CXCL14 expression suppresses tumor growth in vivo in human oral carcinoma cells

BBRC Biochemical and Biophysical Research Communications 348 (2006) 406–412 www.elsevier.com/locate/ybbrc

BRAK/CXCL14 expression suppresses tumor growth in vivo in human oral carcinoma cells Shigeyuki Ozawa

a,b,c

, Yasumasa Kato a,c, Reika Komori a,c, Yojiro Maehata Eiro Kubota b,c, Ryu-Ichiro Hata a,c,*

a,c

,

a

c

Department of Biochemistry and Molecular Biology, 82 Inaoka-cho, Yokosuka, 238-8580, Japan b Department of Oral and Maxillofacial Surgery, 82 Inaoka-cho, Yokosuka, 238-8580, Japan Oral Health Science Research Center, Kanagawa Dental College, 82 Inaoka-cho, Yokosuka, 238-8580, Japan Received 17 June 2006 Available online 24 July 2006

Abstract In order to find a suppressor(s) of tumor progression in vivo for oral carcinoma (OC), we searched for molecules down-regulated in OC cells when the cells were treated with epidermal growth factor (EGF), whose receptor is frequently over-activated in OC. The expression of BRAK, which is also known as CXC chemokine ligand14 (CXCL14), was down-regulated significantly by the treatment of OC cells with EGF as observed by cDNA microarray analysis followed by reverse-transcriptase polymerase chain reaction analysis. The EGF effect was attenuated by the co-presence of a MEK inhibitor. The rate of tumor formation in vivo of BRAK-expressing vectortransfected tumor cells in athymic nude mice was significantly lower than that of mock vector-transfected ones. In addition tumors formed in vivo by the BRAK-expressing cells were significantly smaller than those of the mock-transfected ones. These results indicate that BRAK/CXCL14 is a chemokine, having suppressive activity toward tumor progression of OC in vivo.  2006 Elsevier Inc. All rights reserved. Keywords: BRAK; CXCL14; Tumor suppression; Squamous cell carcinoma; Oral carcinoma; Epidermal growth factor; Epidermal growth factor receptor

Oral squamous cell carcinoma is the most common malignant neoplasm arising in the mucosa of the upper aerodigestive tract. It is an aggressive tumor that is difficult to treat with conventional therapies, including chemotherapy, radiation, and surgery [1]. Because surgical treatment often affects profoundly the quality of life and activities of daily living of the affected patients with OC, and thus new therapeutic strategies are necessary along with the other conventional therapy. OC progresses by a multi-step process similar to that shown in other human cancers [2]; and cell to cell and cell to extracellular matrix interactions are important for the nature, progression, and invasion of these carcinomas in vivo [2–8].

*

Corresponding author. Fax: +81 46 822 8839. E-mail address: [email protected] (R. Hata).

0006-291X/$ - see front matter  2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.07.070

Over-activation of the epidermal growth factor (EGF) receptor (EGFR) is frequently observed in many epithelial tumors including OC, and clinical studies have indicated its importance in tumor etiology, progression, and prognosis [9–16]. Thus therapies targeting the EGFR have been the most commonly studied [17–19]. EGFR signaling is essential for processes ranging from cell division to death, and cell motility to adhesion, as well as for organogenesis including craniofacial development in vivo [20,21]. Thus careful consideration is necessary for effective application of EGFR inhibitors [22]. In order to find a new molecular target(s) for treatment of progression of OC, we investigated molecules downstream signaling of EGFR. At least four EGFRs, ErbB1 to ErbB4 or Her1 to Her4, have been reported; and among their versatile ligands, such as EGF, tumor growth factor-a (TGF-a), epiregulin, amphiregulin, heparin binding-EGF, and neuregulins, EGF can activate signaling of all four

