- Email: [email protected]
Construction of an Escherichia coli knockout strain for functional analysis of tRNAAsp1
doi:10.1006/jmbi.2001.4785 available online at http://www.idealibrary.com on
J. Mol. Biol. (2001) 310, 537±542
Construction of an Escherichia coli Knockout Strain for Functional Analysis of tRNAAsp William H. McClain* and Kay Gabriel Department of Bacteriology University of Wisconsin, 1550 Linden Drive, E. B. Fred Hall Madison, WI 53706-1567, USA
The speci®c aminoacylation of tRNA is critical for translation of the genetic code. A molecular description of aminoacylation requires knowledge of the relevant three-dimensional structures, biochemical parameters and the structure-function relationship of the synthetase and its substrate tRNA. Extensive structural and biochemical data are available on the aspartic acid system of Escherichia coli, but there is a paucity of cellular functional data. We have developed a system to overcome this de®ciency by engineering an E. coli knockout tRNAAsp strain, thereby allowing a penetrating analysis of tRNAAsp structure and function under conditions that prevail in the cell. # 2001 Academic Press
*Corresponding author
Keywords: multiple knockout; plasmid switch; tRNA; two-plasmid system; aminoacylation
Introduction Escherichia coli tRNAAsp, in both free and enzyme-complexed forms, has been studied extensively by crystallographic and biochemical methods. However, complementary in vivo studies of tRNA structure and function have been constrained because the anticodon bases are essential for aminoacylation, which precludes the use of nonsense suppressor tRNAs to study aminoacylation. We have overcome this limitation by engineering an E. coli knockout strain lacking the multiple chromosomally encoded tRNAAsp genes. Knockout cells are maintained by a plasmid carrying a wild-type tRNAAsp gene. This plasmid can be switched easily for other plasmids carrying any mutant tRNAAsp gene, thereby allowing the in vivo study of tRNA structure and function. This new information, together with crystallographic and other data, will provide a level of critical information capable of unraveling the structure-function relationship between tRNAAsp and its cognate aspartyl-tRNA synthetase (AspRS). Abbreviations used: AspRS, aspartyl-tRNA synthetase; aspwt, Escherichia coli wild-type tRNAAsp; yeast, Saccharomyces cerevisiae; UVT, inactivated forms of three E. coli tRNAAsp genes; ystwt, yeast wild-type tRNAAsp; ystmut6, yeast mutant tRNAAsp with its acceptor stem and positions 32 and 38 of the anticodon loop replaced by the corresponding E. coli nucleotides. E-mail address of the corresponding author: [email protected] 0022-2836/01/030537±6 $35.00/0
Results Inactivation of tRNA genes presents several technical challenges. Gene replacement by antibioticresistance markers is impractical when the chromosome contains multiple gene copies, and entirely deleting a chromosomal tRNA gene leaves no identi®able gene remnant to con®rm its loss. Also, gene deletion and/or insertion raise the possibility that ¯anking genes will be functionally disrupted. We therefore developed the strategy described below to replace the three chromosomal tRNAAsp gene copies with non-functional RNA genes sequences while maintaining cell viability with a plasmid-produced tRNA. E. coli contains three tRNAAsp genes1,2 that produce identical isoacceptors: aspT located at 85 minutes in rrnC, aspU at ®ve minutes in rrnH, and aspV at ®ve minutes on the chromosome in a nonrrn region. Three DNA fragments approximately 1000 base-pairs long, each containing a tRNAAsp gene, were generated by PCR from starting E. coli strain Kdel. The fragments were cloned separately into plasmid pCRII and site-speci®cally altered by the insertion of one of three tetraloops into the anticodon stem and loop, thereby inactivating tRNA function. In addition, pairs of restriction sites were placed on each side of the anticodon stem to facilitate easy con®rmation of mutants by restriction enzyme digestion of PCR products derived from chromosomal DNA. Figure 1 shows the sequence of E. coli tRNAAsp and the relevant parts of the three tetraloop constructs inserted into the respective chromosomal genes. # 2001 Academic Press
538
Functional Analysis of a tRNA in Cells
Figure 1. Wild-type tRNAAsp and anticodon tetraloop structures inserted into aspU, aspV and aspT genes. The circled bases in E. coli tRNAAsp were inserted into a yeast tRNAAsp background to create tRNAystmut6 via a synthetic gene construction. The bases in bold in the asp tetra anticodon stem sequences designate the restriction sites; arrows indicate cleavage points. The base modi®cation of mutant tRNAs was not investigated.
The PCR fragments containing the mutated genes were subcloned separately into M13mp10::CAT,3 a non-replicating gene replacement vector. E. coli strain Kd6 (a relA derivative of Kdel) was infected with M13CATmp10::aspU-tetra and plated on LB plates containing chloramphenicol to select for cells that integrated the M13 vector into the chromosome by homologous recombination. One of these merodiploids (U19, see Figure 2, lane 4) was subsequently resolved by subculturing in LB liquid medium containing 0.5 % (w/v) sodium deoxycholate, and then streaking on LB plates containing 0.3 % sodium deoxycholate. Cells in which the wild-type aspU gene had been replaced with the aspU-tetra gene were identi®ed by in situ hybridization. The presence of the singlereplacement aspU-tetra gene in strain U19-1 was con®rmed by digesting a PCR-generated chromosomal DNA fragment containing the aspU region with ApaI (Figure 2). In a similar way, aspT was replaced to give single-replacement strain T13a. A wild-type tRNAAsp gene carried on the lowcopy, temperature-sensitive maintenance plasmid pBATS4 was transformed into U19-1. The aspV gene in U19-1 was then replaced by aspV-tetra in the manner described above. The resulting strain (UV6a), which lacks functional aspU and aspV genes, was cured of the maintenance plasmid by growing at 42 C without loss of cell viability. This indicates that one of three tRNAAsp genes is suf®cient for viability. We show below (see Table 1) that the amount of tRNAAsp made in the single and double-replacement strains is in approximate proportion to the number of remaining, active tRNAAsp genes. Since the amount of wild-type tRNAAsp required for viability was unknown, we tried to inactivate the third tRNAAsp gene in cells containing various maintenance plasmids. Attempts to engineer a triple knockout strain from double-replacement
UV6a carrying different low and medium-copy plasmids were unsuccessful. However, when we transformed high-copy plasmid pGFIB5 carrying a wild-type tRNAAsp gene into strain UV6a, the ®nal chromosomal gene, aspT, was replaced successfully by aspT-tetra to give strain pGFIBaspwt/UVT, where aspwt indicates E. coli wild-type tRNAAsp, and UVT indicates inactivated forms of AspU, AspV and AspT genes in E. coli. Figure 2, lanes 6-8, show restriction enzyme digestion products of PCR fragments generated from each of the chromosomal tRNAAsp regions, and indicates that all three of the tRNAAsp genes have been replaced by tetraloop RNA sequences in the UVT knockout strain. Lanes 1-3 show the restriction enzyme digestion pattern of the three wild-type genes in the parental strain Kd6. We designed a system to investigate tRNA function by replacing the maintenance plasmid with another plasmid carrying an active yeast mutant tRNAAsp gene (tRNAystmut6; see below). This
Table 1. Level of tRNAAsp standardized to 5 S and normalized to Kd6 Name Kd6 U19-1 T13a UV6a pGFIBaspwt/UVT pGFIBystmut6/UVT pSADaspwt/UVT
E. coli tRNAAsp probe
Yeast tRNAAsp probe
1.00 0.76 0.69 0.39 3.09 0.05 1.43
0.01 0.01 0.01 0.01 0.03 3.11 0.06
The ratio shows the amount of tRNAAsp standardized to 5 S RNA in each sample relative to parental strain Kd6 also standardized to Kd6 5 S RNA ((sample tRNAAsp/sample 5 S)/(Kd6 tRNAAsp/Kd6 5 S)). A background correction was performed by subtracting an equivalent background area from the tRNA and 5 S areas before calculating the ratios.
