- Email: [email protected]
Cyclic expression of Lhx2 is involved in secondary hair follicle development in cashmere goat
Gene Expression Patterns 16 (2014) 31–35
Contents lists available at ScienceDirect
Gene Expression Patterns j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e p
Cyclic expression of Lhx2 is involved in secondary hair follicle development in cashmere goat Rongqing Geng a,1, Lanping Wang a,1, Xiaolong Wang b, Yulin Chen b,* a b
College of Life Science and Technology, Yancheng Teachers University, Yancheng 224051, China College of Animal Science and Technology, Northwest A&F University, Yangling 712100, China
A R T I C L E
I N F O
Article history: Received 17 May 2014 Received in revised form 29 July 2014 Accepted 31 July 2014 Available online 13 August 2014 Keywords: Cashmere goat Secondary hair follicle Lhx2 Cyclic expression
A B S T R A C T
Lhx2, a member of LIM homeobox transcription factors, plays a key role in normal tissue development. However, the molecular mechanism of Lhx2 gene in the regulation of the secondary hair follicle cycling in cashmere goat remains largely unknown. In the present study, the Lhx2 gene was cloned and characterized in cashmere goat. The cloned cDNA of Lhx2 was 1233 bp in length, encoding for proteins of 406 amino acids which contained all functionally important domains conserved among vertebrate Lhx2 gene. Tissue distribution analysis showed that Lhx2 mRNA was highly expressed in the skin and low expressed in all other tissues. Immunohistochemical localization revealed that Lhx2 was expressed in secondary hair follicles. Analysis of expression profiles of Lhx2 mRNA during different development stages in secondary hair follicles showed that the highest expression was observed at the anagen stage, while the lowest expression was detected at the telogen stage. The expression tendency during the development stages was that it increased from telogen to anagen, decreased from anagen to catagen, and decreased from catagen to telogen. The expression pattern of Lhx2 protein and mRNA was similar. The mRNA and protein expression of Lhx2 were consistent throughout the development cycle in secondary hair follicles. These findings provided a better understanding of the function of Lhx2 and suggested that the cyclic expression of Lhx2 might play important roles during secondary hair follicle development in cashmere goat. © 2014 Published by Elsevier B.V.
Cashmere is the fine, undercoat fibers (down) of cashmere goats. Cashmere goat is heterogeneous fleece composed of wool and cashmere which are respectively generated by the primary hair follicles and the secondary hair follicles. Although their structures and composition are very similar, the secondary hair follicle is differentiated from the primary hair follicle. The hair follicle cycle of cashmere goat is composed of anagen (active), catagen (quiescent) and telogen (inactive) phases. The process of seasonal hair follicle cycle and fiber shedding in cashmere goat has been described extensively by previously studies (Ansari-Renani et al., 2011; He et al., 2012; Li et al., 2008; McDonald et al., 1987; Nixon et al., 1991; Ryder, 1966). Although basic principles and molecular mechanisms that govern hair follicle development and cyclic regeneration have been revealed in humans (Le Bot, 2011; Millar, 2002; Schmidt-Ullrich and Paus, 2005; Stenn and Paus, 2001), molecular mechanisms that regulate the development and postnatal growth of the hair follicle in cashmere goat are still not clear. The recent and ongoing
* Corresponding author at: College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi Province 712100, China. Tel.: +86-29-87091130; fax: +86-29-87091130. E-mail address: [email protected] (Y. Chen). 1 The first two authors contributed equally to this work. http://dx.doi.org/10.1016/j.gep.2014.07.004 1567-133X/© 2014 Published by Elsevier B.V.