S. Ozawa et al. / Biochemical and Biophysical Research Communications 348 (2006) 406–412

EGFRs [23,24]. TGF-a but EGF might be a ligand for EGFRs in vivo in OC patients [9,10], but EGF activates all four EGFRs, ErbB1 to ErbB4 [24]; and thus we employed EGF to screen for target molecules of EGFR signaling. When we treated OC cells with EGF to mimic the aggressive phase of cancer progression and surveyed molecules down-regulated by the treatment, those molecules might have tumor-suppressing activities under normal conditions. DNA microarray analysis followed by reverse transcriptase-polymerase chain reaction (RT-PCR) showed significant down-regulation of BRAK, also known as chemokine CXCL14 [25,26], in addition to up-regulation of several genes including the gene for vimentin, an intermediate filament protein. Chemokines are a group of small proteins, with molecular weights in the range of 8–12 K, mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interaction with a subset of seven-transmembrane, G protein-coupled receptors [27–30]. Chemokine domains are defined by the presence of 4 conserved cysteine residues linked by 2 disulfide bonds. Two major subfamilies, CXC and CC chemokines, are distinguished according to the position of the first 2 cysteine residues, which are separated by 1 amino acid (CXC subfamily) or are adjacent to each other (CC subfamily). BRAK/CXCL14 was first reported to be expressed in breast and kidney but later was found in many other normal cells and tissues but absent in transformed cells and cancerous tissues including oral carcinoma [25,26], indicating it to be a candidate gene having tumor-suppressing activity. When a BRAK expression vector was introduced into HSC-3 OC cells [31], the growth was not decreased under in vitro culture conditions compared with that of vector-transfected cells, but the suppression rate of BRAKexpressing vector-transfected tumor cells was significantly higher than that of mock vector-transfected ones and the growth of the tumor cells in vivo was suppressed when BRAK-expressing cells were injected subcutaneously into athymic mice. These results suggest that BRAK/CXCL14 is a tumor-suppressing chemokine in vivo. Materials and methods Cell and cell culture. Squamous cell carcinoma cell line HSC-3, derived from the tongue of male patient [31], was provided from Japanese Collection of Research Bioresources (JCRB) Cell Bank (#JCRB0623). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Nissui Seiyaku, Tokyo, Japan) containing gentamicin sulfate (50 mg/l, Wako Pure Chemical Industries, Osaka, Japan), Fungizone (250 lg/l, Invitrogen Japan, Tokyo), and N-2-hydroxyethylpiperazine-N 0 -2-ethanesulfonic acid (3 g/l, Wako) referred to as DMEM-0. The medium was also supplemented with 10% fetal bovine serum (FBS, Thermo Electron, Melbourne, Australia) and called DMEM-10. The cells were cultured at 37 C under 95% air and 5% CO2 and routinely passaged by treatment with 0.1% trypsin (Trypsin 250, Wako)/1 mM EDTA (Wako) in Dulbecco’s Mg2+–Ca2+-free phosphate-buffered saline (DPBS (-), TAKARA BIO, Otsu, Japan). For EGF treatment, cells (1 · 106/60 mm-dish) were inoculated in DMEM-10, cultured for 24 h, and then incubated for 5 min