Functional Analysis of a tRNA in Cells
Figure 2. Agarose gel of restriction enzyme digestion products of tRNAAsp and tetraloop RNA genes. Pro®le of digestion products of PCR fragments showing wildtype tRNAAsp genes from E. coli strain Kd6 (lanes 1-3), a merodiploid containing both wild-type asp and aspUtetra genes (lane 4) and tetraloop RNA genes from knockout strain UVT (lanes 6-8). Lane 5 is size markers.
strategy is more desirable than using a regulatable promoter to adjust the level of wild-type tRNA, because activity of the mutant tRNAAsp can be assessed more meaningfully in the absence of any wild-type tRNAAsp background. Initially, we avoided using pGFIB as the maintenance plasmid because of the dif®culty involved in curing highcopy plasmids. However, we later observed that cells harboring ampicillin-resistant plasmid pGFIB grow poorly on minimal medium (Figure 3),
539 whereas cells harboring medium-copy, chloramphenicol-resistant plasmid pSAD6 grow well on minimal medium. This difference in growth properties, together with the fact that the araCpBAD promoter of pSAD can be induced by arabinose and repressed by glucose,7 and the observation that electroporated bacterial cells lose many of their resident plasmids,8 formed the basis of our strategy for switching plasmids. To test the plasmid-switching system, we ®rst attempted to exchange plasmids carrying wildtype tRNAAsp genes. Competent pGFIBaspwt/ UVT cells were ®rst electroporated to reduce the amount of resident pGFIBaspwt plasmid in the cells. The electroporated cells were allowed to recover for a short time, then again made competent and electroporated a second time with pSAD plasmid carrying an E. coli wild-type tRNAAsp gene. The cells were grown in minimal medium with arabinose and chloramphenicol overnight. A10ÿ6 dilution examined on spread plates revealed colonies on minimal medium but not on rich medium. The minimal medium colonies were picked and streaked on both minimal medium plates containing either arabinose or glucose as the carbon source and on LB plates. The cells grew on arabinose plates, where the gene for wild-type tRNAAsp is expressed from pSADaspwt, but not on either glucose plates or LB rich medium plates, where the gene is repressed. These results indicated that the pGFIB plasmid had been lost and that the pSADaspwt gene was supplying the sole source of tRNAAsp. The UVT identity of the cells was subsequently con®rmed by PCR analysis. Figure 3 shows streak plates of parental strain Kd6 and
Figure 3. Streak plates of parental strain Kd6 and tRNAAsp knockout derivatives. Strains Kd6 and pGFIBaspwt/UVT were each grown overnight at 37 C in LB and Min A supplemented with arabinose, Casamino acids and the appropriate antibiotic as described in Materials and Methods. Strain pSADaspwt/UVT was grown only in the Min A medium. One ml of each culture was pelleted and washed with Min A without supplements. The washed cells were resuspended in 1 ml of Min A without supplements and streaked on plates without antibiotics. The LB plate and Min A plates containing Casamino acids were incubated at 37 C for 20 hours, while the plates without casamino acids were incubated 24 hours.