development of next-generation sequencing technologies provide accurate and digital gene expression profiles of transcripts and have been used in mRNA sequencing for cashmere goat. Numerous differentially expressed genes have been identified between different hair follicle developmental stages at the transcriptional level, which will provide useful information for researches on hair follicle development in cashmere goat (Geng et al., 2013; Xu et al., 2013; Zhu et al., 2013, 2014). LIM-homeodomain family, a class of transcription factors, regulates many important developmental processes such as asymmetric cell division, tissue specification and differentiation of specific cell types (Hobert and Westphal, 2000). One member of this gene family, Lhx2, was independently isolated as a transcription factor binding to the glycoprotein hormone α-subunit promoter and has been shown to be essential in regulating fundamental processes which is important for organ/tissue generation and regeneration (Dahl et al., 2008; Kolterud et al., 2004; Park et al., 2012; Shetty et al., 2013; Zhao et al., 2010). It is also confirmed that Lhx2 gene is active during the growth phase of the hair follicles and is turned off during the resting phase (Törnqvist et al., 2010). Hence, Lhx2 is functionally involved in hair formation and is an important regulator of hair growth. The purpose of this study was to elucidate the regulation roles of Lhx2 gene during secondary hair follicle development. Firstly, Lhx2 gene was cloned and characterized from cashmere goat skin. Then,
32
R. Geng et al./Gene Expression Patterns 16 (2014) 31–35
the tissue distribution of Lhx2 gene was examined and immunohistochemistry was performed to detect the precise position of Lhx2 in the secondary hair follicle, which was the main tissue responsible for cashmere formation. Finally, the expression profiles of the Lhx2 gene in the secondary hair follicle at different postnatal developmental stages were examined. 1. Materials and methods 1.1. Animals and tissue sampling The Shaanbei white cashmere goats were obtained from the Shaanbei Cashmere Goats Engineering Technology Research Center (Shaanxi, China). Twenty adult individuals (10 males and 10 females) were randomly selected and any two or more individuals with traceable phylogenetic relationship were avoided in the sampling process. The skin samples were collected according to a previous study (Geng et al., 2014). Briefly, about 1 cm2 skin tissue was harvested from the right mid-side of an adult cashmere goat by surgical method. Secondly, the skin tissue was rinsed in ice-cold DEPC-treated water and was cut into small pieces. Lastly, the skin samples were immediately frozen in liquid nitrogen and then stored at −80 °C until RNA extraction. The skin samples were collected from the same individuals at different development stages. 1.2. cDNA cloning, sequencing and sequence analysis Total RNA was isolated using TRIzol reagent (Takara, Dalian, China) according to the manufacturer’s protocol and stored at −80 °C. The isolated RNA was applied to synthesize the first-strand cDNA using the PrimeScript RT reagent Kit with gDNA Eraser (Takara, Dalian, China). Based on the sequence of bovine Lhx2 gene (NM_001191175), a pair of primers (Table 1) was designed to amplify the complete coding region of cashmere goat Lhx2 gene. PCR amplifications were conducted in a final volume of 50 μL with 1 μL first strand cDNA, 25 μL Premix Taq and 1 μL of each primer (10 pmol/μL). The PCR amplification conditions were programmed as 5 min predenaturation at 94 °C, followed by 32 cycles of denaturation at 94 °C for 30 s, annealing at 63 °C for 45 s, extension at 72 °C for 60 s, then final extension at 72 °C for 10 min. The PCR amplification product was examined by 1% agarose gel. The PCR product was purified and ligated into the pMD18-T Vector (Takara, Dalian, China). Three different individual positive clones were sequenced on an ABI 3700 sequencer (Applied Biosystems) by Sangon Biotech Co., Ltd. (Shanghai, China). Sequence homology analysis was obtained from Blast suite program of NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and the deduced amino acid sequence was analyzed by the Protparam program of ExPASy (http://web.expasy.org/protparam/). The signal peptide cleavage site was predicted by the SignalP 4.0 Server (http:// www.cbs.dtu.dk/services/SignalP/). Putative transmembrane domain was predicted by using TMHMM Server v. 2.0. Protein domains were predicted by prosite program of ExPASy (http://prosite.expasy.org/ prosite.html).