407

to 24 h with or without human EGF (final concentration, 10 ng/ml, Wako) after 24 h of serum starvation. The cells were also cultured in the presence of a MEK inhibitor (PD98059, Calbiochem, La Jolla, CA, USA) used at a final concentration of 50 lM, which was added 1 h before addition of EGF. cDNA microarray analysis. Total RNA was extracted with TRIzol reagent (Invitrogen) from cells treated with EGF for 24 h and untreated cells and fluorescent cDNAs were prepared separately by a single round of reverse transcription in the presence of fluorescent Cy3-deoxy UTP for EGF-treated cells and Cy5-deoxy UTP for untreated ones. Cy3-deoxy UTP- and Cy5-deoxy UTP-labeled cDNAs were mixed and hybridized with IntelliGene Human Cytokine CHIP Ver. 3.0 (TAKARA). cDNA microarray analysis was performed according to the manufacturer’s protocol. The same experiment was repeated by reversing the labels, i.e., using Cy5-deoxy UTP for EGF-treated cells and Cy3-deoxy UTP for the untreated ones. The hybridized chips were analyzed by ScanArray 4000 (Perkin-Elmer, Wellesle, MA, USA) as described previously [32]. Changes in spot intensities higher than 2 or less than 0.5 were regarded as significant in this system. RT-PCR analysis. Total RNA was extracted by using TRIzol reagent. An aliquot of each sample was denatured and reverse transcribed by using a SuperScript First-strand Synthesis System (Invitrogen) according to the manufacturer’s protocols. Aliquots (5%) of the total cDNA were amplified by each PCR in a 20-ll reaction mixture that contained 5 pmol of each of 5 0 and 3 0 primers, 1· PCR buffer, 1.5 mM MgCl2, a 0.2 mM concentration of each deoxy trinucleotide, and 0.5 U Taq polymerase (EX Taq, TAKARA). Each cDNA sample was run in duplicate for every PCR, as described previously [33]. The amplification primers for BRAK were hBRAKS1, 5 0 -AA TGAAGCCAAAGTACCCGC-3 0 (forward) and hBRAKA2, 5 0 -AGTCC TTTGCACAAGTCTCC-3 0 (reverse), which yielded a 232 bp product for the endogenous mRNA. Those for b-actin, hb-actinS1, 5 0 -AGCCATGT ACGTTGCTA-3 0 (forward) and hb-actinA2, 5 0 -AGTCCGCCTAGA AGCA-3 0 (reverse), yielded a 745 bp product. For vimentin hVimentinS1, CAGCTAACCAACGACAAAGC, and hVimentinA2, TATTCACG AAGGTGACGAGC, primers were employed to amplify a 664-bp product. In some experiments, PCR templates were diluted in 2-fold steps prior to being amplified. Amplifications were performed in a Mastercycler gradient device (Eppendorf-Netheler-Hinz GmbH, Hamburg, Germany) after an initial denaturation at 94 C for 2 min. Expression of b-actin mRNA was used as an internal standard. PCR conditions were as follows: 23–28 cycles for BRAK, 17 cycles for b-actin, and 20 cycles for vimentin, at 94 C for 30 s, 58 C (BRAK) or 60 C (b-actin and vimentin) for 40 s, and 72 C for 40 s. All the reaction mixtures were incubated at 72 C for 10 min before being stored at 4 C. The PCR products were separated on agarose gels and visualized by ethidium bromide staining as described [33]. Western blot analysis. Serum-free conditioned medium was dialyzed against Milli Q (Millipore, Tokyo)-treated water at 4 C, and proteins were concentrated by freeze-drying. Western blot analysis was performed as reported previously [34,35]. After electrophoresis on an SDS-10% polyacrylamide gel, the proteins were transferred onto an Immobilon-P membrane at a constant voltage of 50 V for 2 h. After having been blocked with 20% N102 blocking reagent (NOF Corp. Tokyo, Japan) in TBS-T solution [20 mM Tris–HCl (pH 7.6), 137 mM NaCl, and 0.05% Tween 20], the membrane was incubated 16 h at 4 C with anti-BRAK polyclonal antibody (R&D systems, Minneapolis, MN, USA), as a primary antibody in TBS-T solution containing 20% N102 blocking reagent, and for 20 min at 37 C with biotin-conjugated swine anti-goat IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA) as the secondary antibody. Finally, after a 20-min incubation at 37 C with horseradish peroxidase-conjugated streptavidin (Santa Cruz), the immunoreactive bands were visualized by using an Immunostar chemiluminescence assay kit (Wako). Construction and transfection of BRAK-expression vector and cloning of BRAK-expressing cells. Total RNA was extracted from HSC-3 cells and then reverse transcribed to cDNA. The full-length cDNA of BRAK was amplified by PCR with a BRAK-specific primer set (forward: hBRAKS3, 5 0 -ATGAGGCTCCTGGCGGCC-3 0 and reverse: hBRAKA4, 5 0 -TTAAT CTGCAAAGTCCTTTGC-3 0 ) and Phusion High-Fidelity DNA Polymerase (New England BioLabs, MA, USA) and directly ligated with

408

S. Ozawa et al. / Biochemical and Biophysical Research Communications 348 (2006) 406–412

pTARGET Mammalian Expression Vector System (Promega, Tokyo, Japan) and cloned by TA cloning strategy (pCL-BRAK). The sense orientation and sequences of vectors were confirmed by DNA sequencing. HSC-3 cells (3 · 105/35 mm dish) were transfected with pCL-BRAK or empty vector (Mock) by use of Lipofectamine (Invitrogen), and stable transformants were selected by culturing the cells in DMEM-10 containing 400 lg/ml G418 (Sigma, Tokyo, Japan) until all non-transfected cells had died. To confirm the expression of BRAK protein by the transfected pCLBRAK vector, we detected BRAK protein by western blotting using the anti-BRAK polyclonal antibody as described above (data not shown). G418-resistant BRAK-expressing cells were cloned according to limiting dilution method [33]. Expression of BRAK was confirmed by RT-PCR and western blotting. These cloned cells expressed 10 times higher amount of BRAK mRNA and protein than mock transfected cells (data not shown). Determination of cell growth rate in vitro and tumor growth in vivo. BRAK-expressing-transfectants and their clones and Mock-transfectants were inoculated (2 · 104 cells per 35 mm dish) in DMEM-10 and cultured. Cell numbers were counted by a Coulter Z1 Counter (Coulter Electronics Ltd., England) after trypsinization [33]. In the case of in vivo experiments, BRAK-expressing-transfectants or Mock-transfected cells were injected subcutaneously at 5 · 106/site into both sides of dorso-lateral region of 10 female athymic nude mice (BALB/cAJcl-nu/nu, Clea Japan, Tokyo) per group. Tumor volume was calculated according to the following formula: (a · b2)/2, where a is the longer and b is the smaller dimension [36]. Statistical analyses. The v2 test and Student’s t-test were used to obtain statistically significant differences between 2 groups, with P < 0.05 being considered statistically significant.