540 of knockout strain UVT with pGFIBaspwt or pSADaspwt maintenance plasmids. We next demonstrated that a yeast (Saccharomyces cerevisiae) mutant tRNAAsp (tRNAystmut6) that is active in E. coli and carried by pGFIB could be switched for the pSADaspwt maintenance plasmid by reversing the above medium conditions. That is, we electroporated the pGFIB plasmid carrying the yeast mutant tRNA gene into pSADaspwt/UVT cells as described above, then grew the cells overnight in rich medium containing ampicillin but not chloramphenicol. Since the wildtype tRNAAsp gene is not expressed under these conditions, cell viability depended on the mutant tRNAAsp; the absence of chloramphenicol resulted in loss of the pSADaspwt plasmid. We made the tRNAystmut6 gene by synthetically constructing9 a gene containing the yeast tRNAAsp backbone but with 12 bases altered to match those of E. coli tRNAAsp. Yeast tRNAAsp is not aminoacylated in vitro by E. coli AspRS . However, replacing the two terminal base-pairs in the acceptor stem of yeast tRNAAsp with their E. coli counterparts improves in vitro aminoacylation (Dino Moras, personal communication). Not knowing the in vivo requirements of E. coli AspRS, we substituted E. coli bases at all positions in the acceptor stem that differ from those of yeast tRNAAsp (ten base changes). Two anticodon loop bases of yeast tRNAAsp were also changed to those of E. coli in the event those nucleotides contribute to translation.10 Figure 1 circles the E. coli bases that were substituted into the corresponding positions of yeast tRNAAsp to create tRNAystmut6. The tRNAystmut6 gene was inserted behind the constitutive llp promoter5 of pGFIB, and a plasmid switch of pGFIBystmut6 for pSADaspwt in UVT cells was carried out as described above. Viable colonies resistant to ampicillin and sensitive to chloramphenicol were obtained. A control culture that received no tRNAAsp gene did not grow, while a control receiving pGFIBaspwt did. Figure 4 shows a Northern blot analysis of tRNAAsp produced in parental strain Kd6, in single-replacements U19-1 and T13a, in doublereplacement UV6a, and ®nally in the knockout strains, pGFIBaspwt/UVT, pSADaspwt/UVT, and pGFIBystmut6/UVT, which lack all chromosomal tRNAAsp genes. Samples were hybridized to 5 S probe and to one of two tRNAAsp probes. The probe speci®c to E. coli wild-type tRNAAsp does not hybridize to mutant tRNAystmut6 (Figure 4(a), lane 6); likewise, the probe speci®c to the tRNAystmut6 does not hybridize to E. coli wild-type tRNAAsp (Figure 4(b), lanes 1-5 and 7). This analysis con®rms that the plasmid switch has taken place and that no other E. coli tRNAAsp exists in the cell. Finally, the analysis shows that UVT cells can be supported solely by the mutant tRNAAsp produced from pGFIBystmut6. The amount of tRNAAsp produced in the various strains shown in Figure 4 was quanti®ed relative to internal standard 5 S ribosomal RNA, and nor-
Functional Analysis of a tRNA in Cells
Figure 4. Northern blot analysis of tRNAAsp produced in Kd6 parental, replacement and knockout strains. (a) Samples hybridized to aspwt probe and 5 S RNA probe. (b) Samples hybridized to ystasp probe and 5 S RNA probe. Quanti®cations are in Table 1.
malized to the values observed in the parental strain Kd6 (Table 1). The single and double replacements reduced the amount of tRNAAsp in the cell, but not enough to impair growth. The pGFIB plasmid containing either a wild-type or mutant tRNAAsp gene produces about a threefold increase in the amount of tRNAAsp relative to chromosomally derived tRNAAsp present in the parental Kd6 strain, whereas the increase in pSAD is about 1.4-fold.
Discussion We have inactivated the three tRNAAsp genes of E. coli by substituting non-functional RNA sequences on the chromosome, thereby avoiding ¯anking gene disruption and/or the introduction of antibiotic markers. The insertion of unique restriction sites enabled easy identi®cation of gene replacements by PCR blot analysis. The use of tetraloops in the tRNA anticodon allowed their identi®cation by hybridization. However, it should be noted that the hybridization signals to the tetraloop RNAs were not strong. We do not know if this reduction results from the inability of the probes to penetrate the extremely stable structure of the tetraloops and/or if the non-functional tetraloop RNAs are degraded in the cell. Viability of the UVT knockout strain lacking three functional tRNAAsp genes can be maintained with either (1) a high-copy plasmid constitutively producing wild-type tRNAAsp (pGFIB), (2) a medium-copy plasmid producing tRNAAsp under the tight control of a pBAD promoter (pSAD), or (3) a high-copy plasmid constitutively producing active mutant tRNAAsp (pGFIBystmut6). Our set of plasmids6 have the advantage of being interchangeable under appropriate growth conditions. pGFIBaspwt/UVT grows well in rich medium with
541
Functional Analysis of a tRNA in Cells
ampicillin and poorly in minimal medium. pSADaspwt/UVT, on the other hand, grows in minimal medium with chloramphenicol, but does not grow in rich medium. These characteristics allowed us to test the function of a mutant tRNAAsp by switching the plasmid carrying the mutant tRNAAsp for a maintenance plasmid carrying wildtype tRNAAsp in the UVT strain. With the system described, an in vivo structurefunction analysis of tRNAAsp is now possible. This information, in combination with crystal structures of both free and enzyme-bound forms of the tRNA and biochemical data, is capable of revealing a detailed molecular picture of the tRNAAsp-AspRS interaction.