Table 1 Primers used for cloning and real-time PCR. Sequence (5′–3′)
Function
Lhx2
F: GGATCCATGCTGTTCCACAGCCTGTC R: AGCTTTTAGAAAAGGTTGGTAAGAGTCG F: TACCCGAGCAGCCAGAAGA R: GTCGGGGTTGTGGTTAATGG F: TGAACCCCAAAGCCAACC R: AGAGGCGTACAGGGACAGCA
Cloning
β-actin
Total RNA from 12 different tissues, including skin, muscle, subcutaneous fat, brain, heart, liver, spleen, lung, kidney, rumen, large intestine and small intestine, were extracted to investigate the mRNA expression profile of the Lhx2 gene in cashmere goat using qPCR. The β-actin gene was used as the internal reference gene. The primers for Lhx2 and β-actin were designed and showed in Table 1. The qPCR was carried out on an iQ5 system (Bio-Rad, Hercules, CA, USA) using SYBR Premix Ex Taq (TaKaRa, Dalian, China) according the manufacturer’s instructions. The thermal cycling conditions used in the qPCR were 95 °C for 3 min, followed by 40 cycling of 95 °C for 5 s and 60 °C for 1 min. The specificity of the SYBR green PCR signal was confirmed by melting curve analysis. There were three biological and technical replicates, respectively. Relative quantification analyses were performed using the comparative CT method, and the relative gene expression was calculated by using the 2−△△Ct method (Livak and Schmittgen, 2001). 1.4. Localization of Lhx2 in secondary hair follicle by immunohistochemistry Skin tissues were harvested and fixed with 4% paraformaldehyde in PBS at 4 °C for 12 h. The fixed samples were dehydrated, embedded with paraffin, and cut into 10 μm thick section. HE staining was performed on rehydrated samples. For immunohistochemistry, sections were rehydrated, blocked with 5% goat serum, and incubated overnight at 4 °C with primary antibody of rabbit antiLhx2 polyclonal antibody (Bioss, Woburn, MA, USA) according to the recommended ratio. Sections were then incubated with the secondary antibody. The labeled samples were then counterstained with DAB, and a Leica confocal microscope was used to observe and document the results. 1.5. Analysis of the expression pattern of Lhx2 in different development stages of secondary hair follicle The secondary hair follicles were collected from three development stages including anagen, catagen and telogen. Total RNA was extracted from secondary hair follicles of three stages by using RNAprep pure Micro kit (Tiangen, Beijing, China) according to the manufacturer’s protocol. The first strand cDNA was synthesized from purified RNA by reverse transcription PCR and qPCR reaction was also performed according to previous Lhx2 gene expression analysis in different tissues. For the western blot analysis, total proteins were extracted with Total Protein Extraction Kit (KeyGEN, Nanjin, China) from frozen secondary hair follicles of each stage according to the instructions provided by the manufacturer. Equal amounts of total protein were loaded per lane on SDS-PAGE gel. Following electrophoresis, proteins were transferred to a polyvinylidene fluoride membrane, which was then probed with the primary antibodies against Lhx2 or β-actin (Bioss). Then, horseradish peroxidase-conjugated secondary antibody was used. Antibody binding was visualized using an enhanced chemiluminescence system and quantified by densitometric analysis. 1.6. Statistical analysis
Gene
Lhx2
1.3. Tissue-specific expression of Lhx2 gene
qPCR qPCR
The statistical analysis was performed by SPSS 13.0. Significant difference was carried out to compare expression levels using a oneway analysis of variance (ANOVA). The relationship between Lhx2 mRNA and protein expression was examined with the Pearson’s correlation coefficient statistical method. Statistical significance was considered significant at P < 0.05.