Results and discussion Identification of downstream targets of epidermal growth factor receptor signaling in HSC-3 cells To find new targets of the EGF receptor signaling, we performed cDNA microarray analysis to profile EGF-modulated genes in serum-starved HSC-3 cells. The EGF concentration was fixed at 10 ng/ml based on its inducibility of MMP-9 expression and cell proliferation (data not shown). The results of cDNA microarray analysis showed that the most significant change observed was in BRAK/ CXCL14. BRAK mRNA was down-regulated to 0.22 ± 0.07 by the EGF treatment. On the other hand, the expression of vimentin was increased to 3.2 ± 0.7. RTPCR analysis using two-step dilution of cDNA template also supported these results (Fig. 1). Here we employed HSC-3 cells as a representative cell line, because they are frequently used as OC cells and also the cells are commercially obtainable, so that other groups will be able to repeat our experiment easily. When we tested 19 cell lines derived from OC, 7 of them expressed BRAK mRNA in our PCR conditions, even though the levels were similar to or lower than those of normal cells, and the expression levels were down-regulated by EGF treatment in all 7 cells (Y. Kato et al., unpublished data). These results suggest that down-regulation of BRAK expression by EGF is a common feature of OC cells. Time course of the effect of EGF on the expression of BRAK mRNA and ERK activation EGFR signaling is mainly transduced by the MAP kinase cascade, i.e., Raf/MEK/ERK. In order to examine

Fig. 1. Effect of EGF on the mRNA levels of BRAK and vimentin in the presence or absence of a MEK inhibitor. (A) HSC-3 cells were cultured in DMEM-0 in the presence or absence of EGF (10 ng/ml) for 24 h; and mRNA levels for BRAK, vimentin, and b-actin (internal standard) were then determined by RT-PCR. The PCR templates were diluted 2-fold steps, amplified, and separated on agarose gel electrophoresis to be visualized by ethidium bromide staining. An EGF-mediated decrease in the level of BRAK mRNA and an increase in that of vimentin mRNA were observed. (B) The cells were cultured in the presence or absence of EGF (10 ng/ml) with or without pretreatment with 50 lM PD98059 (MEK inhibitor).

the nature of the intracellular EGFR signaling, we pretreated the cells with a MEK kinase inhibitor (PD98059). It attenuated the EGF effect on the mRNA expression of both BRAK and vimentin (Fig. 1B). In addition, treatment with PD98059 alone increased BRAK mRNA expression and decreased vimentin mRNA expression, suggesting that the expression of both BRAK and vimentin was regulated by MEK (Fig. 1B). Time-course analysis of the expression of the BRAK mRNA level revealed that EGF down-regulated it at 3 h and later after the start of treatment (Fig. 2A). Phosphorylated form of ERK2 (active form) was observed 10–30 min after the EGF treatment, even though levels of non-active, non-phosphorylated ERK2 were fairly constant (Fig. 2B). Co-presence of PD98059 together with EGF abrogated the EGF effects (data not shown), suggesting that the BRAK mRNA level was regulated by the MEK/ERK2 cascade. Growth of BRAK vector-transfected cells in vitro and in vivo In preliminary experiments, when we injected G-418-resistant population of pCL-BRAK-transfected and Mocktransfected HSC-3 cells into dorso-lateral region of the skin

S. Ozawa et al. / Biochemical and Biophysical Research Communications 348 (2006) 406–412

Fig. 2. Time-dependent effect of EGF on BRAK mRNA level (A) and ERK activation (B). HSC-3 cells were incubated with DMEM-0 and treated with EGF (10 ng/ml) for 5 min to 24 h, and mRNA levels for BRAK and b-actin (internal standard) were determined by RT-PCR. Levels of total ERKs and the activated form of ERKs (P-ERKs) were determined by western blotting after separation by gel electrophoresis.

