- Email: [email protected]
CXCR5
Accepted Manuscript Title: p53 Deletion promotes myeloma cells invasion by upregulating miR19a/CXCR5 Authors: Zhijie Yue, Yongxia Zhou, Pan Zhao, Yafang Chen, Ying Yuan, Yaoyao Jing, Xiaofang Wang PII: DOI: Reference:
S0145-2126(17)30468-X http://dx.doi.org/doi:10.1016/j.leukres.2017.07.003 LR 5800
To appear in:
Leukemia Research
Received date: Revised date: Accepted date:
25-2-2017 8-6-2017 23-7-2017
Please cite this article as: Yue Zhijie, Zhou Yongxia, Zhao Pan, Chen Yafang, Yuan Ying, Jing Yaoyao, Wang Xiaofang.p53 Deletion promotes myeloma cells invasion by upregulating miR19a/CXCR5.Leukemia Research http://dx.doi.org/10.1016/j.leukres.2017.07.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
p53
Deletion
Promotes
Myeloma
Cells
Invasion
By
Upregulating
miR19a/CXCR5
Zhijie Yue*, Yongxia Zhou*, Pan Zhao, Yafang Chen, Ying Yuan, Yaoyao Jing and Xiaofang Wang* Department of Hematology, Key Laboratory of Cancer Prevention and Therapy, Tianjin Medical University, Cancer Hospital of Tianjin, Xiaofang Wang [email protected], Ti-Yuan-Bei, Huan-Hu-Xi-Road, Tianjin 300060 China *These authors contributed equally to this work. They are Equal contributors and co-first authors.
Highlights: 1.p53 regulates the migration of NCI-H929 cells with wild-type p53. 2. p53 deletion promoted the acquisition of EMT-like phenotype of NCI-H929 cells. 3. p53 deletion reduced adhesion of NCI-H929 cells to the BM stroma. 4. miR-19a/CXCR5 pathway acts as a candidate for p53-induced migration mechanism.
Abstract: P53 deletion has been identified as one of the few factors that defined high risk and poor prognosis in MM. It has been reported p53 deletion is associated with resistance to chemotherapy and organ infiltrations of MM. However, p53 deletion in the migration and dissemination of MM cells has not been totally elucidated. In this research, first, we investigated whether p53 is associated with migration of MM cells. We found that p53 regulates the migration of NCI-H929 cells with wild-type p53 but not U266 cells with mutated-type p53. Next, we investigated the related mechanism by which p53 regulates the migration. We found that down-regulation of p53 reduced adhesion of NCI-H929 cells to the BM stroma via decreased expression of E-cadherin and increased EMT-regulating proteins. Further study have identified the miR-19a/CXCR5 pathway as a candidate p53-induced migration mechanism. In conclusion, we have demonstrated for the first time the critical value of p53 deletion in MM cell migration and dissemination, as well as the acquisition of an EMT-like phenotype. Our research provides new insights into the function of p53 in migration of MM and suggests p53/miRNA19a/CXCR5 may provide potentially therapeutic targets for the treatment of myeloma with p53 deletion. Key words:multiple myeloma, p53 deletion, migration, EMT Multiple myeloma (MM) is a clonal B-cell malignancy characterized by the aberrant proliferation of plasma cells within the bone marrow (BM). However, the disease typically remains confined to the BM [1]. With the development of new drugs and stem cell transplantation the prognosis of MM is improved significantly. However,
p53 deletion has been identified as one of the few factors that defined high risk and poor prognosis in MM[2–8]. p53 deletion has been reported associated with resistance to chemotherapy and advanced stage of organ infiltrations[9,10]. In breast cancer cells, p53 negatively regulates the expression of CXCR4 and CXCR5 and is associated with tumor metastasis[11,12]. However, whether p53 is involved in migration of MM and the related mechanism remains unexplored. CXCR5 is a G-protein coupled seven-trans-membrane domain chemokine receptor[13]. Binding of CXCR5 to its ligand CXCL13 leads to activation of multiple intracellular signaling pathways which regulate cell proliferation, survival and migration[14]. Epithelial-mesenchymal transition (EMT) occur in both physiological and pathological conditions [15,16] as well as cancer progression and metastasis[20-23]. Previous studies have shown that EMT plays a role in regulating MM cell dissemination and extra-medullary disease(EMD)[24,25]. EMT was as evidenced by repression of the epithelial marker E-cadherin, and induction of the mesenchymal marker Vimentin, and EMT transcription factors Snail and Twist[26-28]. However, whether p53 is involved in EMT remains unexplored. Recent studies have highlighted the importance of micro-RNAs (miRNAs) in various cancers[29]. MiRNAs were proven to play an important role in the pathogenesis of MM[30-32]. Our previous study showed that miR-19a acts as an oncogene by promoting cell proliferation/invasion and inhibiting apoptosis in MM[33]. In this research, for the first time we showed that suppression of p53 leads to
increased CXCR5 expression in NCI-H929 cells and activates cell migration in response to CXCL13. In addition, we demonstrated that p53 enhanced the acquisition of an EMT-like phenotype. Further study have identified the miR-19a/CXCR5 pathway as a candidate p53-induced migration mechanism. Cell Culture The NCI-H929(p53 wild-type) and U266 cell lines (p53 mutated) were purchased from the American
Type
Culture
Collection
(ATCC,
Manassas,VA). The
cells were grown in suspension in RPMI1640 medium (Gibco BRL, Grand Island, NY) supplemented with 15% fetal bovine serum (FBS) (GIBCO-BRL), penicillin(100 mg/mL), streptomycin
(100 mg/mL) and 2 mM l-glutamine (Gibco BRL, Grand
Island, NY). Cells were maintained at 37℃ in an atmosphere of 5% carbon dioxide and 95% air
and
underwent
passage twice weekly.
Stromal cells were obtained from BM samples from newly diagnosed MM patients in stages I to III as described previously[34].The patients were not treated before biopsy, and had no previous cancer or chemotherapy. Informed consent was obtained from all patients in accordance with the Declaration of Helsinki. Approval for these studies was obtained by Tianjin Cancer Institute Institutional Review Board. Cell Transfection Cells were grown in serumfree. RPMI1640 containing no antibiotics at a density of 5×105 in a six-well plate, prior to the addition of transfection. NCI-H929 and U266 cells were transfected with final concentration 50nM of miR-19a-3p mimics/inhibitors and corresponding negative controls.
The following p53 siRNAs were selected: target no. 1 for P53, 5 -GGGAGUUGUCAAGUCUUGCtt-3 (sense) and 5 -GCAAGACUUGACAACUCCCtc-3 (antisense); target no. 2 for P53, 5 -GGGUUAGUUUACAAUCAGCtt-3
(sense) and
5 -GCUGAUUGUAAACUAACCCtt-3
(antisense); Srambled siRNAs composed
of a 19 bp-scrambled sequence with 3-dT overhangs (Ambion’s Silencer negative control siRNA), was used. miR-19a-3p mimics/inhibitors and p53 siRNAs designed and synthesized by Biomics Biotechnologies Co., Ltd. (ZheJiang, China) were transfected into the cells using Lipofectamine 2000 (Invitrogen), respectively. RNA and protein were extracted after 48–72 h of transfection. Quantitative Real-Time PCR Real-time qRT-PCR was performed as previously described[30]. Total RNA was isolated from cells using Trizol reagent (Invitrogen, Carlsbad, USA) following the manufacturer’s protocol. RNA was reverse transcribed by M-MULV reverse transcriptase and oligodT primer from First strand cDNA synthesis kit (Fermentas, Vilnius, Lithuania). Quantitative RT-PCR was performed using Real-time PCR reaction mix with SYBR Green (Syntol, Moscow, Russia) and Applied Biosystems 7500 real-time PCR machine. Specific primer sets for miR-19a and U6 were purchasedfrom RiboBio. The primer sequences used to amplify human CXCR5,CXCR4, p53, Vimentin, Snail, Twist , E-cadherin and GAPDH are represented in Table 1. PCR conditions were as follows: 95℃ for 10 min, 95℃ for 15 s,
55℃ for 15 s, 72℃ for 20 s, for 40 cycles. mRNA levels of CXCR5, CXCR4, p53, Vimentin, Snail, Twist and E-cadherin in all samples were normalized by GAPDH and the expression of miR-19a was normalized by U6. Western Blot Total cell lysates were prepared using lysis buffer. Protein samples were resolved on 12% SDS-PAGE and transferred to Hybond-C. Extra nitrocellulose membrane (Amersham Biosciences, Amersham, UK) and immunoblotted with primary monoclonal antibodies specific to CXCR5 (1:500,R&D Systems, Minneapolis),CXCR4 (1:500, Cell Signaling Technology,Danvers, MA, USA), p53(1:1000, Cell Signaling Technology,Danvers, MA, USA) E-cadherin(1:1000, Cell Signaling Technology,Danvers, MA, USA), Snail(1:500, Cell Signaling Technology,Danvers, MA, USA), Twist(1:1000, Cell Signaling Technology,Danvers, MA, USA), Vimentin(1:1000, Cell Signaling Technology,Danvers, MA, USA) or β-actin (1:1000, Sigma, St. Louis, MO). The bands were detected with ECL using SuperSignal West Dura Extended Duration Substrate (Thermo Scientific, Waltham, USA). β-actin was used as an internal control for protein loading. Adhesion Assay A confluent monolayer of BM stromal cells (BMSCs; passages 2) was generated by plating 1×104 cells/well in 96-well plates for 24 hours. MM cells were fluorescently labeled by calcein-AM (1µg/mL for 1 hour), washed, and a suspension of 0.5×106 cells/mL was prepared. BMSCs were washed, 100µL of MM cell suspension was added to each well, and then cells were incubated for 1 hour.