Materials and Methods Strains and plasmids E. coli strain Kd6 is a relA derivative of strain Kdel (glyV55 (tonB trpAB17) (argF lac) U169/F0 trpA (UGA15)).11 Plasmids pGFIB5 and pSAD,6 and phagemid M13mp10::CAT3 have been described. PCR vector pCRII was purchased from Invitrogen. Liquid minimal medium Min A and Min A plates were all supplemented with MgSO4 (1 mM), B1 (4 mg mlÿ1), arginine (40 mg mlÿ1), tryptophan (40 mg mlÿ1) and glycerol (0.2 %, (v/v)). Glucose, arabinose and Casamino acids concentrations, when used, were 0.2 % (w/v) unless otherwise noted. Rich medium LB broth and plates, and 2 YT broth were used as indicated. Ampicillin and chloramphenicol concentrations were 100 mg mlÿ1 and 20 mg mlÿ1 respectively.12 Knockout strain construction The mutant tetraloop RNA genes were made as follows. A 1023 bp PCR fragment containing aspU was made from Kdel using primers aspUT-P1 (50 AAATGCGGAAGAGATAAGTGCT 30 ) and aspU-P2 (50 CGCCTG CATAAACTCTTCAACA 30 ). Similarly, a 1030 bp fragment containing aspT was made from primers aspUT-P1 (50 AAATGCGGAAGAGATAAGTGCT 30 ) and aspT-P2 (50 CAGTGCCCCTTCAAAACTAAAG 30 ). The fragments were inserted into PCR cloning vector pCRII. Using the vector's f1 origin, single-stranded U-containing DNA was made from dut, ung strain CJ236 with helper phage R408. The E. coli wild-type tRNAAsp genes were site-speci®cally altered by annealing a mutagenic oligonucleotide, extending with phage T7 polymerase and transforming the mutagenized plasmid into cells. The mutagenic oligonucleotide tetraloop sequences for aspU and aspT were, respectively, 50 CGCGACCCGGGCCCCGAAGGGCCCTATTCTAACC 30 , and 50 CGCGACCC GGTACCCGAAGGTACCTATTCTAACC 30 . The mutagenized aspT-tetra and aspU-tetra DNA fragments were removed from pCRII by a BamHI-NsiI digest and cloned into BamHI-PstI digested M13mp10::CAT. A 1102 bp mutagenized DNA fragment containing aspV-tetra was made by PCR from strain Kdel using 50 and 30 end primers aspV-P3 (50 TCGGCTTTATGGACTACGAGTT 30 ) and aspV-P4 (50 TGTCAGTTGCTGGGGAGTGTTT 30 ), and mutagenic primer asp-tetra 3 (50 CGCGACCCGGATCCCGAAGGATCCTATTCTAAC 30 ). The fragment was ®rst ligated into pCRII, then removed by SacI-NsiI digestion and recloned into the SacI-PstI sites of
M13CATmp10. Sequence-speci®c probes for aspU-tetra, aspV-tetra and aspT-tetra were, respectively, 50 CCCGG GCCCCGAAGGGC 30 , 50 CCCGGTACCCGAAGGTA 30 , and 50 CCCGGATCCCGAAGGAT 30 . Gene replacement using the M13mp10::CAT vector has been described.3 Plasmid switches UVT cells harboring maintenance plasmid pGFIBaspwt were grown overnight at 37 C in LB plus ampicillin while UVT with pSADaspwt was grown overnight at 37 C in Min A with arabinose, chloramphenicol and Casamino acids. The cells were pelleted, washed three times in an equal volume of cold sterile water, and resuspended in 1/20 volume of cold sterile water. Competent cells (20 ml) were electroporated at 2.5 kV (GIBCO BRL E. coli Pulser) and allowed to recover for 20 minutes by growing in 1 ml of SOC broth8 at 37 C. They were then pelleted and washed as before. The replacement plasmid, either pSADaspwt to replace pGFIBaspwt or pGFIBystmut6 to replace pSADaspwt, was electroporated into the competent cells as before and the cells were allowed to recover in 1 ml of SOC medium for one hour at 37 C. The cells were pelleted, and resuspended in 5 ml of medium plus the antibiotic that selects for the new plasmid. For the pSADaspwt replacement plasmid, Min A with arabinose and chloramphenicol was used. To replace pSADaspwt with pGFIBystmut6, LB plus ampicillin was used. Without a second antibiotic selecting for the original plasmid, it was lost. The cultures were grown overnight at 37 C then plated on the same agar medium. Individual colonies were tested for antibiotic resistance, ability to grow on minimal medium and LB agar plates and by a Northern blot analysis. Northern blot analysis Cells were grown to A550 0.5 in 2 x YT broth with appropriate antibiotics except pSADaspwt/UVT, which was grown in Min A containing added arabinose (0.2 % (w/v)), casamino acids and chloramphenicol. The cells (1.5 ml) were pelleted, resuspended in 0.3 M sodium acetate (pH 5), and extracted with 100 ml of acid phenol (GIBCO BRL). The aqueous phase was precipitated with ethanol, washed with 70 % (v/v) ethanol, dried and resuspended in 15 ml of TE. A 2 ml sample was mixed with 1 ml of formamide, heated at 65 for ®ve minutes and run on a 10 % (w/v) polyacrylamide/7 M urea TBE minigel at room temperature. The samples were electroblotted onto Nytran SuperCharge membrane in 1 TAE at 20V for 30 minutes.13 Membranes were hybridized overnight at 37 C in Sigma PerfectHybTM Plus buffer to 30 pmol of (50 -32P)-labeled 5 S RNA probe (50 TTCTGAGTTCGGCATGGGGT 30 ) and similarly labeled aspwt probe (50 CCCCCTGCGTGACAGGC 30 ) or ystasp probe (50 CTGGCACGTGACAGGCG 30 ). Quanti®cations were determined using a Molecular Dynamics Storm 860 instrument and ImageQuaNT 4.2a software.
Acknowledgments We thank Dino Moras for unpublished information and all members of the McClain laboratory for ongoing discussions and other contributions, Jay Schneider for mutant tRNA gene construction and Sharee Otten for
542
Functional Analysis of a tRNA in Cells
comments on the manuscript. This work was supported by US Public Health Service grant GM42123. 8.
References 1. Komine, Y., Adachi, T., Inokuchi, H. & Ozeki., H. (1990). Genomic organization and physical mapping of the transfer RNA genes in Escherichia coli K12. J. Mol. Biol. 212, 579-598. 2. Blattner, F. R., Plunkett, G., III, Bloch, C. A., Perna, N. T., Burland, V. & Riley, M. et al. (1997). The complete genome sequence of Escherichia coli K-12. Science, 277, 1453-1462. 3. Blum, P., Holzschu, D., Kwan, H.-S., Riggs, D. & Artz, S. (1989). Gene replacement and retrieval with recombinant M13mp bacteriophages. J. Bacteriol. 171, 538-546. 4. Gabriel, K. & McClain, W. H. (1999). A set of plasmids constitutively producing different RNA levels in Escherichia coli. J. Mol. Biol. 290, 385-390. 5. Masson, J.-M. & Miller, J. H. (1986). Expression of synthetic suppressor tRNA genes under the control of a synthetic promoter. Gene, 47, 179-183. 6. Gabriel, K. & McClain, W. H. (2001). Plasmid systems to study RNA function in Escherichia coli. J. Mol. Biol. 310, 543-548. 7. Guzman, L.-M., Belin, D., Carson, M. J. & Beckwith, J. (1995). Tight regulation, modulation, and high-
9. 10. 11.
12.