Fig. 3. Growth curves of BRAK and Mock-transfected HSC-3 cells. The three highest BRAK protein-expressing cell clones (BRAK 1, 3, and 4; closed symbols) and Mock vector-transfected cells (Mock, open circles) were inoculated into (2 · 104/35 mm dish) and grown in DMEM-10. Cell numbers were counted after dispersion with trypsin. Values are means of duplicate counting using 3 dishes.

of athymic mice, a significantly smaller number of tumors were formed by the pCL-BRAK-transfected cells than by the Mock-transfected ones. However, some of the tumors arising from the pCL-BRAK-transfected cells remained (data not shown), suggesting that the pCL-BRAK-transfected cell population contained some cells that were G-418 resistant but not expressing BRAK. In order to confirm this possibility, we cloned pCL-BRAK-transfected HSC-3 cells and found they yielded both BRAK-expressing and non-expressing cell clones. We first selected 10 BRAK

409

over-expressing clones by RT-PCR. Then 3 clones expressing 10 times higher amounts of BRAK protein than those of Mock vector-transfected cells were chosen by western blotting and cultured them in vitro. No difference in their growth rates was observed (Fig. 3), indicating that BRAK expression did not affect the growth of the cells in vitro. On the other hand, when a mixture of three clones of BRAKexpressing cells (BRAK), or Mock-transfected cells (Mock) was injected subcutaneously into the skin on both side of nude mice, a significantly higher number of tumors from the BRAK-expressing cells were rejected as compared with the number in the case of Mock-transfection (Fig. 4 and Table 1). Furthermore, the size of tumors from Mock vector-transfected cells significantly increased (P < 0.02 between days and day 27) after injection of the cells, on the other hand those from BRAK-expressing cells gradually decreased. The differences in tumor size between 2 groups were significant from 3 days after injection of the cells until 27 days (a, b, and c in Fig. 5). These results taken together indicate that BRAK expression in HSC-3 cells suppressed tumor formation in vivo. BRAK/CXCL14 was reported to be a chemokine expressed in normal cells and tissues but absent in cancer cells and cancerous tissues [25,26]. When we cultured HSC-3 cells, which were derived from a human tongue squamous cell carcinoma, in serum-free medium, they expressed BRAK/CXCL14; but it was down-regulated by the treatment with EGF (Fig. 1A). In this context it is interesting that fetal bovine serum employed in our cell culture system also down-regulated expression of BRAK mRNA (data not shown), which might be the reason why BRAK mRNA was not detected in previous report in cancer-derived cells in culture [25]. Human BRAK protein is produced as a precursor composed of 99 amino acid residues, and the mature protein with 77 amino acid residues is formed after removing the 22-amino acid N-terminal signal peptide [25]. Mouse BRAK is also called BMAC; because of it has B cell-and macrophage-activating activity [37]. The amino acid sequences of human and mouse BRAK are quite homologous (97.2% identical) with only 2 homologous substitutions (I36 to V and V41 to M) observed. Also the amino terminus 72 amino acid residues, which are supposedly essential for its function, are identical between human and chimpanzee BRAK proteins. This high homology among BRAK proteins of different species suggests important common physiological functions of this molecule. There is no TATAA box in the upstream presumptive promoter region of BRAK gene, only GC-rich sequences that are often found in the upstream sequence of housekeeping genes. The ubiquitous expression of BRAK mRNA and a common feature of the upstream sequence of the human BRAK gene suggest that BRAK could be a kind of housekeeping gene. Quite recently it was reported that breast tumor myoepithelial cells and prostate tumor epithelial cells express BRAK at a higher than that found in normal cells [8,38].

410

S. Ozawa et al. / Biochemical and Biophysical Research Communications 348 (2006) 406–412

Fig. 4. Photographs of tumor cell xenografts after 27 days. A mixture of BRAK-expressing cell clones and Mock vector-transfected cells (5 · 106) was inoculated subcutaneously into both sides of the back region of 10 female athymic nude mice, representative animals were photographed 27 days after xenografting. (A,B) BRAK-expressing cells. (C,D) Mock vector-transfected cells.

Table 1 Suppression of tumor cell xenograft

Mock BRAK

Suppressiona

%

4/20 16/20

20 80*

a BRAK-expressing or Mock vector-transfected tumor cells were injected subcutaneously and tumor sizes were consecutively measured. Tumors were regarded as suppressed, when there where only fat tissues and/or scar tissues observed and no tumor cells were found by histological examination after dissection at 27 days. * P < 0.001 (v2-test).