Nonadherent cells were washed and adhesion was detected by measuring the fluorescence intensity in the wells using a plate-reader-fluorometer(excitement/emission, 485/520 nm). In Vitro Invasion Assay To evaluate myeloma cell invasion, MM cells (U266 and NCI-H929) were cultured in a six-well insert for 24 hours. In some experiments, p53 was down-regulated by transfection with siRNA and up-regulated by Nutlin-3 in MM cells. In other cases,miR-19a was up-regulated/down-regulated by miR-19a-3p(50Nm) mimics/inhibitors in MM cells. Then cells were placed in the upper matrigel-coated invasion chambers (24-well insert, 8 um pore size, BD) in serumfree 1640 (Hyclone). To the lower chambers, 1640 contain 10% FBS were added as a chemoattractant.In some experiments, 1640 contain 0.5% CXCL13 were added as a chemoattractant. In the cultured system, the filters were removed after approximately 24 h at 37℃ and noninvading cells from the top wells were removed by a cotton wrap. Cells on the lower membrane surface were fixed in 4% formaldehyde and stained with 0.2% crystal violet. Invading cells were manually counted in five randomly chosen fields under a microscope, and photographs were used. Statistical Analyses The Student’s t test was used to measure statistical significance between two treatment groups. Multiple comparisons were done using one-way ANOVA. Data were considered significant for p <0.05. Results
p53 Regulated The Invasion of NCI-H929 cells Previous study showed that p53 in involved in the metastasis of breast cancer cells. MM patients with p53 deletion tend to have EMD. In this research, we investigated whether p53 regulates the invasion of MM cells in vitro. Myeloma cells that passed through the Matrigel were harvested and analyzed by CCK-8 assay. As demonstrated by the transwell assay, downregulation of p53 with siRNA significantly increased the invasion ability of NCI-H929 cells(p<0.05) but not U266 cells. While upregulation of p53 by Nutlin-3 apparently decreased the invasion and increased the expression of p53 in NCI-H929(p<0.05) but not U266 cells (Figure 1).
p53 Regulates Adhesion of MM Cells To The BM Stroma Via Decreased Expression of E-cadherin And Increased EMT-regulating Proteins Previous studies have shown that EMT plays a role in regulating MM cell dissemination and EMD. We tested whether p53 regulates adhesion of MM cells to the BM stroma. QT-PCR and western blot were used to measure the expression of EMT-related markers. As shown in Figure 2, siRNA of p53 reduced adhesion to BMSCs isolated from MM patients of NCI-H929 cells but not of U266 cells. In addition, siRNA of p53 downregulated E-cadherin, together with upregulated Vimentin, Snail, and Twist in NCI-H929 cells(p<0.05) but not U266 cells. The above results indicated that down-regulation of p53 reduced adhesion of MM cells to the BM stroma via decreased expression of E-cadherin and increased EMT-regulating proteins. p53 Knockdown Activates CXCR5 But Not CXCR4 Expression In NCI-H929
cells. Previous study showed that elevated CXCR5 expression may contribute to abnormal cell survival and migration in breast tumors that lack functional p53. Roccaro et al. showed that CXCR4 regulates the EMD of MM[24].We are aimed to investigate p53 regulates the migration of H929 through CXCR5 or CXCR4. Realtime RT-PCR and Western blot were used to detect CXCR5 and CXCR4 mRNA and protein in NCI-H929 (Figure 3). NCI-H929 cells transfected siRNA of p53, demonstrated a significant increase in CXCR5 expression at both mRNA and protein levels, respectively(p<0.05). The expression of CXCR4 expression at both mRNA and protein levels did not change with transfected siRNA of p53(p>0.05). p53 Knockdown Increases CXCL13-Dependent Chemotaxis In NCI-H929 Cells Recently, it was shown that CXCL13-CXCR5 axis co-expression in breast cancer patients highly correlates with lymph node metastases. Matrigel-coated invasion chambers was used to test the whether p53 modulates CXCL13-dependent migration activity of MM cells. p53 knockdown in NCI-H929 cells led to a significantly higher migration rate towards recombinant CXCL13 compared to negative controls(p<0.05) (Figure 4A). It has been demonstrated that treatment with Nutlin-3 results in rising levels of p53 protein and subsequent induction of cell cycle arrest and apoptosis in a variety of tumor cells[35-38]. We performed western blot and matrigel invasion assay to determine whether Nutlin-3 increases p53 protein levels and reduces the migration of NCI-H929 cells with CXCL13 treatment. Cells were treated with 10 μM Nutlin-3 for
48 h and excess Nutlin-3 was removed by washing. Invasion of NCI-H929 cells was reduced significantly by Nutlin-3(p<0.05). In contrast, the invasion of U266 cells did not change by Nutlin-3(Figure 4B). Western blot showed that the expression of p53 was upregulated and CXCR5 was downregulated by Nutlin-3(Figure 4C). The above results demonstrated that Nutlin-3 regulates the invasion and CXCR5 expression of NCI-H929 cells in a p53-dependent manner. p53 Regulates The Expression of miR19a In NCI-H929 Cells Our previous study showed that miR19a promotes the cell proliferation/invasion of MM cells. QT-PCR was used to investigate whether p53 regulates the expression of miR19a. As shown in Figure 5, the expression of miR19a was upregulated by siRNA of p53 and downregulated by Nutlin-3 in NCI- H929 cells(p<0.05). In contrast, the expression of miR19a in U266 cells did not change by siRNA of p53 and Nutlin-3(p>0.05). miR19a Regulates The Expression of CXCR5 QT-PCR and Westen blot was used to investigate whether miR19a regulates the expression of CXCR5. As shown in Figure 6, the results showed that enforced expression of miR19a upregulates the mRNA and protein expression of CXCR5 as well as promotes the invasion of NCI-H929 cells(p<0.05). While attenuated expression of miR-19a inhibits the mRNA and protein expression of CXCR5 as well as the invasion of NCI-H929 cells(p<0.05). Silencing of miR19a Counteracts The Ability of p53 To Regulate CXCR5 And Invasion of NCI-H929 Cells
Next, experiments were carried out to ascertain whether p53 regulates CXCR5 expression of in NCI-H929 cells via miR19a. For this purpose, we have used predetermined optimal experimental conditions for siRNA transfection to specifically attenuate miR19a gene expression. As shown in Figure 7, the results showed that miR19a knockdown specifically abrogated the ability of siRNA of p53 to regulate CXCR5 expression and invasion of NCI-H929 cells, strongly suggesting that the regulation of CXCR5 by p53 was mediated by miR19a in NCI-H929 cells. Discussion Deletion of chromosome 17p13 region has been identified as one of the few factors that defined high risk and poor prognosis in MM[39]. Studies have highlighted the critical value of p53 deletion in the pathogenesis of MM[40,41]. However, whether p53 is involved in migration of MM and the mechanism remains unexplored. Based on studies showing that EMD usually occurred in patients with p53 depletion or mutation[42,43]. We anticipated that p53 is associated with MM cell migration and dissemination, and formation of EMD. In this research, first we test whether p53 regulates the migration of MM cells. NCI-H929 cells with wild-type p53 and U266 cells with mutated p53 were treated with siRNA of p53 or Nutlin-3,respectively. The results showed that downregulation or upregulation of p53 promotes or inhibited the migration of MM cells with wild-type p53. In breast cancer cells, p53 decreases tumor cell migration through upregulation the expression of CXCR4 and CXCR5[11,12]. In chronic lymphocytic leukemia,
