalovirus glycoprotein H have conformationally distinct binding sites. J Virol, 1993, 67: 489–496. Masako S, Michael M, William JB. Human cytomegalovirus infection elicits a glycoprotein M(gM)/gN-specific virus-neutralizing antibody response. J Virol, 2006, 80: 4591–4600. Shen SY, Wang SX, Britt JW, et al. DNA vaccines expressing glycoprotein complex II antigens gM and gN elicited neutralizing antibodies against multiple human cytomegalovirus (HCMV) isolates. Vaccine, 2007, 25: 3319–3327. Wang BX. Screening and application of epitope in glycoprotein M of human cytomegalovirus. Doctoral Dissertation. Susan MV, Daniel NS, Mattew EM. Identification of proteins in human cytomegalovirus (HCMV) particles: the HCMV proteome. J Virol, 2004, 78: 10960–10966. Michael M, Barbara K, Magdalena K, et al. Complex formation by glycoproteins M and N of human cytomegalovirus: structural and functional aspects. J Virol, 2005, 79: 2160–2170.