Differences in BRAK expression levels among tumors are not clear but they might depend on the type of cancer, squamous cell carcinoma in case of OC and adenocarcinoma, in prostate and breast cancer or stages of the carcinoma. Although up-regulation of BRAK mRNA level positively correlated with Gleason score, interestingly enough, introduction of a BRAK-expression vector into prostate cancer cells retarded growth of tumor xenograft in nude mice compared with that of Mock vector-transfected cells [38]. BRAK-expression in tumor cells increased the inhibition rate of tumor formation significantly and suppressed the growth of remained tumor cells in vivo (Figs. 4, 5 and Table 1). This is not simply due to growth retardation of BRAKexpressing cells, because in vitro culture conditions, growth rates of these cells are the same with Mock-vector-transfected cells. Two biological functions which might explain tumor suppressing function of BRAK are reported; anti-

Fig. 5. Effect of BRAK expression on HSC-3 xenograft tumor growth in nude mice. Each pooled clone of BRAK-and Mock vector-transfected cells (5 · 106) was inoculated subcutaneously into both sides of the dorsolateral region of 10 female athymic nude mice and the size of the established tumors at various times was determined. Mock: open circles, average of 16 tumors from 8 animals. BRAK: closed circles, average of 4 tumors with 4 animals. Two independent experiments showed a quite similar result. Difference between Mock-transfected and BRAK-expressing cells is shown. a, P < 0.05; b, P < 0.02; c, P < 0.001 (Student’s t-test).

S. Ozawa et al. / Biochemical and Biophysical Research Communications 348 (2006) 406–412

angiogenic activity and chemotactic activity for immature dendritic cells [39–41]. Precise mechanisms underlying in vivo tumor suppressing effect of BRAK in OC cells are not known at present, but BRAK to be a promising candidate molecule for cancer suppression, because it is produced in vivo in normal cells, thus overexpression, injection of BRAK protein or BRAK expressing vector might not have severe side effects. Acknowledgments We thank Dr. Akinori Kimura, Tokyo Medical and Dental University, for valuable comments on the manuscript. This work was supported in part by a Grant-inAid for High-Tech Research Center Project from the Ministry of Education, Culture, Sports, Science and Technology of Japan and by a Grant-in-Aid for Scientific Research from Japan Society for Promotion of Science. References [1] J.R. Grandis, J.A. Pietenpol, J.S. Greenberger, R.A. Pelroy, S. Mohla, Head and neck cancer: meeting summary and research opportunities, Cancer Res. 64 (2004) 8126–8129. [2] B. Vogelstein, K.W. Kinzler, Cancer genes and the pathways they control, Nat. Med. 10 (2004) 789–799. [3] S. Hirohashi, Y. Kanai, Cell adhesion system and human cancer morphogenesis, Cancer Sci. 94 (2003) 575–581. [4] M.J. Bissell, D. Radisky, Putting tumours in context, Nat. Rev. Cancer 1 (2001) 46–54. [5] P. Nyberg, L. Xie, R. Kalluri, Endogenous inhibitors of angiogenesis, Cancer Res. 65 (2005) 3967–3979. [6] M. Seiki, N. Koshikawa, I. Yana, Role of pericellular proteolysis by membrane-type 1 matrix metalloproteinase in cancer invasion and angiogenesis, Cancer Metastasis Rev. 22 (2003) 129–143. [7] Y. Itoh, M. Seiki, MT1-MMP: an enzyme with multidimensional regulation, Trends Biochem. Sci. 29 (2004) 285–289. [8] M. Allinen, R. Beroukhim, L. Cai, C. Brennan, J. LahtiDomenici, H. Huang, D. Porter, M. Hu, L. Chin, A. Richardson, S. Schnitt, W.R. Sellers, K. Polyak, Molecular characterization of the tumor microenvironment in breast cancer, Cancer Cell 6 (2004) 17–32. [9] J.R. Grandis, D.J. Tweardy, Elevated levels of transforming growth factor a and epidermal growth factor receptor messenger RNA are early markers of carcinogenesis in head and neck cancer, Cancer Res. 53 (1993) 3579–3584. [10] J.R. Grandis, M.F. Melhem, W.E. Gooding, R. Day, V.A. Holst, M.M. Wagener, S.D. Drenning, D.J. Tweardy, Levels of TGF-a and EGFR protein in head and neck squamous cell carcinoma and patient survival, J. Natl. Cancer Inst. 90 (1998) 824–832. [11] K.K. Ang, B.A. Berkey, X. Tu, H.Z. Zhang, R. Katz, E.H. Hammond, K.K. Fu, L. Milas, Impact of epidermal growth factor receptor expression on survival and pattern of relapse in patients with advanced head and neck carcinoma, Cancer Res. 62 (2002) 7350– 7356. [12] K. Katoh, Y. Nakanishi, S. Akimoto, K. Yoshimura, M. Takagi, M. Sakamoto, S. Hirohashi, Correlation between laminin-5 gamma2 chain expression and epidermal growth factor receptor expression and its clinicopathological significance in squamous cell carcinoma of the tongue, Oncology 62 (2002) 318–326. [13] I.H. Chen, J.T. Chang, C.T. Liao, H.M. Wang, L.L. Hsieh, A.J. Cheng, Prognostic significance of EGFR and Her-2 in oral cavity cancer in betel quid prevalent area cancer prognosis, Br. J. Cancer 89 (2003) 681–686.