13.
level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177, 4121-4130. Heery, D. M., Powell, R., Gannon, F. & Dunican, L. K. (1989). Curing a plasmid from E. coli using high-voltage electroporation. Nucl. Acids Res. 17, 10131. McClain, W. H. & Foss, K. (1988). Changing the identity of a tRNA by introducing a G-U wobble pair near the 30 acceptor end. Science, 240, 793-796. Yarus, M. (1982). Translational ef®ciency of transfer RNA's: uses of an extended anticodon. Science, 218, 646-652. Gabriel, K., Schneider, J. & McClain, W. H. (1996). Functional evidence for indirect recognition of G U in tRNAAla by alanyl-tRNA synthetase. Science, 271, 195-197. Miller, J. H. (1992). Section 25, formulas and recipes, handbook. In A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Appendix B: preparation of reagents and buffers used in molecular cloning. In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Edited by J. Karn (Received 7 March 2001; received in revised form 21 May 2001; accepted 22 May 2001)
J. Mol. Biol. (2001) 310, 537±542
Construction of an Escherichia coli Knockout Strain for Functional Analysis of tRNAAsp William H. McClain* and Kay Gabriel Department of Bacteriology University of Wisconsin, 1550 Linden Drive, E. B. Fred Hall Madison, WI 53706-1567, USA
The speci®c aminoacylation of tRNA is critical for translation of the genetic code. A molecular description of aminoacylation requires knowledge of the relevant three-dimensional structures, biochemical parameters and the structure-function relationship of the synthetase and its substrate tRNA. Extensive structural and biochemical data are available on the aspartic acid system of Escherichia coli, but there is a paucity of cellular functional data. We have developed a system to overcome this de®ciency by engineering an E. coli knockout tRNAAsp strain, thereby allowing a penetrating analysis of tRNAAsp structure and function under conditions that prevail in the cell. # 2001 Academic Press
*Corresponding author
Keywords: multiple knockout; plasmid switch; tRNA; two-plasmid system; aminoacylation
Introduction Escherichia coli tRNAAsp, in both free and enzyme-complexed forms, has been studied extensively by crystallographic and biochemical methods. However, complementary in vivo studies of tRNA structure and function have been constrained because the anticodon bases are essential for aminoacylation, which precludes the use of nonsense suppressor tRNAs to study aminoacylation. We have overcome this limitation by engineering an E. coli knockout strain lacking the multiple chromosomally encoded tRNAAsp genes. Knockout cells are maintained by a plasmid carrying a wild-type tRNAAsp gene. This plasmid can be switched easily for other plasmids carrying any mutant tRNAAsp gene, thereby allowing the in vivo study of tRNA structure and function. This new information, together with crystallographic and other data, will provide a level of critical information capable of unraveling the structure-function relationship between tRNAAsp and its cognate aspartyl-tRNA synthetase (AspRS). Abbreviations used: AspRS, aspartyl-tRNA synthetase; aspwt, Escherichia coli wild-type tRNAAsp; yeast, Saccharomyces cerevisiae; UVT, inactivated forms of three E. coli tRNAAsp genes; ystwt, yeast wild-type tRNAAsp; ystmut6, yeast mutant tRNAAsp with its acceptor stem and positions 32 and 38 of the anticodon loop replaced by the corresponding E. coli nucleotides. E-mail address of the corresponding author: [email protected] 0022-2836/01/030537±6 $35.00/0
Results Inactivation of tRNA genes presents several technical challenges. Gene replacement by antibioticresistance markers is impractical when the chromosome contains multiple gene copies, and entirely deleting a chromosomal tRNA gene leaves no identi®able gene remnant to con®rm its loss. Also, gene deletion and/or insertion raise the possibility that ¯anking genes will be functionally disrupted. We therefore developed the strategy described below to replace the three chromosomal tRNAAsp gene copies with non-functional RNA genes sequences while maintaining cell viability with a plasmid-produced tRNA. E. coli contains three tRNAAsp genes1,2 that produce identical isoacceptors: aspT located at 85 minutes in rrnC, aspU at ®ve minutes in rrnH, and aspV at ®ve minutes on the chromosome in a nonrrn region. Three DNA fragments approximately 1000 base-pairs long, each containing a tRNAAsp gene, were generated by PCR from starting E. coli strain Kdel. The fragments were cloned separately into plasmid pCRII and site-speci®cally altered by the insertion of one of three tetraloops into the anticodon stem and loop, thereby inactivating tRNA function. In addition, pairs of restriction sites were placed on each side of the anticodon stem to facilitate easy con®rmation of mutants by restriction enzyme digestion of PCR products derived from chromosomal DNA. Figure 1 shows the sequence of E. coli tRNAAsp and the relevant parts of the three tetraloop constructs inserted into the respective chromosomal genes. # 2001 Academic Press
538
Functional Analysis of a tRNA in Cells
Figure 1. Wild-type tRNAAsp and anticodon tetraloop structures inserted into aspU, aspV and aspT genes. The circled bases in E. coli tRNAAsp were inserted into a yeast tRNAAsp background to create tRNAystmut6 via a synthetic gene construction. The bases in bold in the asp tetra anticodon stem sequences designate the restriction sites; arrows indicate cleavage points. The base modi®cation of mutant tRNAs was not investigated.
The PCR fragments containing the mutated genes were subcloned separately into M13mp10::CAT,3 a non-replicating gene replacement vector. E. coli strain Kd6 (a relA derivative of Kdel) was infected with M13CATmp10::aspU-tetra and plated on LB plates containing chloramphenicol to select for cells that integrated the M13 vector into the chromosome by homologous recombination. One of these merodiploids (U19, see Figure 2, lane 4) was subsequently resolved by subculturing in LB liquid medium containing 0.5 % (w/v) sodium deoxycholate, and then streaking on LB plates containing 0.3 % sodium deoxycholate. Cells in which the wild-type aspU gene had been replaced with the aspU-tetra gene were identi®ed by in situ hybridization. The presence of the singlereplacement aspU-tetra gene in strain U19-1 was con®rmed by digesting a PCR-generated chromosomal DNA fragment containing the aspU region with ApaI (Figure 2). In a similar way, aspT was replaced to give single-replacement strain T13a. A wild-type tRNAAsp gene carried on the lowcopy, temperature-sensitive maintenance plasmid pBATS4 was transformed into U19-1. The aspV gene in U19-1 was then replaced by aspV-tetra in the manner described above. The resulting strain (UV6a), which lacks functional aspU and aspV genes, was cured of the maintenance plasmid by growing at 42 C without loss of cell viability. This indicates that one of three tRNAAsp genes is suf®cient for viability. We show below (see Table 1) that the amount of tRNAAsp made in the single and double-replacement strains is in approximate proportion to the number of remaining, active tRNAAsp genes. Since the amount of wild-type tRNAAsp required for viability was unknown, we tried to inactivate the third tRNAAsp gene in cells containing various maintenance plasmids. Attempts to engineer a triple knockout strain from double-replacement
UV6a carrying different low and medium-copy plasmids were unsuccessful. However, when we transformed high-copy plasmid pGFIB5 carrying a wild-type tRNAAsp gene into strain UV6a, the ®nal chromosomal gene, aspT, was replaced successfully by aspT-tetra to give strain pGFIBaspwt/UVT, where aspwt indicates E. coli wild-type tRNAAsp, and UVT indicates inactivated forms of AspU, AspV and AspT genes in E. coli. Figure 2, lanes 6-8, show restriction enzyme digestion products of PCR fragments generated from each of the chromosomal tRNAAsp regions, and indicates that all three of the tRNAAsp genes have been replaced by tetraloop RNA sequences in the UVT knockout strain. Lanes 1-3 show the restriction enzyme digestion pattern of the three wild-type genes in the parental strain Kd6. We designed a system to investigate tRNA function by replacing the maintenance plasmid with another plasmid carrying an active yeast mutant tRNAAsp gene (tRNAystmut6; see below). This
Table 1. Level of tRNAAsp standardized to 5 S and normalized to Kd6 Name Kd6 U19-1 T13a UV6a pGFIBaspwt/UVT pGFIBystmut6/UVT pSADaspwt/UVT
E. coli tRNAAsp probe
Yeast tRNAAsp probe
1.00 0.76 0.69 0.39 3.09 0.05 1.43
0.01 0.01 0.01 0.01 0.03 3.11 0.06
The ratio shows the amount of tRNAAsp standardized to 5 S RNA in each sample relative to parental strain Kd6 also standardized to Kd6 5 S RNA ((sample tRNAAsp/sample 5 S)/(Kd6 tRNAAsp/Kd6 5 S)). A background correction was performed by subtracting an equivalent background area from the tRNA and 5 S areas before calculating the ratios.