CXCR5 plays a role in cell positioning and cognate interactions between tumor cells and accessory cells [44]. In additon, CXCR5 and CXCL13 play a role in the initial development of AIDS-related non-Hodgkin's lymphoma [45]. Therefore, we examined whether p53 regulates the migration of MM cells via CXCR5 or CXCR4. The results showed that only the expression of CXCR5 was changed by siRNA of p53 or Nutlin-3, suggesting p53 regulates the migration of MM cells via CXCR5. In addition, our results showed that suppression of p53 in NCI-H929 cells promotes chemotaxis towards CXCL13, suggesting CXCL13-CXCR5 axis correlates with MM invasion. Previous studies have shown that EMT plays a role in regulating MM cell dissemination and EMD. Roccaro et al. demonstrated that EMT-like transcriptional regulation occurs in MM cells during hypoxic conditions. CXCR4 regulates extra-medullary myeloma through epithelial-mesenchymal transition-like transcriptional activation[24,25]. However, whether p53 is involved in EMT remains unexplored. In this study, we found that siRNA of p53 reduced NCI-H929 cells adhesion to BMSCs isolated from MM patients. Further study showed that siRNA of p53 downregulated E-cadherin, together with upregulated Vimentin, Snail, and Twist in NCI-H929 cells but not U266 cells. The results indicated that down-regulation of p53 reduced adhesion of MM cells to the BM stroma via decreased expression of E-cadherin and increased EMT-regulating proteins. The miRNAs have been implicated in many critical biological processes. miR-34a has been shown to participate in cancer drug resistance or sensitivity in p53-dependent or
independent manner in cancers[46,47]. Our previous study showed that miR-19a acts as an oncogene in MM by promoting cell proliferation/invasion and inhibiting apoptosis[33]. Recent studies have demonstrated that miRNAs interact with p53 and its network at multiple levels. Thus, p53 regulates the transcription, expression and the maturation of a group of miRNAs [ 48-50]. In this study, we aimed to test whether miR-19a is involved in p53 mediated migration of MM cells. QT-PCR was used to investigate whether p53 regulate the expression of miR19a. The results showed that the expression of miR19a was upregulated in by siRNA of and downregulated by Nutlin-3 in p53 wild-type NCI-H929 cells but not in p53 mutated U266 cells. Our prvevious study showed that miR-19a/PTEN/AKT axis is involved in the invasion of myeloma. In this research,we found that miR19a regulates the expression of CXCR5 and migration of MM cells. Last, we showed that miR19a knockdown specifically abrogated the ability of siRNA of p53 to regulate CXCR5 expression and invasion of NCI-H929 cells. The results suggested that the regulation of CXCR5 by p53 was mediated by miR19a in NCI-H929 cells. In conclusion, we have demonstrated for the first time the critical value of p53 deletion in MM cell migration and dissemination, as well as the acquisition of an EMT-like phenotype. Our report provides new insights into the function of p53 in migration of MM and suggests p53/miRNA19a/CXCR5 may provide potentially therapeutic targets for the treatment of myeloma with p53 deletion. However,
targeting the p53/miRNA19a/CXCR5 might activate other signal pathway and give rise to further resistance sooner or later. Conflict of Interest The authors declare that they have no competing interests. Acknowledgements This research was supported by National Science Foundation of China, No. 81272562. References 1.Kyle RA, Rajkumar SV. Multiple myeloma. Blood. 2008, 111(6):2962-2972. 2.Chng WJ, Price-Troska T, Gonzalez-Paz N, et al. Clinical significance of TP53 mutation in myeloma. Leukemia. 2007, 21(3):582-584. 3.Lodé L, Eveillard M, Trichet V, et al. Mutations in TP53 are exclusively associated with del(17p) in multiple myeloma. Haematologica. 2010, 95(11):1973-1976. 4. Herrero AB, Rojas EA, Misiewicz-Krzeminska I,et al. Molecular Mechanisms of p53 Deregulation in Cancer: An Overview in Multiple Myeloma. Int J Mol Sci. 2016, 30:17(12). 5.Boyd KD, Ross FM, Tapper WJ, et al. The clinical impact and molecular biology of del(17p) in multiple myeloma treated with conventional or thalidomide-based therapy. Genes Chromosomes and Cancer. 2011, 50(10): 765-774. 6. Teoh PJ, Chng WJ. p53 abnormalities and potential therapeutic targeting in multiple myeloma. Biomed Res Int. 2014,2014:717919. 7.Chen MH, Qi CX, Saha MN, et al. p53 nuclear expression correlates with
hemizygous TP53 deletion and predicts an adverse outcome for patients with relapsed/refractory multiplemyeloma treated with lenalidomide. American Journal of Clinical Pathology. 2012, 137(2):208-212. 8.Chou T. Multiple myeloma: recent progress in diagnosis and treatment. Journal of Clinical and Experimental Hematopathology. 2012,52(3):149-159. 9.Vicente-Dueñas C, González-Herrero I, García Cenador MB, et al. Loss of p53 exacerbates multiple myeloma phenotype by facilitating the reprogramming of hematopoietic stem/progenitor cells to malignant plasma cells by MafB. Cell Cycle. 2012,11(20):3896-3900. 10.Billecke L, Penas EM, May AM,et al. Similar incidences of TP53 deletions in extramedullary organ infiltrations, soft tissue and osteolyses of patients with multiple myeloma. Anticancer Research. 2012, 32(5): 2031-2034. 11.Mehta SA, Christopherson KW, Bhat-Nakshatri P, et al. Negative regulation of chemokine receptor CXCR4 by tumor suppressor p53 in breast cancer cells: implications of p53 mutation or isoform expression on breast cancer cell invasion.Oncogene. 2007,26(23):3329-3337. 12. Mitkin NA, Hook CD, Schwartz AM, et al. p53-dependent expression of CXCR5 chemokine receptor in MCF-7 breast cancer cell s. Sci Rep. 2015, 5:9330. 13. Zlotnik A,Yoshie O. Chemokines: a new classification system and their role in immunity. Immunity. 2000, 12(2), 121-127. 14. Luster AD. Chemokines–chemotactic cytokines that mediate inflammation.
N Engl J Med. 1998,338(7), 436-445. 15.Acloque H, Adams MS, Fishwick K, et al. Epithelial-mesenchymal transitions: the importance of changing cell state in development and disease. J Clin Invest. 2009, 119(6): 1438–1449. 16. Vićovac L, Aplin JD. Epithelial-mesenchymal transition during trophoblast differentiation. Acta Anat. 1996, 156(3): 202–216. 17.Okada H, Danoff TM, Kalluri R, et al. Early role of Fsp1 in epithelial-mesenchymal transformation. Am J Physiol. 1997,273: F563– F574. 18.Zeisberg EM, Tarnavski O, Zeisberg M, et al. Endothelial-to-mesenchymal transition contributes to cardiac fibrosis. Nat Med. 2007, 13(8): 952–961. 19.Zeisberg M, Yang C, Martino M, et al. Fibroblasts derive from hepatocytes in liver fibrosis via epithelial to mesenchymal transition. J Biol Chem. 2007,282(32): 23337–23347. 20.Ansieau S, Bastid J, Doreau A, et al. Induction of EMT by twist proteins as a collateral effect of tumor-promoting inactivation of premature senescence. Cancer Cell. 2008, 14(1):79–89. 21.Brabletz T, Jung A, Reu S, et al. Variable beta-catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment. Proc Natl Acad Sci U S A. 2001, 98(18): 10356–10361. 22.Yang J, Mani SA, Weinberg RA. Exploring a new twist on tumor metastasis. Cancer Res.2006,66(9): 4549–4552.
23.Yang J, Weinberg RA. Epithelial-mesenchymal transition: at the crossroads of development and tumor metastasis. Dev Cell. 2008,14(6):818–829. 24. Roccaro AM, Mishima Y, Sacco A, et al. CXCR4 Regulates Extra-Medullary Myeloma through Epithelial-Mesenchymal-Transition-like Transcriptional Activation. Cell Rep. 2015, 12(4):622-635. 25. Azab AK, Hu J, Quang P, et al. Hypoxia promotes dissemination of multiple myeloma through acquisition of epithelial to mesenchymal transition-like features. Blood. 2012, 119(24):5782-5794. 26.WellsA, YatesC, ShepardCR. E-cadherin as an indicator of mesenchymal to epithelial reverting transitions during the metastatic seeding of disseminated carcinomas. Clin Exp Metastasis. 2008;25(6):621-628. 27. Vuoriluoto K, Haugen H, Kiviluoto S, et al. Vimentin regulates EMT induction by Slug and oncogenic H-Ras and migration by governing Axl expression in breast cancer.Oncogene. 2011,30(12):1436-1448. 28. Fendrich V, Waldmann J, Feldmann G, et al. Unique expression pattern of the EMT markers Snail, Twist and E-cadherin in benign and malignant parathyroid neoplasia. Eur J Endocrinol. 2009, 160(4):695-703. 29. Garzon R, Fabbri M, Cimmino A, et al. MicroRNA expression and function in cancer. Trends Mol Med. 2006,12(12):580-857. 30. Gutiérrez NC, Sarasquete ME, Misiewicz-Krzeminska I, et al. Deregulation of microRNA expression in the different genetic subtypes of multiple myeloma and correlation with gene expression profiling. Leukemia. 2010, 24(3):629-637.