R. Geng et al./Gene Expression Patterns 16 (2014) 31–35
33
2. Results 2.1. Molecular cloning and sequence analysis of the Lhx2 gene in cashmere goat The cloned cDNA of Lhx2 gene was 1233 bp, with an open reading frame (ORF) of 1221 bp (KJ872671) coding for a polypeptide of 406 amino acids. The theoretical isoelectric point (pI) and molecular weight (Mw) of Lhx2 protein was 8.48 and 44.38 KDa, respectively. The deduced Lhx2 protein was predicted to possess no signal peptide and transmembrane domain. It included all functionally important domains conserved among vertebrate Lhx2, which consisted of two LIM zinc-binding domains and a homeobox domain. The Lhx2 gene sequence of cashmere goat shared highest identity (99%) to that of the Bos taurus Lhx2 gene (NM_001191175). The deduced amino acid sequence of cashmere goat Lhx2 shared the 100% identity with that of Bos taurus (NP_001178104) and Sus scrofa (NP_001163990), 99% with Homo sapiens (BAG51357), 98% with Ovis aries (XP_004005697), and also shared relatively high identity with other mammalian species. 2.2. Lhx2 mRNA expression profile in different tissues The expression of the Lhx2 mRNA in different tissues was analyzed by qPCR analysis. Although Lhx2 mRNA was ubiquitously expressed in all sampled tissues, its expression level varied dramatically in different tissues (Fig. 1). The Lhx2 mRNA was highly expressed in the skin. A very low expression level was found in other tissues including liver, brain, muscle, subcutaneous fat, heart, spleen, lung, kidney, rumen, large intestine and small intestine. The expression level in the skin was significantly different from those in other tissues (P < 0.05). 2.3. Immunohistochemical analysis of Lhx2 in secondary hair follicle Immunohistochemical detection of Lhx2 in cashmere goat skin showed that it was highly expressed in secondary hair follicles but no expression was found in blank control hair follicles (Fig. 2). In secondary hair follicles, Lhx2 was detected in dermal papilla, matrix, inner root sheath and outer root sheath. Staining intensity of dermal papilla appeared to be slightly weaker than that of matrix, although quantitative analysis was not performed. Immunohistochemical localization of Lhx2 in cashmere goat skin revealed that Lhx2 was expressed in secondary hair follicles. 2.4. Expression profiles of Lhx2 in secondary hair follicle at different development stages The temporal expression profile of Lhx2 mRNA in secondary hair follicle at different development stages was analyzed by qPCR (Fig. 3). A highly significant difference was found between different stages (P < 0.05). The highest expression level was detected at the anagen stage, whereas the telogen stage showed the lowest expression. The expression tendency of Lhx2 mRNA during the development stages was that it increased from telogen to anagen, decreased from anagen to catagen, and decreased from catagen to telogen. The western blotting revealed that Lhx2 protein was expressed in all examined development stages (Fig. 4a). The highest expression of the protein was detected at the anagen stage. The protein level was remarkably decreased at the catagen stage and the telogen stage (Fig. 4b). The relative protein expression levels at different development stages were significantly different (P < 0.05). The level of the Lhx2 protein and mRNA in secondary hair follicles during development stages showed a similar pattern (Fig. 3 and
Fig. 1. The expression patterns of Lhx2 in different tissues. Significant differences (P < 0.05) are indicated by different superscripts and the same superscript means no significance.
Fig. 4b). Correlation analysis between Lhx2 protein and mRNA expression levels showed that the Pearson’s correlation coefficient value was 0.996 and the correlation relationship was significant (P < 0.05). 3. Discussion In the present study, a strategy of reverse transcription PCR method was used to obtain the Lhx2 cDNA sequence. A protein of 406 amino acids encoded by the 1233 bp cDNA sequence was obtained from cashmere goat skin. The length of Lhx2 amino acids sequence in cashmere goat was the same as that of mammalian Lhx2. The obtained cDNA sequence was named as cashmere goat Lhx2 since the deduced protein sequence exhibits more than 98% identity with known cattle and sheep Lhx2 amino acid sequence. It implied that the coding region of cashmere goat Lhx2 gene was successfully cloned for the first time and the whole ORF region was 1221 bp in length. Analysis of amino acid sequence showed that the Lhx2 putative protein sequence of cashmere goat contained three conserved motifs, including two LIM zinc-binding domains and a homeobox
34
R. Geng et al./Gene Expression Patterns 16 (2014) 31–35
Fig. 2. Immunohistochemical localization of Lhx2 in secondary hair follicles of cashmere goat. Positive staining is shown on the left but blank control showed almost no positive staining on the right. Immuno-stained product is observed as a brown deposit.