Functional Analysis of a tRNA in Cells
Figure 2. Agarose gel of restriction enzyme digestion products of tRNAAsp and tetraloop RNA genes. Pro®le of digestion products of PCR fragments showing wildtype tRNAAsp genes from E. coli strain Kd6 (lanes 1-3), a merodiploid containing both wild-type asp and aspUtetra genes (lane 4) and tetraloop RNA genes from knockout strain UVT (lanes 6-8). Lane 5 is size markers.
strategy is more desirable than using a regulatable promoter to adjust the level of wild-type tRNA, because activity of the mutant tRNAAsp can be assessed more meaningfully in the absence of any wild-type tRNAAsp background. Initially, we avoided using pGFIB as the maintenance plasmid because of the dif®culty involved in curing highcopy plasmids. However, we later observed that cells harboring ampicillin-resistant plasmid pGFIB grow poorly on minimal medium (Figure 3),
539 whereas cells harboring medium-copy, chloramphenicol-resistant plasmid pSAD6 grow well on minimal medium. This difference in growth properties, together with the fact that the araCpBAD promoter of pSAD can be induced by arabinose and repressed by glucose,7 and the observation that electroporated bacterial cells lose many of their resident plasmids,8 formed the basis of our strategy for switching plasmids. To test the plasmid-switching system, we ®rst attempted to exchange plasmids carrying wildtype tRNAAsp genes. Competent pGFIBaspwt/ UVT cells were ®rst electroporated to reduce the amount of resident pGFIBaspwt plasmid in the cells. The electroporated cells were allowed to recover for a short time, then again made competent and electroporated a second time with pSAD plasmid carrying an E. coli wild-type tRNAAsp gene. The cells were grown in minimal medium with arabinose and chloramphenicol overnight. A10ÿ6 dilution examined on spread plates revealed colonies on minimal medium but not on rich medium. The minimal medium colonies were picked and streaked on both minimal medium plates containing either arabinose or glucose as the carbon source and on LB plates. The cells grew on arabinose plates, where the gene for wild-type tRNAAsp is expressed from pSADaspwt, but not on either glucose plates or LB rich medium plates, where the gene is repressed. These results indicated that the pGFIB plasmid had been lost and that the pSADaspwt gene was supplying the sole source of tRNAAsp. The UVT identity of the cells was subsequently con®rmed by PCR analysis. Figure 3 shows streak plates of parental strain Kd6 and
Figure 3. Streak plates of parental strain Kd6 and tRNAAsp knockout derivatives. Strains Kd6 and pGFIBaspwt/UVT were each grown overnight at 37 C in LB and Min A supplemented with arabinose, Casamino acids and the appropriate antibiotic as described in Materials and Methods. Strain pSADaspwt/UVT was grown only in the Min A medium. One ml of each culture was pelleted and washed with Min A without supplements. The washed cells were resuspended in 1 ml of Min A without supplements and streaked on plates without antibiotics. The LB plate and Min A plates containing Casamino acids were incubated at 37 C for 20 hours, while the plates without casamino acids were incubated 24 hours.