31. Lionetti M, Biasiolo M, Agnelli L, et al. Identification of microRNA expression patterns and definition of a microRNA/mRNA regulatory network in distinct molecular groups of multiple myeloma. Blood. 2009,114(25):e20-e26. 32. Pichiorri F, Suh SS, Ladetto M, et al. MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008, 105(35): 12885-12890. 33.Zhang X, Chen Y, Zhao P, et al.MicroRNA-19a functions as an oncogene by regulating PTEN/AKT/pAKT pathway in myeloma. Leuk Lymphoma. 2017,58(4):932-940. 34.Wang X, Wang C, Yan SK, et al. XIAP is upregulated in HL-60 cells cocultured with stromal cells by direct cell contac t. Leuk Res. 2007,31(8):1125-1129. 35. Stuhmer T, Chatterjee M, Hildebrandt M, et al. Nongenotoxic activation of the p53 pathway as a therapeutic strategy for multiple myeloma. Blood. 2005,106(10): 3609–3617. 36. Kojima K, Konopleva M, Samudio IJ, et al. MDM2 antagonists induce p53-dependent apoptosis in AML: implications for leukemia therapy. Blood. 2005,106(9): 3150–3159. 37. Coll-Mulet L, Iglesias-Serret D, Santidrian AF, et al. MDM2 antagonists activate p53 and synergize with genotoxic drugs in Bcell chronic lymphocytic leukemia cells. Blood.2006,107(10): 4109–4114. 38. Drakos E, Thomaides A, Medeiros LJ, et al. Inhibition of p53-murine double
minute 2 interaction by nutlin-3A stabilizes p53 and induces cell cycle arrest and apoptosis in Hodgkin lymphoma. Clin Cancer Res. 2007,13(11): 3380–3387. 39. Chen MH, Qi CX, Saha MN, et al. p53 nuclear expression correlates with hemizygous TP53 deletion and predicts an adverse outcome for patients with relapsed/refractory multiple myeloma treated with lenalidomide. Am J Clin Pathol. 2012, 137(2): 208–212. 40.Mangiacavalli S, Pochintesta L, Cocito F, et al. Correlation between burden of 17P13.1 alteration and rapid escape to plasma cell leukaemia in multiple myeloma. Br J Haematol. 2013, 162(4): 555–558. 41. López-Anglada L, Gutiérrez NC, García JL, et al. P53 deletion may drive the clinical evolution and treatment response in multiple myeloma. Eur J Haematol. 2010 , 84(4): 359–361. 42.Usmani SZ, Heuck C, Mitchell A, et al. Extramedullary disease portends poor prognosis in multiple myeloma and is overrepresented in high risk disease even in era of novel agents. Haematologica 2012; 97(11):1761-1767. 43. Sheth N, Yeung J, Chang H. p53 nuclear accumulation is associated with extramedullary progression of multiple myeloma. Leuk Res 2009; 33(10):1357-1360. 44. Bürkle A, Niedermeier M, Schmitt-Gräff A, et al. Overexpression of the CXCR5 chemokine receptor, and its ligand, CXCL13 in B-cell chronic lymphocytic leukemia. Blood. 2007,110(9):3316-3325. 45.Widney DP, Gui D, Popoviciu LM, et al. Expression and Function of the Chemokine, CXCL13,
and
Its
Receptor, CXCR5,
in
Aids-Associated
Non-Hodgkin's Lymphoma. AIDS Res Treat. 2010,2010:164586. 46. Chakraborty S, Mazumdar M, Mukherjee S, et al. Restoration of p53/miR-34a regulatory axis decreases survival advantage and ensures Bax-dependent apoptosis of non-small cell lung carcinoma cells. FEBS Lett. 2014,588(4):549-559. 47. Fan YN, Meley D, Pizer B, et al. Mir-34a mimics are potential therapeutic agents for p53-mutated and chemo-resistant brain tumour cells. PLoS One. 2014, 24;9(9):e108514. 48.Braun CJ, Zhang X, Savelyeva I, et al. p53-responsive microRNAs 192 and 215 are capable of inducing cell cycle arrest. Cancer Res. 2008;68(24):10094–10104. 49.Chang TC, Wentzel EA, Kent OA, et al. Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol. Cell.2007;26(5):745–752. 50.Georges SA, Biery MC, Kim SY, et al. Coordinated regulation of cell cycle transcripts by p53-inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008;68(24):10105–10112.
Figure 1. Effect of p53 on the invasion of NCI-H929 cells. NCI-H929 and U266 cells were transfected with siRNA of p53(A) or treated with Nutlin-3(B). The Cell invasion ability was evaluated 12 h after transfection. Cells that migrated through the Matrigel layer were harvested and assessed by CCK-8 assay. The expression of p53 in NCI-H929 cells after treatment with Nutlin-3 was measured by western blot (C). Data are expressed as mean ± SD from three independent experiments. (*p<0.05).
Figure 2. p53 regulates adhesion of MM cells to the BM stroma via decreased expression of E-cadherin and increased EMT-regulating proteins The effect of incubation of BMSCs (isolated from 3 different MM patients) for 24 hours in vitro on adhesion of MM cells to BMSCs. The result shows decreased adhesion of NCI-H929 cells but not U266 transfected with siRNA of p53(A). siRNA of p53 downregulated the mRNA and protein levels of E-cadherin, together with upregulated Vimentin, Snail, and Twist in NCI-H929 cells(B,D)(*p<0.05)but not U266 cells(C, E). Data are expressed as mean ± SD from three independent experiments.
Figure 3. p53 knockdown activates CXCR5 but not CXCR4 expression in NCI-H929 cells.QT-PCR and western blot were used to test the expression mRNA and protein levels of CXCR4 and CXCR5. siRNA of p53 downregulated the expression of p53 and upregulated the expression of CXCR5 both in mRNA(A) and protein levels(B) of NCI-H929(*p<0.05), while the expression of CXCR4 did no change by siRNA of p53. Data are expressed as mean ± SD from three independent experiments.
Figure 4. p53 regulates the chemotaxis of NCI-H929 cells in a CXCL13-dependent manner. The migration of NCI-H929 cells towards recombinant CXCL13 was evaluated 12 h after transfection with siRNA of p53(A) or treatment with Nutlin-3(B). Cells that migrated through the Matrigel layer were harvested and assessed by CCK-8 assay. And western blot was used to test the protein levels of p53 and CXCR5 in
NCI-H929 cells treated with Nutlin-3(C). Data are expressed as mean ± SD from three independent experiments (*p<0.05). Figure 5. p53 regulates the expression of miR19a in NCI-H929 cells. QT-PCR was used to test the mRNA expression of miR19a by siRNA of p53(A) and Nutlin-3(B) in NCI-H929 and U266 cells, (*p<0.05) . Data are expressed as mean ± SD from three independent experiments. Figure 6. miR19a regulates the expression of CXCR5 and migratin in NCI-H929 cells. QT-PCR and Western blot were used to test the mRNA and protein expression of CXCR5 transfected with miR-19a-3p mimics(A,B) or inhibitors(C,D) in NCI-H929 cells. The migration of NCI-H929 cells transfected with miR-19a-3p mimics(E) or inhibitors(F) was evaluated 12h after transfection. Cells that migrated through the Matrigel layer were harvested and assessed by CCK-8 assay(*p<0.05). Data are expressed as mean ± SD from three independent experiments.
Figure 7. Silencing of miR19a counteracts the ability of p53 to regulate CXCR5. NCI-H929 cells pre-treated with miR19a inhibitors was treated with siRNA or scrambled RNA of p53. Then QT-PCR and Western blot were used to test the effect of the mRNA(A) and protein(B) expression of p53 and CXCR5 in NCI-H929 cells. The migration of NCI-H929 cells was evaluated 12 h after transfection(C). Cells that migrated through the Matrigel layer were harvested and assessed by CCK-8 assay(*p<0.05) . Data are expressed as mean ± SD from three independent experiments.