domain. All these motifs were crucial to the functional Lhx2 protein (Dawid et al., 1998; Hobert and Westphal, 2000; Jurata and Gill, 1998). Lhx2 proteins contain two zinc-coordinated, finger-like LIM domains, that are located N-terminally of the homeodomain. These structures mediated both interactions with other proteins (including transcriptional coregulators and other transcription factors) and intramolecular modulation of DNA binding properties. A centrally located homeobox domain allows interaction with DNA recognition elements in target genes. A number of studies have shown that Lhx2 is essential for the normal development of the forebrain, eye, olfactory system, liver, pituitary and nervous system (Hirota and Mombaerts, 2004; Kolterud et al., 2004; Porter et al., 1997; Shetty et al., 2013; Zhao et al., 2010). qPCR analysis revealed strong tissue-specific expression patterns of the Lhx2 gene in cashmere goat. The Lhx2 mRNA was expressed in all analyzed tissues, which suggests that the Lhx2 gene is ubiquitously expressed in adult cashmere goat and may have multiple functions. However, although Lhx2 was detected in all these tissues, its expression quantity varied from one to the other. The highest mRNA level was detected in the skin, followed by the liver and brain, and meanwhile the lowest mRNA level was observed in the spleen. Further experiments confirmed that Lhx2 protein was located in the secondary hair follicles of cashmere goat skin by im-
Fig. 3. The expression level of Lhx2 mRNA in secondary hair follicle of cashmere goat at different development stages. Significant differences (P < 0.05) are indicated by different superscripts.
Fig. 4. The expression level of Lhx2 protein in secondary hair follicle of cashmere goat at different development stages. (a) Western blotting results. (b) Relative protein levels. Significant differences (P < 0.05) are indicated by different superscripts.
munohistochemistry method. Specifically speaking, the highest mRNA level was detected in the skin and relatively low in all other tissues, implying that Lhx2 might be involved more in skin metabolism than in any other tissues. Since the Lhx2 mRNA expression level in skin was much higher than that in all the other 11 tissues, it was essential to provide additional evidences of expression patterns for better understanding of its role at different development stages in secondary hair follicles. The function of Lhx2 in the hair follicle has been addressed previously, concluding that Lhx2 is important for maintaining the quiescence of the stem cells located in the bulge region (Rhee et al., 2006). It is also founded that Lhx2 is primarily expressed by precursor cells outside of the bulge region where the hair follicle stem cells are located, and it is periodically expressed in regulation of hair formation. Until now, there is no report that focused on Lhx2 expression profile at different development stages of hair follicle in cashmere goat, especially in secondary hair follicle development. To further understanding the function of Lhx2 in the development of cashmere goat secondary hair follicle, we conducted qPCR analysis in the secondary hair follicle cycles. The results showed that the Lhx2 gene expression reached its peak at the anagen stage and decreased at other stages, implying that Lhx2 may stimulate the activity of hair follicles and control the growth of fibers. The expression of Lhx2 protein was also low at the telogen stage, increased and reached a maximum at the anagen stage, and then decreased at the catagen stage. Moreover, the expression pattern of Lhx2 protein was largely consistent with the relative mRNA expressions in secondary hair follicle at different development stages, together with a significant correlation between them. Hence, the mRNA and protein expression of Lhx2 were consistent throughout the development cycle in secondary hair follicles. Their relative expression varied according to the development stage of secondary hair follicle cycle, which was higher at the anagen stage, lower at the catagen and telogen stages. These findings suggested that the cyclic expression of Lhx2 might have physiological roles in secondary hair follicle development in cashmere goat. Nevertheless, these evidences were not sufficient to draw a conclusive inference about the role of Lhx2 in this process.
