Corrigendum to “TRPC3 channels critically regulate hippocampal excitability and contextual fear memory” Behav. Brain Res. 281(March) 2015, 69–77

Corrigendum to “TRPC3 channels critically regulate hippocampal excitability and contextual fear memory” Behav. Brain Res. 281(March) 2015, 69–77

Behavioural Brain Research xxx (xxxx) xxx–xxx Contents lists available at ScienceDirect Behavioural Brain Research journal homepage: www.elsevier.co...

88KB Sizes 4 Downloads 67 Views

Behavioural Brain Research xxx (xxxx) xxx–xxx

Contents lists available at ScienceDirect

Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr

Corrigendum

Corrigendum to “TRPC3 channels critically regulate hippocampal excitability and contextual fear memory” Behav. Brain Res. 281(March) 2015, 69–77 Sarah M. Neunera, Lynda A. Wilmotta, Kevin A. Hopea, Brian Hoffmannb, Jayhong A. Chongc, Joel Abramowitzd, Lutz Birnbaumerd, Kristen O’Connelle, Andrew K. Trybaf, Andrew S. Greeneb,g, ⁎ C.Savio Chanh, Catherine C. Kaczorowskia, a

Dept. of Anatomy and Neurobiology, The University of Tennessee Health Science Center, Memphis, TN, United States Dept. of Biotechnology and Bioengineering, Medical College of Wisconsin, Milwaukee, WI, United States Hydra Biosciences, Cambridge, MA,United States d Laboratory of Neurobiology, National Institute of Environmental Health Sciences, Research Triangle Park, NC, United States e Dept. of Physiology, The University of Tennessee Health Science Center, Memphis, TN, United States f Dept. of Pediatrics, The University of Chicago, Chicago, IL, United States g Dept. of Physiology, Medical College of Wisconsin, Milwaukee, WI, United States h Dept. of Physiology, Northwestern Fienberg School of Medicine, Chicago, IL, United States b c

The authors regret that numerical errors occurred in the 4th paragraph of the results section. Specifically, in the following sentences, where the corrections have been underlined:

• (Fig. 3A : FC memory index; 55.6 ± 4.79% freezing, n = 7 mice) • …as well as naïve untrained controls (n = 7 mice) • [Fig. 3B: one-way ANOVA F(2,21) = 4.6, p = 0.02 (one-tailed) with post-hoc tests comparing FC relative to ISD (p = 0.004) and naïve cage controls (p = 0.05)]

The authors have revised Fig. 3 caption to reflect these above changes; specifically, in the following sentences, where the corrections have been underlined:

• (A) …(memory index; 55.6 ± 4.79% freezing, n = 7 mice) • (B) …(Cntl; n = 7 mice) and ISD controls [One-way ANOVA F •

(2,21) = 4.6, p = 0.02 with post-hoc tests comparing FC relative to ISD (p = 0.004) and naïve cage controls (p = 0.05)] Additionally, the authors have revised the corresponding figure (Fig. 3A & B) to reflect these changes.

In addition, a nucleotide was omitted from the sequence of mTrpC3 shRNA in the methods section of the manuscript. The sequence of mTrpC3 shRNA is GAGGUUCAAUAUUUCACCUAUGC The authors would like to apologise for any inconvenience caused.

DOI of original article: http://dx.doi.org/10.1016/j.bbr.2014.12.018 ⁎ Corresponding author. E-mail address: [email protected] (C.C. Kaczorowski). http://dx.doi.org/10.1016/j.bbr.2017.05.038

0166-4328/

Please cite this article as: Kaczorowski, C.C., Behavioural Brain Research (2017), http://dx.doi.org/10.1016/j.bbr.2017.05.038