411

[14] H. Niwa, A.L. Wentzel, M. Li, W.E. Gooding, V.W. Lui, J.R. Grandis, Antitumor effects of epidermal growth factor receptor antisense oligonucleotides in combination with docetaxel in squamous cell carcinoma of the head and neck, Clin. Cancer Res. 9 (2003) 5028–5035. [15] D. Ulanovski, Y. Stern, P. Roizman, T. Shpitzer, A. Popovtzer, R. Feinmesser, Expression of EGFR and Cerb-B2 as prognostic factors in cancer of the tongue, Oral Oncol. 40 (2004) 532–537. [16] Q. Zhang, S.M. Thomas, S. Xi, T.E. Smithgall, J.M. Siegfried, J. Kamens, W.E. Gooding, J.R. Grandis, Src family kinases mediate epidermal growth factor receptor ligand cleavage, proliferation, and invasion of head and neck cancer cells, Cancer Res. 64 (2004) 6166– 6173. [17] A. Gschwind, O.M. Fischer, A. Ullrich, The discovery of receptor tyrosine kinases: targets for cancer therapy, Nat. Rev. Cancer 4 (2004) 361–370. [18] N.E. Hynes, H.A. Lane, ERBB receptors and cancer: the complexity of targeted inhibitors, Nat. Rev. Cancer 5 (2005) 341–354. [19] S.M. Thomas, Q. Zeng, M.W. Epperly, W.E. Gooding, I. Pastan, Q.C. Wang, J. Greenberger, J.R. Grandis, Abrogation of head and neck squamous cell carcinoma growth by epidermal growth factor receptor ligand fused to pseudomonas exotoxin transforming growth factor a-PE38, Clin. Cancer Res. 10 (2004) 7079–7087. [20] F. Ciardiello, G. Tortora, A novel approach in the treatment of cancer: targeting the epidermal growth factor receptor, Clin. Cancer Res. 10 (2001) 2958–2970. [21] P.J. Miettinen, J.R. Chin, L. Shum, H.C. Slavkin, C.F. Shuler, R. Derynck, Z. Werb, Epidermal growth factor receptor function is necessary for normal craniofacial development and palate closure, Nat. Genet. 22 (1999) 69–73. [22] J.G. Paez, P.A. Ja¨nne, J.C. Lee, S. Tracy, H. Greulich, S. Gabriel, P. Herman, F.J. Kaye, N. Lindeman, T.J. Boggon, K. Naoki, H. Sasaki, Y. Fujii, M.J. Eck, W.R. Sellers, B.E. Johnson, M. Meyerson1, EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy, Science 304 (2004) 1497–1500. [23] S. Burden, Y. Yarden, Neuregulins and their receptors: a versatile signaling module in organogenesis and oncogenesis, Neuron 18 (1997) 847–855. [24] Y. Yarden, M.X. Sliwkowski, Untangling the ErbB signalling network, Nat. Rev. Mol. Cell Biol. 2 (2001) 127–137. [25] R. Hromas, H.E. Broxmeyer, C. Kim, H. Nakshatri, K. Christopherson II, M. Azam, Y.H. Hou, Cloning of BRAK, a novel divergent CXC chemokine preferentially expressed in normal versus malignant cells, Biochem. Biophys. Res. Commun. 255 (1999) 703–706. [26] M.J. Frederick, Y. Henderson, X. Xu, M.T. Deavers, A.A. Sahin, H. Wu, D.E. Lewis, A.K. El-Naggar, G.L. Clayman, In vivo expression of the novel CXC chemokine BRAK in normal and cancerous human tissue, Am. J. Pathol. 156 (2000) 1937–1950. [27] B.J. Rollins, Chemokines, Blood 90 (1997) 909–928. [28] M. Baggiolini, B. Dewald, B. Moser, Human chemokines: an update, Annu. Rev. Immunol. 15 (1997) 675–705. [29] J.M. Wang, X. Deng, W. Gong, S. Su, Chemokines and their role in tumor growth and metastasis, J. Immunol. Methods 220 (1998) 1–17. [30] A. Zlotnik, O. Yosie, Chemokines: A New Classification system and their role in Immunity, Immunity 12 (2000) 121–127. [31] K. Rikimaru, H. Toda, N. Tachikawa, N. Kamata, S. Enomoto, Growth of the malignant and nonmalignant human squamous cells in a protein-free defined medium, In Vitro Cell Dev. Biol. 26 (1990) 849– 856. [32] K. Izukuri, S. Ozawa, Y. Maehata, S. Takamizawa, E. Kubota, S. Sato, R. Hata, Development of cDNA microarray for analysis of gene expression profiles during the differentiation process in the craniomandibular system and for molecular diagnosis of craniomandibular disorders, Bull. Kanagawa Dent. Coll. 30 (2002) 137–140. [33] Y. Maehata, S. Takamizawa, S. Ozawa, Y. Kato, S. Sato, E. Kubota, R. Hata, Both direct and collagen-mediated signals are required for active vitamin D3-elicited differentiation of human osteoblastic cells:

412

[34]

[35]

[36]

[37]

S. Ozawa et al. / Biochemical and Biophysical Research Communications 348 (2006) 406–412 roles of osterix, an osteoblast-related transcription factor, Matrix Biology 25 (2006) 47–58. Y. Kato, J.M. Lewalle, Y. Baba, M. Tsukuda, N. Sakai, M. Baba, K. Kobayashi, S. Koshika, Y. Nagashima, F. Frankenne, A. Noel, J.M. Foidart, R. Hata, Induction of SPARC by VEGF in human vascular endothelial cells, Biochem. Biophys. Res. Commun. 287 (2001) 422–426. Y. Kato, C.A. Lambert, A.C. Colige, P. Mineur, A. Noel, F. Frankenne, J.M. Foidart, M. Baba, R. Hata, K. Miyazaki, M. Tsukuda, Acidic extracellular pH induces matrix metalloproteinase-9 expression in mouse metastatic melanoma cells through the phospholipase D-mitogen-activated protein kinase signaling, J. Biol. Chem. 280 (2005) 10938–10944. G. Nishimura, S. Yanoma, K. Satake, Y. Ikeda, T. Taguchi, Y. Nakamura, F. Hirose, M. Tsukuda, An experimental model of tumor dormancy therapy for advanced head and neck carcinoma, Jpn. J. Cancer Res. 91 (2000) 1199–1203. M.A. Sleeman, J.K. Fraser, J.G. Murison, S.L. Kelly, R.L. Prestidge, D.J. Palmer, J.D. Watson, K.D. Kumble, B cell- and monocyteactivating chemokine (BMAC), a novel non-ELR a-chemokine, Int. Immunol. 12 (2000) 677–689.

[38] S.R. Schwarze, J. Luo, W.B. Isaacs, D.F. Jarrard, Modulation of CXCL14 (BRAK) expression in prostate cancer, Prostate 64 (2005) 67–74. [39] T.D. Shellenberger, M. Wang, M. Gujrati, A. Jayakumar, R.M. Strieter, M.D. Burdick, C.G. Ioannides, C.L. Efferson, A.K. ElNaggar, D. Roberts, G.L. Clayman, M.J. Frederick, BRAK/ CXCL14 is a potent inhibitor of angiogenesis and a chemotactic factor for immature dendritic cells, Cancer Res. 64 (2004) 8262– 8270. [40] G.V. Shurin, R. Ferris, I.L. Tourkova, L. Perez, A. Lokshin, L. Balkir, B. Collins, G.S. Chatta, M.R. Shurin, Loss of new chemokine CXCL14 in tumor tissue is associated with low infiltration by dendritic cells (DC), while restoration of human CXCL14 expression in tumor cells causes attraction of DC both in vitro and in vivo, J. Immunol. 174 (2005) 5490–5498. [41] I. Kurth, K. Willimann, P. Schaerli, T. Hunziker, I. ClarhLewis, B. Moser, Monocyte selectivity and tissue localization suggests a role for breast and kidney-expressed chemokine (BRAK) in macrophage development, J. Exp. Med. 194 (2001) 855–861.