R. Geng et al./Gene Expression Patterns 16 (2014) 31–35
Acknowledgments This research was supported by the National Natural Science Foundation of China (Grant No. 31101684 and 31101747), the Natural Science Foundation of Jiangsu Province (BK20141259), the Natural Science Foundation (2014JM3068) and International SciTech Cooperation Program (2014KW14-01) of Shaanxi province, the Major Projects for New Varieties of Genetically Modified Organisms of China (2014ZX08008-002) and sponsored by Qing Lan Project of Jiangsu Province. References Ansari-Renani, H.R., Ebadi, Z., Moradi, S., Baghershah, H.R., Ansari-Renani, M.Y., Ameli, S.H., 2011. Determination of hair follicle characteristics, density and activity of Iranian cashmere goat breeds. Small Rumin. Res. 95 (2–3), 128–132. Dahl, L., Richter, K., Hägglund, A.C., Carlsson, L., 2008. Lhx2 expression promotes self-renewal of a distinct multipotential hematopoietic progenitor cell in embryonic stem cell-derived embryoid bodies. PLoS ONE 3 (4), e2025. Dawid, I.B., Breen, J.J., Toyama, R., 1998. LIM domains: multiple roles as adapters and functional modifiers in protein interactions. Trends Genet. 14, 156–162. Geng, R.Q., Yuan, C., Chen, Y.L., 2013. Exploring differentially expressed genes by RNA-Seq in cashmere goat (Capra hircus) skin during hair follicle development and cycling. PLoS ONE 8 (4), e62704. Geng, R.Q., Yuan, C., Chen, Y.L., 2014. Molecular cloning and expression analysis of prostaglandin E receptor 2 gene in cashmere goat (Capra hircus) skin during hair follicle development. Anim. Biotechnol. 25 (2), 98–107. He, Y., Cheng, L., Wang, J., Liu, X., Luo, Y., 2012. Identification of the secondary follicle cycle of hexi cashmere goat. Anat. Rec. 295, 1520–1528. Hirota, J., Mombaerts, P., 2004. The LIM-homeodomain protein Lhx2 is required for complete development of mouse olfactory sensory neurons. Proc. Natl. Acad. Sci. USA. 101 (23), 8751–8755. Hobert, O., Westphal, H., 2000. Functions of LIM-homeobox genes. Trends Genet. 16 (2), 75–83. Jurata, L.W., Gill, G.N., 1998. Structure and function of LIM domains. Curr. Top. Microbiol. Immunol. 228, 75–113. Kolterud, A., Wandzioch, E., Carlsson, L., 2004. Lhx2 is expressed in the septum transversum mesenchyme that becomes an integral part of the liver and the formation of these cells is independent of functional Lhx2. Gene Expr. Patterns 4 (5), 521–528.
35
Le Bot, N., 2011. Hair follicles run by clockwork. Nat. Cell Biol. 13, 1394. Li, Y.R., Fan, W.B., Li, C.Q., Yin, J., Zhang, Y.J., Li, J.Q., 2008. Histomorphology research of the secondary follicle cycling of Inner Mongolia cashmere goat. Sci. Agric. Sin. 41 (11), 3920–3926. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T). Method Methods 25, 402–408. McDonald, B., Hoey, W., Hopkins, P., 1987. Cyclical fleece growth in cashmere goats. Crop Pasture Sci. 38, 597–609. Millar, S.E., 2002. Molecular mechanisms regulating hair follicle development. J. Invest. Dermatol. 118, 216–225. Nixon, A.J., Gurnsey, M.P., Betteridge, K., Mitchell, R.J., Welch, R.A.S., 1991. Seasonal hair follicle activity and fibre growth in some New Zealand cashmere-bearing goats&LPKT; Capra hircus&RPKT. J. Zool. 224, 589–598. Park, K.S., Kim, K.K., Kim, K.E., 2012. Histone modification-mediated Lhx2 gene expression. Biochem. Biophys. Res. Commun. 