540 of knockout strain UVT with pGFIBaspwt or pSADaspwt maintenance plasmids. We next demonstrated that a yeast (Saccharomyces cerevisiae) mutant tRNAAsp (tRNAystmut6) that is active in E. coli and carried by pGFIB could be switched for the pSADaspwt maintenance plasmid by reversing the above medium conditions. That is, we electroporated the pGFIB plasmid carrying the yeast mutant tRNA gene into pSADaspwt/UVT cells as described above, then grew the cells overnight in rich medium containing ampicillin but not chloramphenicol. Since the wildtype tRNAAsp gene is not expressed under these conditions, cell viability depended on the mutant tRNAAsp; the absence of chloramphenicol resulted in loss of the pSADaspwt plasmid. We made the tRNAystmut6 gene by synthetically constructing9 a gene containing the yeast tRNAAsp backbone but with 12 bases altered to match those of E. coli tRNAAsp. Yeast tRNAAsp is not aminoacylated in vitro by E. coli AspRS . However, replacing the two terminal base-pairs in the acceptor stem of yeast tRNAAsp with their E. coli counterparts improves in vitro aminoacylation (Dino Moras, personal communication). Not knowing the in vivo requirements of E. coli AspRS, we substituted E. coli bases at all positions in the acceptor stem that differ from those of yeast tRNAAsp (ten base changes). Two anticodon loop bases of yeast tRNAAsp were also changed to those of E. coli in the event those nucleotides contribute to translation.10 Figure 1 circles the E. coli bases that were substituted into the corresponding positions of yeast tRNAAsp to create tRNAystmut6. The tRNAystmut6 gene was inserted behind the constitutive llp promoter5 of pGFIB, and a plasmid switch of pGFIBystmut6 for pSADaspwt in UVT cells was carried out as described above. Viable colonies resistant to ampicillin and sensitive to chloramphenicol were obtained. A control culture that received no tRNAAsp gene did not grow, while a control receiving pGFIBaspwt did. Figure 4 shows a Northern blot analysis of tRNAAsp produced in parental strain Kd6, in single-replacements U19-1 and T13a, in doublereplacement UV6a, and ®nally in the knockout strains, pGFIBaspwt/UVT, pSADaspwt/UVT, and pGFIBystmut6/UVT, which lack all chromosomal tRNAAsp genes. Samples were hybridized to 5 S probe and to one of two tRNAAsp probes. The probe speci®c to E. coli wild-type tRNAAsp does not hybridize to mutant tRNAystmut6 (Figure 4(a), lane 6); likewise, the probe speci®c to the tRNAystmut6 does not hybridize to E. coli wild-type tRNAAsp (Figure 4(b), lanes 1-5 and 7). This analysis con®rms that the plasmid switch has taken place and that no other E. coli tRNAAsp exists in the cell. Finally, the analysis shows that UVT cells can be supported solely by the mutant tRNAAsp produced from pGFIBystmut6. The amount of tRNAAsp produced in the various strains shown in Figure 4 was quanti®ed relative to internal standard 5 S ribosomal RNA, and nor-
Functional Analysis of a tRNA in Cells
Figure 4. Northern blot analysis of tRNAAsp produced in Kd6 parental, replacement and knockout strains. (a) Samples hybridized to aspwt probe and 5 S RNA probe. (b) Samples hybridized to ystasp probe and 5 S RNA probe. Quanti®cations are in Table 1.
malized to the values observed in the parental strain Kd6 (Table 1). The single and double replacements reduced the amount of tRNAAsp in the cell, but not enough to impair growth. The pGFIB plasmid containing either a wild-type or mutant tRNAAsp gene produces about a threefold increase in the amount of tRNAAsp relative to chromosomally derived tRNAAsp present in the parental Kd6 strain, whereas the increase in pSAD is about 1.4-fold.
Discussion We have inactivated the three tRNAAsp genes of E. coli by substituting non-functional RNA sequences on the chromosome, thereby avoiding ¯anking gene disruption and/or the introduction of antibiotic markers. The insertion of unique restriction sites enabled easy identi®cation of gene replacements by PCR blot analysis. The use of tetraloops in the tRNA anticodon allowed their identi®cation by hybridization. However, it should be noted that the hybridization signals to the tetraloop RNAs were not strong. We do not know if this reduction results from the inability of the probes to penetrate the extremely stable structure of the tetraloops and/or if the non-functional tetraloop RNAs are degraded in the cell. Viability of the UVT knockout strain lacking three functional tRNAAsp genes can be maintained with either (1) a high-copy plasmid constitutively producing wild-type tRNAAsp (pGFIB), (2) a medium-copy plasmid producing tRNAAsp under the tight control of a pBAD promoter (pSAD), or (3) a high-copy plasmid constitutively producing active mutant tRNAAsp (pGFIBystmut6). Our set of plasmids6 have the advantage of being interchangeable under appropriate growth conditions. pGFIBaspwt/UVT grows well in rich medium with
541
Functional Analysis of a tRNA in Cells
ampicillin and poorly in minimal medium. pSADaspwt/UVT, on the other hand, grows in minimal medium with chloramphenicol, but does not grow in rich medium. These characteristics allowed us to test the function of a mutant tRNAAsp by switching the plasmid carrying the mutant tRNAAsp for a maintenance plasmid carrying wildtype tRNAAsp in the UVT strain. With the system described, an in vivo structurefunction analysis of tRNAAsp is now possible. This information, in combination with crystal structures of both free and enzyme-bound forms of the tRNA and biochemical data, is capable of revealing a detailed molecular picture of the tRNAAsp-AspRS interaction.