A
B
C
Figure 1
A
B
C
D
E Figure 2
A
B Figure 3
A
B
C Figure 4
A
B Figure 5
A
B
C
D
E
F Figure 6
A
B
C Figure 7
Table 1. Primers used for qRT-PCR Gene
Forward Primer (5' to 3')
CXCR4
TGACGGACAAGTACAGGCTG
CXCR5
GCTAACGCTGGAAATGGA
Reverse Primer (5' to 3') AGGGAAGCGTGATGACAAAGA GCAGGGCAGAGATGATTT
p53
ACTTTGCGTTCGGGCTGGGA
GTCTGGCTGCCAATCCAGGGA
Twist
CGGACAAGCTGAGCAAGATT
CCTTCTCTGGAAACAATGAC
Vimentin Snail E-cadherin GAPDH
GAACGCCAGATGCGTGAAATG CCAGAGGGAGTGAATCC AGATTA GCTCCTTCGTCCTTCTCCTC
TGACATCTGAGTGGGTCTGG
CGAGAGCTACACGTTCACGG
GGCCTTTTGACTGTAATCACACC
AAGGTGAAGGTCGGAGTCAAC GGGGTCATTGATGGCAACAATA
S0145-2126(17)30468-X http://dx.doi.org/doi:10.1016/j.leukres.2017.07.003 LR 5800
To appear in:
Leukemia Research
Received date: Revised date: Accepted date:
25-2-2017 8-6-2017 23-7-2017
Please cite this article as: Yue Zhijie, Zhou Yongxia, Zhao Pan, Chen Yafang, Yuan Ying, Jing Yaoyao, Wang Xiaofang.p53 Deletion promotes myeloma cells invasion by upregulating miR19a/CXCR5.Leukemia Research http://dx.doi.org/10.1016/j.leukres.2017.07.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
p53
Deletion
Promotes
Myeloma
Cells
Invasion
By
Upregulating
miR19a/CXCR5
Zhijie Yue*, Yongxia Zhou*, Pan Zhao, Yafang Chen, Ying Yuan, Yaoyao Jing and Xiaofang Wang* Department of Hematology, Key Laboratory of Cancer Prevention and Therapy, Tianjin Medical University, Cancer Hospital of Tianjin, Xiaofang Wang [email protected], Ti-Yuan-Bei, Huan-Hu-Xi-Road, Tianjin 300060 China *These authors contributed equally to this work. They are Equal contributors and co-first authors.
Highlights: 1.p53 regulates the migration of NCI-H929 cells with wild-type p53. 2. p53 deletion promoted the acquisition of EMT-like phenotype of NCI-H929 cells. 3. p53 deletion reduced adhesion of NCI-H929 cells to the BM stroma. 4. miR-19a/CXCR5 pathway acts as a candidate for p53-induced migration mechanism.
Abstract: P53 deletion has been identified as one of the few factors that defined high risk and poor prognosis in MM. It has been reported p53 deletion is associated with resistance to chemotherapy and organ infiltrations of MM. However, p53 deletion in the migration and dissemination of MM cells has not been totally elucidated. In this research, first, we investigated whether p53 is associated with migration of MM cells. We found that p53 regulates the migration of NCI-H929 cells with wild-type p53 but not U266 cells with mutated-type p53. Next, we investigated the related mechanism by which p53 regulates the migration. We found that down-regulation of p53 reduced adhesion of NCI-H929 cells to the BM stroma via decreased expression of E-cadherin and increased EMT-regulating proteins. Further study have identified the miR-19a/CXCR5 pathway as a candidate p53-induced migration mechanism. In conclusion, we have demonstrated for the first time the critical value of p53 deletion in MM cell migration and dissemination, as well as the acquisition of an EMT-like phenotype. Our research provides new insights into the function of p53 in migration of MM and suggests p53/miRNA19a/CXCR5 may provide potentially therapeutic targets for the treatment of myeloma with p53 deletion. Key words:multiple myeloma, p53 deletion, migration, EMT Multiple myeloma (MM) is a clonal B-cell malignancy characterized by the aberrant proliferation of plasma cells within the bone marrow (BM). However, the disease typically remains confined to the BM [1]. With the development of new drugs and stem cell transplantation the prognosis of MM is improved significantly. However,
p53 deletion has been identified as one of the few factors that defined high risk and poor prognosis in MM[2–8]. p53 deletion has been reported associated with resistance to chemotherapy and advanced stage of organ infiltrations[9,10]. In breast cancer cells, p53 negatively regulates the expression of CXCR4 and CXCR5 and is associated with tumor metastasis[11,12]. However, whether p53 is involved in migration of MM and the related mechanism remains unexplored. CXCR5 is a G-protein coupled seven-trans-membrane domain chemokine receptor[13]. Binding of CXCR5 to its ligand CXCL13 leads to activation of multiple intracellular signaling pathways which regulate cell proliferation, survival and migration[14]. Epithelial-mesenchymal transition (EMT) occur in both physiological and pathological conditions [15,16] as well as cancer progression and metastasis[20-23]. Previous studies have shown that EMT plays a role in regulating MM cell dissemination and extra-medullary disease(EMD)[24,25]. EMT was as evidenced by repression of the epithelial marker E-cadherin, and induction of the mesenchymal marker Vimentin, and EMT transcription factors Snail and Twist[26-28]. However, whether p53 is involved in EMT remains unexplored. Recent studies have highlighted the importance of micro-RNAs (miRNAs) in various cancers[29]. MiRNAs were proven to play an important role in the pathogenesis of MM[30-32]. Our previous study showed that miR-19a acts as an oncogene by promoting cell proliferation/invasion and inhibiting apoptosis in MM[33]. In this research, for the first time we showed that suppression of p53 leads to
increased CXCR5 expression in NCI-H929 cells and activates cell migration in response to CXCL13. In addition, we demonstrated that p53 enhanced the acquisition of an EMT-like phenotype. Further study have identified the miR-19a/CXCR5 pathway as a candidate p53-induced migration mechanism. Cell Culture The NCI-H929(p53 wild-type) and U266 cell lines (p53 mutated) were purchased from the American
Type
Culture
Collection
(ATCC,
Manassas,VA). The
cells were grown in suspension in RPMI1640 medium (Gibco BRL, Grand Island, NY) supplemented with 15% fetal bovine serum (FBS) (GIBCO-BRL), penicillin(100 mg/mL), streptomycin
(100 mg/mL) and 2 mM l-glutamine (Gibco BRL, Grand
Island, NY). Cells were maintained at 37℃ in an atmosphere of 5% carbon dioxide and 95% air
and
underwent
passage twice weekly.
Stromal cells were obtained from BM samples from newly diagnosed MM patients in stages I to III as described previously[34].The patients were not treated before biopsy, and had no previous cancer or chemotherapy. Informed consent was obtained from all patients in accordance with the Declaration of Helsinki. Approval for these studies was obtained by Tianjin Cancer Institute Institutional Review Board. Cell Transfection Cells were grown in serumfree. RPMI1640 containing no antibiotics at a density of 5×105 in a six-well plate, prior to the addition of transfection. NCI-H929 and U266 cells were transfected with final concentration 50nM of miR-19a-3p mimics/inhibitors and corresponding negative controls.
The following p53 siRNAs were selected: target no. 1 for P53, 5 -GGGAGUUGUCAAGUCUUGCtt-3 (sense) and 5 -GCAAGACUUGACAACUCCCtc-3 (antisense); target no. 2 for P53, 5 -GGGUUAGUUUACAAUCAGCtt-3
(sense) and
5 -GCUGAUUGUAAACUAACCCtt-3
(antisense); Srambled siRNAs composed
of a 19 bp-scrambled sequence with 3-dT overhangs (Ambion’s Silencer negative control siRNA), was used. miR-19a-3p mimics/inhibitors and p53 siRNAs designed and synthesized by Biomics Biotechnologies Co., Ltd. (ZheJiang, China) were transfected into the cells using Lipofectamine 2000 (Invitrogen), respectively. RNA and protein were extracted after 48–72 h of transfection. Quantitative Real-Time PCR Real-time qRT-PCR was performed as previously described[30]. Total RNA was isolated from cells using Trizol reagent (Invitrogen, Carlsbad, USA) following the manufacturer’s protocol. RNA was reverse transcribed by M-MULV reverse transcriptase and oligodT primer from First strand cDNA synthesis kit (Fermentas, Vilnius, Lithuania). Quantitative RT-PCR was performed using Real-time PCR reaction mix with SYBR Green (Syntol, Moscow, Russia) and Applied Biosystems 7500 real-time PCR machine. Specific primer sets for miR-19a and U6 were purchasedfrom RiboBio. The primer sequences used to amplify human CXCR5,CXCR4, p53, Vimentin, Snail, Twist , E-cadherin and GAPDH are represented in Table 1. PCR conditions were as follows: 95℃ for 10 min, 95℃ for 15 s,
55℃ for 15 s, 72℃ for 20 s, for 40 cycles. mRNA levels of CXCR5, CXCR4, p53, Vimentin, Snail, Twist and E-cadherin in all samples were normalized by GAPDH and the expression of miR-19a was normalized by U6. Western Blot Total cell lysates were prepared using lysis buffer. Protein samples were resolved on 12% SDS-PAGE and transferred to Hybond-C. Extra nitrocellulose membrane (Amersham Biosciences, Amersham, UK) and immunoblotted with primary monoclonal antibodies specific to CXCR5 (1:500,R&D Systems, Minneapolis),CXCR4 (1:500, Cell Signaling Technology,Danvers, MA, USA), p53(1:1000, Cell Signaling Technology,Danvers, MA, USA) E-cadherin(1:1000, Cell Signaling Technology,Danvers, MA, USA), Snail(1:500, Cell Signaling Technology,Danvers, MA, USA), Twist(1:1000, Cell Signaling Technology,Danvers, MA, USA), Vimentin(1:1000, Cell Signaling Technology,Danvers, MA, USA) or β-actin (1:1000, Sigma, St. Louis, MO). The bands were detected with ECL using SuperSignal West Dura Extended Duration Substrate (Thermo Scientific, Waltham, USA). β-actin was used as an internal control for protein loading. Adhesion Assay A confluent monolayer of BM stromal cells (BMSCs; passages 2) was generated by plating 1×104 cells/well in 96-well plates for 24 hours. MM cells were fluorescently labeled by calcein-AM (1µg/mL for 1 hour), washed, and a suspension of 0.5×106 cells/mL was prepared. BMSCs were washed, 100µL of MM cell suspension was added to each well, and then cells were incubated for 1 hour.