427 (4), 718–724. Porter, F.D., Drago, J., Xu, Y., Cheema, S.S., Wassif, C., Huang, S.P., et al., 1997. Lhx2, a LIM homeobox gene, is required for eye, forebrain, and definitive erythrocyte development. Development 124, 2935–2944. Rhee, H., Polak, L., Fuchs, E., 2006. Lhx2 maintains stem cell character in hair follicles. Science 312, 1946–1949. Ryder, M.L., 1966. Coat structure and seasonal shedding in goats. Anim. Prod. 8, 289–302. Schmidt-Ullrich, R., Paus, R., 2005. Molecular principles of hair follicle induction and morphogenesis. Bioessays 27 (3), 247–261. Shetty, A.S., Godbole, G., Maheshwari, U., Padmanabhan, H., Chaudhary, R., Muralidharan, B., et al., 2013. Lhx2 regulates a cortex-specific mechanism for barrel formation. Proc. Natl Acad. Sci. U.S.A. 110 (50), E4913–E4921. Stenn, K.S., Paus, R., 2001. Controls of hair follicle cycling. Physiol. Rev. 81, 449–494. Törnqvist, G., Sandberg, A., Hägglund, A.C., Carlsson, L., 2010. Cyclic expression of lhx2 regulates hair formation. PLoS Genet. 6 (4), e1000904. Xu, T., Guo, X., Wang, H., Hao, F., Du, X., Gao, X., et al., 2013. Differential gene expression analysis between anagen and telogen of Capra hircus skin based on the de novo assembled transcriptome sequence. Gene 520 (1), 30–38. Zhao, Y., Mailloux, C.M., Hermesz, E., Palkóvits, M., Westphal, H., 2010. A role of the LIM-homeobox gene Lhx2 in the regulation of pituitary development. Dev. Biol. 337 (2), 313–323. Zhu, B., Xu, T., Yuan, J., Guo, X., Liu, D., 2013. Transcriptome sequencing reveals differences between primary and secondary hair follicle-derived dermal papilla cells of the Cashmere goat (Capra hircus). PLoS ONE 8 (9), e76282. Zhu, B., Xu, T., Zhang, Z., Ta, N., Gao, X., Hui, L., et al., 2014. Transcriptome sequencing reveals differences between anagen and telogen secondary hair follicle-derived dermal papilla cells of the Cashmere goat (Capra hircus). Physiol. Genomics 46 (3), 104–111.
Contents lists available at ScienceDirect
Gene Expression Patterns j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e p
Cyclic expression of Lhx2 is involved in secondary hair follicle development in cashmere goat Rongqing Geng a,1, Lanping Wang a,1, Xiaolong Wang b, Yulin Chen b,* a b
College of Life Science and Technology, Yancheng Teachers University, Yancheng 224051, China College of Animal Science and Technology, Northwest A&F University, Yangling 712100, China
A R T I C L E
I N F O
Article history: Received 17 May 2014 Received in revised form 29 July 2014 Accepted 31 July 2014 Available online 13 August 2014 Keywords: Cashmere goat Secondary hair follicle Lhx2 Cyclic expression
A B S T R A C T
Lhx2, a member of LIM homeobox transcription factors, plays a key role in normal tissue development. However, the molecular mechanism of Lhx2 gene in the regulation of the secondary hair follicle cycling in cashmere goat remains largely unknown. In the present study, the Lhx2 gene was cloned and characterized in cashmere goat. The cloned cDNA of Lhx2 was 1233 bp in length, encoding for proteins of 406 amino acids which contained all functionally important domains conserved among vertebrate Lhx2 gene. Tissue distribution analysis showed that Lhx2 mRNA was highly expressed in the skin and low expressed in all other tissues. Immunohistochemical localization revealed that Lhx2 was expressed in secondary hair follicles. Analysis of expression profiles of Lhx2 mRNA during different development stages in secondary hair follicles showed that the highest expression was observed at the anagen stage, while the lowest expression was detected at the telogen stage. The expression tendency during the development stages was that it increased from telogen to anagen, decreased from anagen to catagen, and decreased from catagen to telogen. The expression pattern of Lhx2 protein and mRNA was similar. The mRNA and protein expression of Lhx2 were consistent throughout the development cycle in secondary hair follicles. These findings provided a better understanding of the function of Lhx2 and suggested that the cyclic expression of Lhx2 might play important roles during secondary hair follicle development in cashmere goat. © 2014 Published by Elsevier B.V.