Materials and Methods Strains and plasmids E. coli strain Kd6 is a relA derivative of strain Kdel (glyV55 (tonB trpAB17) (argF lac) U169/F0 trpA (UGA15)).11 Plasmids pGFIB5 and pSAD,6 and phagemid M13mp10::CAT3 have been described. PCR vector pCRII was purchased from Invitrogen. Liquid minimal medium Min A and Min A plates were all supplemented with MgSO4 (1 mM), B1 (4 mg mlÿ1), arginine (40 mg mlÿ1), tryptophan (40 mg mlÿ1) and glycerol (0.2 %, (v/v)). Glucose, arabinose and Casamino acids concentrations, when used, were 0.2 % (w/v) unless otherwise noted. Rich medium LB broth and plates, and 2 YT broth were used as indicated. Ampicillin and chloramphenicol concentrations were 100 mg mlÿ1 and 20 mg mlÿ1 respectively.12 Knockout strain construction The mutant tetraloop RNA genes were made as follows. A 1023 bp PCR fragment containing aspU was made from Kdel using primers aspUT-P1 (50 AAATGCGGAAGAGATAAGTGCT 30 ) and aspU-P2 (50 CGCCTG CATAAACTCTTCAACA 30 ). Similarly, a 1030 bp fragment containing aspT was made from primers aspUT-P1 (50 AAATGCGGAAGAGATAAGTGCT 30 ) and aspT-P2 (50 CAGTGCCCCTTCAAAACTAAAG 30 ). The fragments were inserted into PCR cloning vector pCRII. Using the vector's f1 origin, single-stranded U-containing DNA was made from dut, ung strain CJ236 with helper phage R408. The E. coli wild-type tRNAAsp genes were site-speci®cally altered by annealing a mutagenic oligonucleotide, extending with phage T7 polymerase and transforming the mutagenized plasmid into cells. The mutagenic oligonucleotide tetraloop sequences for aspU and aspT were, respectively, 50 CGCGACCCGGGCCCCGAAGGGCCCTATTCTAACC 30 , and 50 CGCGACCC GGTACCCGAAGGTACCTATTCTAACC 30 . The mutagenized aspT-tetra and aspU-tetra DNA fragments were removed from pCRII by a BamHI-NsiI digest and cloned into BamHI-PstI digested M13mp10::CAT. A 1102 bp mutagenized DNA fragment containing aspV-tetra was made by PCR from strain Kdel using 50 and 30 end primers aspV-P3 (50 TCGGCTTTATGGACTACGAGTT 30 ) and aspV-P4 (50 TGTCAGTTGCTGGGGAGTGTTT 30 ), and mutagenic primer asp-tetra 3 (50 CGCGACCCGGATCCCGAAGGATCCTATTCTAAC 30 ). The fragment was ®rst ligated into pCRII, then removed by SacI-NsiI digestion and recloned into the SacI-PstI sites of
M13CATmp10. Sequence-speci®c probes for aspU-tetra, aspV-tetra and aspT-tetra were, respectively, 50 CCCGG GCCCCGAAGGGC 30 , 50 CCCGGTACCCGAAGGTA 30 , and 50 CCCGGATCCCGAAGGAT 30 . Gene replacement using the M13mp10::CAT vector has been described.3 Plasmid switches UVT cells harboring maintenance plasmid pGFIBaspwt were grown overnight at 37 C in LB plus ampicillin while UVT with pSADaspwt was grown overnight at 37 C in Min A with arabinose, chloramphenicol and Casamino acids. The cells were pelleted, washed three times in an equal volume of cold sterile water, and resuspended in 1/20 volume of cold sterile water. Competent cells (20 ml) were electroporated at 2.5 kV (GIBCO BRL E. coli Pulser) and allowed to recover for 20 minutes by growing in 1 ml of SOC broth8 at 37 C. They were then pelleted and washed as before. The replacement plasmid, either pSADaspwt to replace pGFIBaspwt or pGFIBystmut6 to replace pSADaspwt, was electroporated into the competent cells as before and the cells were allowed to recover in 1 ml of SOC medium for one hour at 37 C. The cells were pelleted, and resuspended in 5 ml of medium plus the antibiotic that selects for the new plasmid. For the pSADaspwt replacement plasmid, Min A with arabinose and chloramphenicol was used. To replace pSADaspwt with pGFIBystmut6, LB plus ampicillin was used. Without a second antibiotic selecting for the original plasmid, it was lost. The cultures were grown overnight at 37 C then plated on the same agar medium. Individual colonies were tested for antibiotic resistance, ability to grow on minimal medium and LB agar plates and by a Northern blot analysis. Northern blot analysis Cells were grown to A550 0.5 in 2 x YT broth with appropriate antibiotics except pSADaspwt/UVT, which was grown in Min A containing added arabinose (0.2 % (w/v)), casamino acids and chloramphenicol. The cells (1.5 ml) were pelleted, resuspended in 0.3 M sodium acetate (pH 5), and extracted with 100 ml of acid phenol (GIBCO BRL). The aqueous phase was precipitated with ethanol, washed with 70 % (v/v) ethanol, dried and resuspended in 15 ml of TE. A 2 ml sample was mixed with 1 ml of formamide, heated at 65 for ®ve minutes and run on a 10 % (w/v) polyacrylamide/7 M urea TBE minigel at room temperature. The samples were electroblotted onto Nytran SuperCharge membrane in 1 TAE at 20V for 30 minutes.13 Membranes were hybridized overnight at 37 C in Sigma PerfectHybTM Plus buffer to 30 pmol of (50 -32P)-labeled 5 S RNA probe (50 TTCTGAGTTCGGCATGGGGT 30 ) and similarly labeled aspwt probe (50 CCCCCTGCGTGACAGGC 30 ) or ystasp probe (50 CTGGCACGTGACAGGCG 30 ). Quanti®cations were determined using a Molecular Dynamics Storm 860 instrument and ImageQuaNT 4.2a software.
Acknowledgments We thank Dino Moras for unpublished information and all members of the McClain laboratory for ongoing discussions and other contributions, Jay Schneider for mutant tRNA gene construction and Sharee Otten for
542
Functional Analysis of a tRNA in Cells
comments on the manuscript. This work was supported by US Public Health Service grant GM42123. 8.
References 1. Komine, Y., Adachi, T., Inokuchi, H. & Ozeki., H. (1990). Genomic organization and physical mapping of the transfer RNA genes in Escherichia coli K12. J. Mol. Biol. 212, 579-598. 2. Blattner, F. R., Plunkett, G., III, Bloch, C. A., Perna, N. T., Burland, V. & Riley, M. et al. (1997). The complete genome sequence of Escherichia coli K-12. Science, 277, 1453-1462. 3. Blum, P., Holzschu, D., Kwan, H.-S., Riggs, D. & Artz, S. (1989). Gene replacement and retrieval with recombinant M13mp bacteriophages. J. Bacteriol. 171, 538-546. 4. Gabriel, K. & McClain, W. H. (1999). A set of plasmids constitutively producing different RNA levels in Escherichia coli. J. Mol. Biol. 290, 385-390. 5. Masson, J.-M. & Miller, J. H. (1986). Expression of synthetic suppressor tRNA genes under the control of a synthetic promoter. Gene, 47, 179-183. 6. Gabriel, K. & McClain, W. H. (2001). Plasmid systems to study RNA function in Escherichia coli. J. Mol. Biol. 310, 543-548. 7. Guzman, L.-M., Belin, D., Carson, M. J. & Beckwith, J. (1995). Tight regulation, modulation, and high-
9. 10. 11.
12.
13.
level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177, 4121-4130. Heery, D. M., Powell, R., Gannon, F. & Dunican, L. K. (1989). Curing a plasmid from E. coli using high-voltage electroporation. Nucl. Acids Res. 17, 10131. McClain, W. H. & Foss, K. (1988). Changing the identity of a tRNA by introducing a G-U wobble pair near the 30 acceptor end. Science, 240, 793-796. Yarus, M. (1982). Translational ef®ciency of transfer RNA's: uses of an extended anticodon. Science, 218, 646-652. Gabriel, K., Schneider, J. & McClain, W. H. (1996). Functional evidence for indirect recognition of G U in tRNAAla by alanyl-tRNA synthetase. Science, 271, 195-197. Miller, J. H. (1992). Section 25, formulas and recipes, handbook. In A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Appendix B: preparation of reagents and buffers used in molecular cloning. In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Edited by J. Karn (Received 7 March 2001; received in revised form 21 May 2001; accepted 22 May 2001)