Nonadherent cells were washed and adhesion was detected by measuring the fluorescence intensity in the wells using a plate-reader-fluorometer(excitement/emission, 485/520 nm). In Vitro Invasion Assay To evaluate myeloma cell invasion, MM cells (U266 and NCI-H929) were cultured in a six-well insert for 24 hours. In some experiments, p53 was down-regulated by transfection with siRNA and up-regulated by Nutlin-3 in MM cells. In other cases,miR-19a was up-regulated/down-regulated by miR-19a-3p(50Nm) mimics/inhibitors in MM cells. Then cells were placed in the upper matrigel-coated invasion chambers (24-well insert, 8 um pore size, BD) in serumfree 1640 (Hyclone). To the lower chambers, 1640 contain 10% FBS were added as a chemoattractant.In some experiments, 1640 contain 0.5% CXCL13 were added as a chemoattractant. In the cultured system, the filters were removed after approximately 24 h at 37℃ and noninvading cells from the top wells were removed by a cotton wrap. Cells on the lower membrane surface were fixed in 4% formaldehyde and stained with 0.2% crystal violet. Invading cells were manually counted in five randomly chosen fields under a microscope, and photographs were used. Statistical Analyses The Student’s t test was used to measure statistical significance between two treatment groups. Multiple comparisons were done using one-way ANOVA. Data were considered significant for p <0.05. Results
p53 Regulated The Invasion of NCI-H929 cells Previous study showed that p53 in involved in the metastasis of breast cancer cells. MM patients with p53 deletion tend to have EMD. In this research, we investigated whether p53 regulates the invasion of MM cells in vitro. Myeloma cells that passed through the Matrigel were harvested and analyzed by CCK-8 assay. As demonstrated by the transwell assay, downregulation of p53 with siRNA significantly increased the invasion ability of NCI-H929 cells(p<0.05) but not U266 cells. While upregulation of p53 by Nutlin-3 apparently decreased the invasion and increased the expression of p53 in NCI-H929(p<0.05) but not U266 cells (Figure 1).
p53 Regulates Adhesion of MM Cells To The BM Stroma Via Decreased Expression of E-cadherin And Increased EMT-regulating Proteins Previous studies have shown that EMT plays a role in regulating MM cell dissemination and EMD. We tested whether p53 regulates adhesion of MM cells to the BM stroma. QT-PCR and western blot were used to measure the expression of EMT-related markers. As shown in Figure 2, siRNA of p53 reduced adhesion to BMSCs isolated from MM patients of NCI-H929 cells but not of U266 cells. In addition, siRNA of p53 downregulated E-cadherin, together with upregulated Vimentin, Snail, and Twist in NCI-H929 cells(p<0.05) but not U266 cells. The above results indicated that down-regulation of p53 reduced adhesion of MM cells to the BM stroma via decreased expression of E-cadherin and increased EMT-regulating proteins. p53 Knockdown Activates CXCR5 But Not CXCR4 Expression In NCI-H929
cells. Previous study showed that elevated CXCR5 expression may contribute to abnormal cell survival and migration in breast tumors that lack functional p53. Roccaro et al. showed that CXCR4 regulates the EMD of MM[24].We are aimed to investigate p53 regulates the migration of H929 through CXCR5 or CXCR4. Realtime RT-PCR and Western blot were used to detect CXCR5 and CXCR4 mRNA and protein in NCI-H929 (Figure 3). NCI-H929 cells transfected siRNA of p53, demonstrated a significant increase in CXCR5 expression at both mRNA and protein levels, respectively(p<0.05). The expression of CXCR4 expression at both mRNA and protein levels did not change with transfected siRNA of p53(p>0.05). p53 Knockdown Increases CXCL13-Dependent Chemotaxis In NCI-H929 Cells Recently, it was shown that CXCL13-CXCR5 axis co-expression in breast cancer patients highly correlates with lymph node metastases. Matrigel-coated invasion chambers was used to test the whether p53 modulates CXCL13-dependent migration activity of MM cells. p53 knockdown in NCI-H929 cells led to a significantly higher migration rate towards recombinant CXCL13 compared to negative controls(p<0.05) (Figure 4A). It has been demonstrated that treatment with Nutlin-3 results in rising levels of p53 protein and subsequent induction of cell cycle arrest and apoptosis in a variety of tumor cells[35-38]. We performed western blot and matrigel invasion assay to determine whether Nutlin-3 increases p53 protein levels and reduces the migration of NCI-H929 cells with CXCL13 treatment. Cells were treated with 10 μM Nutlin-3 for
48 h and excess Nutlin-3 was removed by washing. Invasion of NCI-H929 cells was reduced significantly by Nutlin-3(p<0.05). In contrast, the invasion of U266 cells did not change by Nutlin-3(Figure 4B). Western blot showed that the expression of p53 was upregulated and CXCR5 was downregulated by Nutlin-3(Figure 4C). The above results demonstrated that Nutlin-3 regulates the invasion and CXCR5 expression of NCI-H929 cells in a p53-dependent manner. p53 Regulates The Expression of miR19a In NCI-H929 Cells Our previous study showed that miR19a promotes the cell proliferation/invasion of MM cells. QT-PCR was used to investigate whether p53 regulates the expression of miR19a. As shown in Figure 5, the expression of miR19a was upregulated by siRNA of p53 and downregulated by Nutlin-3 in NCI- H929 cells(p<0.05). In contrast, the expression of miR19a in U266 cells did not change by siRNA of p53 and Nutlin-3(p>0.05). miR19a Regulates The Expression of CXCR5 QT-PCR and Westen blot was used to investigate whether miR19a regulates the expression of CXCR5. As shown in Figure 6, the results showed that enforced expression of miR19a upregulates the mRNA and protein expression of CXCR5 as well as promotes the invasion of NCI-H929 cells(p<0.05). While attenuated expression of miR-19a inhibits the mRNA and protein expression of CXCR5 as well as the invasion of NCI-H929 cells(p<0.05). Silencing of miR19a Counteracts The Ability of p53 To Regulate CXCR5 And Invasion of NCI-H929 Cells
Next, experiments were carried out to ascertain whether p53 regulates CXCR5 expression of in NCI-H929 cells via miR19a. For this purpose, we have used predetermined optimal experimental conditions for siRNA transfection to specifically attenuate miR19a gene expression. As shown in Figure 7, the results showed that miR19a knockdown specifically abrogated the ability of siRNA of p53 to regulate CXCR5 expression and invasion of NCI-H929 cells, strongly suggesting that the regulation of CXCR5 by p53 was mediated by miR19a in NCI-H929 cells. Discussion Deletion of chromosome 17p13 region has been identified as one of the few factors that defined high risk and poor prognosis in MM[39]. Studies have highlighted the critical value of p53 deletion in the pathogenesis of MM[40,41]. However, whether p53 is involved in migration of MM and the mechanism remains unexplored. Based on studies showing that EMD usually occurred in patients with p53 depletion or mutation[42,43]. We anticipated that p53 is associated with MM cell migration and dissemination, and formation of EMD. In this research, first we test whether p53 regulates the migration of MM cells. NCI-H929 cells with wild-type p53 and U266 cells with mutated p53 were treated with siRNA of p53 or Nutlin-3,respectively. The results showed that downregulation or upregulation of p53 promotes or inhibited the migration of MM cells with wild-type p53. In breast cancer cells, p53 decreases tumor cell migration through upregulation the expression of CXCR4 and CXCR5[11,12]. In chronic lymphocytic leukemia,
CXCR5 plays a role in cell positioning and cognate interactions between tumor cells and accessory cells [44]. In additon, CXCR5 and CXCL13 play a role in the initial development of AIDS-related non-Hodgkin's lymphoma [45]. Therefore, we examined whether p53 regulates the migration of MM cells via CXCR5 or CXCR4. The results showed that only the expression of CXCR5 was changed by siRNA of p53 or Nutlin-3, suggesting p53 regulates the migration of MM cells via CXCR5. In addition, our results showed that suppression of p53 in NCI-H929 cells promotes chemotaxis towards CXCL13, suggesting CXCL13-CXCR5 axis correlates with MM invasion. Previous studies have shown that EMT plays a role in regulating MM cell dissemination and EMD. Roccaro et al. demonstrated that EMT-like transcriptional regulation occurs in MM cells during hypoxic conditions. CXCR4 regulates extra-medullary myeloma through epithelial-mesenchymal transition-like transcriptional activation[24,25]. However, whether p53 is involved in EMT remains unexplored. In this study, we found that siRNA of p53 reduced NCI-H929 cells adhesion to BMSCs isolated from MM patients. Further study showed that siRNA of p53 downregulated E-cadherin, together with upregulated Vimentin, Snail, and Twist in NCI-H929 cells but not U266 cells. The results indicated that down-regulation of p53 reduced adhesion of MM cells to the BM stroma via decreased expression of E-cadherin and increased EMT-regulating proteins. The miRNAs have been implicated in many critical biological processes. miR-34a has been shown to participate in cancer drug resistance or sensitivity in p53-dependent or
independent manner in cancers[46,47]. Our previous study showed that miR-19a acts as an oncogene in MM by promoting cell proliferation/invasion and inhibiting apoptosis[33]. Recent studies have demonstrated that miRNAs interact with p53 and its network at multiple levels. Thus, p53 regulates the transcription, expression and the maturation of a group of miRNAs [ 48-50]. In this study, we aimed to test whether miR-19a is involved in p53 mediated migration of MM cells. QT-PCR was used to investigate whether p53 regulate the expression of miR19a. The results showed that the expression of miR19a was upregulated in by siRNA of and downregulated by Nutlin-3 in p53 wild-type NCI-H929 cells but not in p53 mutated U266 cells. Our prvevious study showed that miR-19a/PTEN/AKT axis is involved in the invasion of myeloma. In this research,we found that miR19a regulates the expression of CXCR5 and migration of MM cells. Last, we showed that miR19a knockdown specifically abrogated the ability of siRNA of p53 to regulate CXCR5 expression and invasion of NCI-H929 cells. The results suggested that the regulation of CXCR5 by p53 was mediated by miR19a in NCI-H929 cells. In conclusion, we have demonstrated for the first time the critical value of p53 deletion in MM cell migration and dissemination, as well as the acquisition of an EMT-like phenotype. Our report provides new insights into the function of p53 in migration of MM and suggests p53/miRNA19a/CXCR5 may provide potentially therapeutic targets for the treatment of myeloma with p53 deletion. However,
targeting the p53/miRNA19a/CXCR5 might activate other signal pathway and give rise to further resistance sooner or later. Conflict of Interest The authors declare that they have no competing interests. Acknowledgements This research was supported by National Science Foundation of China, No. 81272562. References 1.Kyle RA, Rajkumar SV. Multiple myeloma. Blood. 2008, 111(6):2962-2972. 2.Chng WJ, Price-Troska T, Gonzalez-Paz N, et al. Clinical significance of TP53 mutation in myeloma. Leukemia. 2007, 21(3):582-584. 3.Lodé L, Eveillard M, Trichet V, et al. Mutations in TP53 are exclusively associated with del(17p) in multiple myeloma. Haematologica. 2010, 95(11):1973-1976. 4. Herrero AB, Rojas EA, Misiewicz-Krzeminska I,et al. Molecular Mechanisms of p53 Deregulation in Cancer: An Overview in Multiple Myeloma. Int J Mol Sci. 2016, 30:17(12). 5.Boyd KD, Ross FM, Tapper WJ, et al. The clinical impact and molecular biology of del(17p) in multiple myeloma treated with conventional or thalidomide-based therapy. Genes Chromosomes and Cancer. 2011, 50(10): 765-774. 6. Teoh PJ, Chng WJ. p53 abnormalities and potential therapeutic targeting in multiple myeloma. Biomed Res Int. 2014,2014:717919. 7.Chen MH, Qi CX, Saha MN, et al. p53 nuclear expression correlates with
hemizygous TP53 deletion and predicts an adverse outcome for patients with relapsed/refractory multiplemyeloma treated with lenalidomide. American Journal of Clinical Pathology. 2012, 137(2):208-212. 8.Chou T. Multiple myeloma: recent progress in diagnosis and treatment. Journal of Clinical and Experimental Hematopathology. 2012,52(3):149-159. 9.Vicente-Dueñas C, González-Herrero I, García Cenador MB, et al. Loss of p53 exacerbates multiple myeloma phenotype by facilitating the reprogramming of hematopoietic stem/progenitor cells to malignant plasma cells by MafB. Cell Cycle. 2012,11(20):3896-3900. 10.Billecke L, Penas EM, May AM,et al. Similar incidences of TP53 deletions in extramedullary organ infiltrations, soft tissue and osteolyses of patients with multiple myeloma. Anticancer Research. 2012, 32(5): 2031-2034. 11.Mehta SA, Christopherson KW, Bhat-Nakshatri P, et al. Negative regulation of chemokine receptor CXCR4 by tumor suppressor p53 in breast cancer cells: implications of p53 mutation or isoform expression on breast cancer cell invasion.Oncogene. 2007,26(23):3329-3337. 12. Mitkin NA, Hook CD, Schwartz AM, et al. p53-dependent expression of CXCR5 chemokine receptor in MCF-7 breast cancer cell s. Sci Rep. 2015, 5:9330. 13. Zlotnik A,Yoshie O. Chemokines: a new classification system and their role in immunity. Immunity. 2000, 12(2), 121-127. 14. Luster AD. Chemokines–chemotactic cytokines that mediate inflammation.
N Engl J Med. 1998,338(7), 436-445. 15.Acloque H, Adams MS, Fishwick K, et al. Epithelial-mesenchymal transitions: the importance of changing cell state in development and disease. J Clin Invest. 2009, 119(6): 1438–1449. 16. Vićovac L, Aplin JD. Epithelial-mesenchymal transition during trophoblast differentiation. Acta Anat. 1996, 156(3): 202–216. 17.Okada H, Danoff TM, Kalluri R, et al. Early role of Fsp1 in epithelial-mesenchymal transformation. Am J Physiol. 1997,273: F563– F574. 18.Zeisberg EM, Tarnavski O, Zeisberg M, et al. Endothelial-to-mesenchymal transition contributes to cardiac fibrosis. Nat Med. 2007, 13(8): 952–961. 19.Zeisberg M, Yang C, Martino M, et al. Fibroblasts derive from hepatocytes in liver fibrosis via epithelial to mesenchymal transition. J Biol Chem. 2007,282(32): 23337–23347. 20.Ansieau S, Bastid J, Doreau A, et al. Induction of EMT by twist proteins as a collateral effect of tumor-promoting inactivation of premature senescence. Cancer Cell. 2008, 14(1):79–89. 21.Brabletz T, Jung A, Reu S, et al. Variable beta-catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment. Proc Natl Acad Sci U S A. 2001, 98(18): 10356–10361. 22.Yang J, Mani SA, Weinberg RA. Exploring a new twist on tumor metastasis. Cancer Res.2006,66(9): 4549–4552.
23.Yang J, Weinberg RA. Epithelial-mesenchymal transition: at the crossroads of development and tumor metastasis. Dev Cell. 2008,14(6):818–829. 24. Roccaro AM, Mishima Y, Sacco A, et al. CXCR4 Regulates Extra-Medullary Myeloma through Epithelial-Mesenchymal-Transition-like Transcriptional Activation. Cell Rep. 2015, 12(4):622-635. 25. Azab AK, Hu J, Quang P, et al. Hypoxia promotes dissemination of multiple myeloma through acquisition of epithelial to mesenchymal transition-like features. Blood. 2012, 119(24):5782-5794. 26.WellsA, YatesC, ShepardCR. E-cadherin as an indicator of mesenchymal to epithelial reverting transitions during the metastatic seeding of disseminated carcinomas. Clin Exp Metastasis. 2008;25(6):621-628. 27. Vuoriluoto K, Haugen H, Kiviluoto S, et al. Vimentin regulates EMT induction by Slug and oncogenic H-Ras and migration by governing Axl expression in breast cancer.Oncogene. 2011,30(12):1436-1448. 28. Fendrich V, Waldmann J, Feldmann G, et al. Unique expression pattern of the EMT markers Snail, Twist and E-cadherin in benign and malignant parathyroid neoplasia. Eur J Endocrinol. 2009, 160(4):695-703. 29. Garzon R, Fabbri M, Cimmino A, et al. MicroRNA expression and function in cancer. Trends Mol Med. 2006,12(12):580-857. 30. Gutiérrez NC, Sarasquete ME, Misiewicz-Krzeminska I, et al. Deregulation of microRNA expression in the different genetic subtypes of multiple myeloma and correlation with gene expression profiling. Leukemia. 2010, 24(3):629-637.
31. Lionetti M, Biasiolo M, Agnelli L, et al. Identification of microRNA expression patterns and definition of a microRNA/mRNA regulatory network in distinct molecular groups of multiple myeloma. Blood. 2009,114(25):e20-e26. 32. Pichiorri F, Suh SS, Ladetto M, et al. MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008, 105(35): 12885-12890. 33.Zhang X, Chen Y, Zhao P, et al.MicroRNA-19a functions as an oncogene by regulating PTEN/AKT/pAKT pathway in myeloma. Leuk Lymphoma. 2017,58(4):932-940. 34.Wang X, Wang C, Yan SK, et al. XIAP is upregulated in HL-60 cells cocultured with stromal cells by direct cell contac t. Leuk Res. 2007,31(8):1125-1129. 35. Stuhmer T, Chatterjee M, Hildebrandt M, et al. Nongenotoxic activation of the p53 pathway as a therapeutic strategy for multiple myeloma. Blood. 2005,106(10): 3609–3617. 36. Kojima K, Konopleva M, Samudio IJ, et al. MDM2 antagonists induce p53-dependent apoptosis in AML: implications for leukemia therapy. Blood. 2005,106(9): 3150–3159. 37. Coll-Mulet L, Iglesias-Serret D, Santidrian AF, et al. MDM2 antagonists activate p53 and synergize with genotoxic drugs in Bcell chronic lymphocytic leukemia cells. Blood.2006,107(10): 4109–4114. 38. Drakos E, Thomaides A, Medeiros LJ, et al. Inhibition of p53-murine double
minute 2 interaction by nutlin-3A stabilizes p53 and induces cell cycle arrest and apoptosis in Hodgkin lymphoma. Clin Cancer Res. 2007,13(11): 3380–3387. 39. Chen MH, Qi CX, Saha MN, et al. p53 nuclear expression correlates with hemizygous TP53 deletion and predicts an adverse outcome for patients with relapsed/refractory multiple myeloma treated with lenalidomide. Am J Clin Pathol. 2012, 137(2): 208–212. 40.Mangiacavalli S, Pochintesta L, Cocito F, et al. Correlation between burden of 17P13.1 alteration and rapid escape to plasma cell leukaemia in multiple myeloma. Br J Haematol. 2013, 162(4): 555–558. 41. López-Anglada L, Gutiérrez NC, García JL, et al. P53 deletion may drive the clinical evolution and treatment response in multiple myeloma. Eur J Haematol. 2010 , 84(4): 359–361. 42.Usmani SZ, Heuck C, Mitchell A, et al. Extramedullary disease portends poor prognosis in multiple myeloma and is overrepresented in high risk disease even in era of novel agents. Haematologica 2012; 97(11):1761-1767. 43. Sheth N, Yeung J, Chang H. p53 nuclear accumulation is associated with extramedullary progression of multiple myeloma. Leuk Res 2009; 33(10):1357-1360. 44. Bürkle A, Niedermeier M, Schmitt-Gräff A, et al. Overexpression of the CXCR5 chemokine receptor, and its ligand, CXCL13 in B-cell chronic lymphocytic leukemia. Blood. 2007,110(9):3316-3325. 45.Widney DP, Gui D, Popoviciu LM, et al. Expression and Function of the Chemokine, CXCL13,
and
Its
Receptor, CXCR5,
in
Aids-Associated
Non-Hodgkin's Lymphoma. AIDS Res Treat. 2010,2010:164586. 46. Chakraborty S, Mazumdar M, Mukherjee S, et al. Restoration of p53/miR-34a regulatory axis decreases survival advantage and ensures Bax-dependent apoptosis of non-small cell lung carcinoma cells. FEBS Lett. 2014,588(4):549-559. 47. Fan YN, Meley D, Pizer B, et al. Mir-34a mimics are potential therapeutic agents for p53-mutated and chemo-resistant brain tumour cells. PLoS One. 2014, 24;9(9):e108514. 48.Braun CJ, Zhang X, Savelyeva I, et al. p53-responsive microRNAs 192 and 215 are capable of inducing cell cycle arrest. Cancer Res. 2008;68(24):10094–10104. 49.Chang TC, Wentzel EA, Kent OA, et al. Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol. Cell.2007;26(5):745–752. 50.Georges SA, Biery MC, Kim SY, et al. Coordinated regulation of cell cycle transcripts by p53-inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008;68(24):10105–10112.
Figure 1. Effect of p53 on the invasion of NCI-H929 cells. NCI-H929 and U266 cells were transfected with siRNA of p53(A) or treated with Nutlin-3(B). The Cell invasion ability was evaluated 12 h after transfection. Cells that migrated through the Matrigel layer were harvested and assessed by CCK-8 assay. The expression of p53 in NCI-H929 cells after treatment with Nutlin-3 was measured by western blot (C). Data are expressed as mean ± SD from three independent experiments. (*p<0.05).
Figure 2. p53 regulates adhesion of MM cells to the BM stroma via decreased expression of E-cadherin and increased EMT-regulating proteins The effect of incubation of BMSCs (isolated from 3 different MM patients) for 24 hours in vitro on adhesion of MM cells to BMSCs. The result shows decreased adhesion of NCI-H929 cells but not U266 transfected with siRNA of p53(A). siRNA of p53 downregulated the mRNA and protein levels of E-cadherin, together with upregulated Vimentin, Snail, and Twist in NCI-H929 cells(B,D)(*p<0.05)but not U266 cells(C, E). Data are expressed as mean ± SD from three independent experiments.
Figure 3. p53 knockdown activates CXCR5 but not CXCR4 expression in NCI-H929 cells.QT-PCR and western blot were used to test the expression mRNA and protein levels of CXCR4 and CXCR5. siRNA of p53 downregulated the expression of p53 and upregulated the expression of CXCR5 both in mRNA(A) and protein levels(B) of NCI-H929(*p<0.05), while the expression of CXCR4 did no change by siRNA of p53. Data are expressed as mean ± SD from three independent experiments.
Figure 4. p53 regulates the chemotaxis of NCI-H929 cells in a CXCL13-dependent manner. The migration of NCI-H929 cells towards recombinant CXCL13 was evaluated 12 h after transfection with siRNA of p53(A) or treatment with Nutlin-3(B). Cells that migrated through the Matrigel layer were harvested and assessed by CCK-8 assay. And western blot was used to test the protein levels of p53 and CXCR5 in
NCI-H929 cells treated with Nutlin-3(C). Data are expressed as mean ± SD from three independent experiments (*p<0.05). Figure 5. p53 regulates the expression of miR19a in NCI-H929 cells. QT-PCR was used to test the mRNA expression of miR19a by siRNA of p53(A) and Nutlin-3(B) in NCI-H929 and U266 cells, (*p<0.05) . Data are expressed as mean ± SD from three independent experiments. Figure 6. miR19a regulates the expression of CXCR5 and migratin in NCI-H929 cells. QT-PCR and Western blot were used to test the mRNA and protein expression of CXCR5 transfected with miR-19a-3p mimics(A,B) or inhibitors(C,D) in NCI-H929 cells. The migration of NCI-H929 cells transfected with miR-19a-3p mimics(E) or inhibitors(F) was evaluated 12h after transfection. Cells that migrated through the Matrigel layer were harvested and assessed by CCK-8 assay(*p<0.05). Data are expressed as mean ± SD from three independent experiments.
Figure 7. Silencing of miR19a counteracts the ability of p53 to regulate CXCR5. NCI-H929 cells pre-treated with miR19a inhibitors was treated with siRNA or scrambled RNA of p53. Then QT-PCR and Western blot were used to test the effect of the mRNA(A) and protein(B) expression of p53 and CXCR5 in NCI-H929 cells. The migration of NCI-H929 cells was evaluated 12 h after transfection(C). Cells that migrated through the Matrigel layer were harvested and assessed by CCK-8 assay(*p<0.05) . Data are expressed as mean ± SD from three independent experiments.
A
B
C
Figure 1
A
B
C
D
E Figure 2
A
B Figure 3
A
B
C Figure 4
A
B Figure 5
A
B
C
D
E
F Figure 6
A
B
C Figure 7
Table 1. Primers used for qRT-PCR Gene
Forward Primer (5' to 3')
CXCR4
TGACGGACAAGTACAGGCTG
CXCR5
GCTAACGCTGGAAATGGA
Reverse Primer (5' to 3') AGGGAAGCGTGATGACAAAGA GCAGGGCAGAGATGATTT
p53
ACTTTGCGTTCGGGCTGGGA
GTCTGGCTGCCAATCCAGGGA
Twist
CGGACAAGCTGAGCAAGATT
CCTTCTCTGGAAACAATGAC
Vimentin Snail E-cadherin GAPDH
GAACGCCAGATGCGTGAAATG CCAGAGGGAGTGAATCC AGATTA GCTCCTTCGTCCTTCTCCTC
TGACATCTGAGTGGGTCTGG
CGAGAGCTACACGTTCACGG
GGCCTTTTGACTGTAATCACACC
AAGGTGAAGGTCGGAGTCAAC GGGGTCATTGATGGCAACAATA