Cashmere is the fine, undercoat fibers (down) of cashmere goats. Cashmere goat is heterogeneous fleece composed of wool and cashmere which are respectively generated by the primary hair follicles and the secondary hair follicles. Although their structures and composition are very similar, the secondary hair follicle is differentiated from the primary hair follicle. The hair follicle cycle of cashmere goat is composed of anagen (active), catagen (quiescent) and telogen (inactive) phases. The process of seasonal hair follicle cycle and fiber shedding in cashmere goat has been described extensively by previously studies (Ansari-Renani et al., 2011; He et al., 2012; Li et al., 2008; McDonald et al., 1987; Nixon et al., 1991; Ryder, 1966). Although basic principles and molecular mechanisms that govern hair follicle development and cyclic regeneration have been revealed in humans (Le Bot, 2011; Millar, 2002; Schmidt-Ullrich and Paus, 2005; Stenn and Paus, 2001), molecular mechanisms that regulate the development and postnatal growth of the hair follicle in cashmere goat are still not clear. The recent and ongoing
* Corresponding author at: College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi Province 712100, China. Tel.: +86-29-87091130; fax: +86-29-87091130. E-mail address: [email protected] (Y. Chen). 1 The first two authors contributed equally to this work. http://dx.doi.org/10.1016/j.gep.2014.07.004 1567-133X/© 2014 Published by Elsevier B.V.
development of next-generation sequencing technologies provide accurate and digital gene expression profiles of transcripts and have been used in mRNA sequencing for cashmere goat. Numerous differentially expressed genes have been identified between different hair follicle developmental stages at the transcriptional level, which will provide useful information for researches on hair follicle development in cashmere goat (Geng et al., 2013; Xu et al., 2013; Zhu et al., 2013, 2014). LIM-homeodomain family, a class of transcription factors, regulates many important developmental processes such as asymmetric cell division, tissue specification and differentiation of specific cell types (Hobert and Westphal, 2000). One member of this gene family, Lhx2, was independently isolated as a transcription factor binding to the glycoprotein hormone α-subunit promoter and has been shown to be essential in regulating fundamental processes which is important for organ/tissue generation and regeneration (Dahl et al., 2008; Kolterud et al., 2004; Park et al., 2012; Shetty et al., 2013; Zhao et al., 2010). It is also confirmed that Lhx2 gene is active during the growth phase of the hair follicles and is turned off during the resting phase (Törnqvist et al., 2010). Hence, Lhx2 is functionally involved in hair formation and is an important regulator of hair growth. The purpose of this study was to elucidate the regulation roles of Lhx2 gene during secondary hair follicle development. Firstly, Lhx2 gene was cloned and characterized from cashmere goat skin. Then,
32
R. Geng et al./Gene Expression Patterns 16 (2014) 31–35
the tissue distribution of Lhx2 gene was examined and immunohistochemistry was performed to detect the precise position of Lhx2 in the secondary hair follicle, which was the main tissue responsible for cashmere formation. Finally, the expression profiles of the Lhx2 gene in the secondary hair follicle at different postnatal developmental stages were examined. 1. Materials and methods 1.1. Animals and tissue sampling The Shaanbei white cashmere goats were obtained from the Shaanbei Cashmere Goats Engineering Technology Research Center (Shaanxi, China). Twenty adult individuals (10 males and 10 females) were randomly selected and any two or more individuals with traceable phylogenetic relationship were avoided in the sampling process. The skin samples were collected according to a previous study (Geng et al., 2014). Briefly, about 1 cm2 skin tissue was harvested from the right mid-side of an adult cashmere goat by surgical method. Secondly, the skin tissue was rinsed in ice-cold DEPC-treated water and was cut into small pieces. Lastly, the skin samples were immediately frozen in liquid nitrogen and then stored at −80 °C until RNA extraction. The skin samples were collected from the same individuals at different development stages. 1.2. cDNA cloning, sequencing and sequence analysis Total RNA was isolated using TRIzol reagent (Takara, Dalian, China) according to the manufacturer’s protocol and stored at −80 °C. The isolated RNA was applied to synthesize the first-strand cDNA using the PrimeScript RT reagent Kit with gDNA Eraser (Takara, Dalian, China). Based on the sequence of bovine Lhx2 gene (NM_001191175), a pair of primers (Table 1) was designed to amplify the complete coding region of cashmere goat Lhx2 gene. PCR amplifications were conducted in a final volume of 50 μL with 1 μL first strand cDNA, 25 μL Premix Taq and 1 μL of each primer (10 pmol/μL). The PCR amplification conditions were programmed as 5 min predenaturation at 94 °C, followed by 32 cycles of denaturation at 94 °C for 30 s, annealing at 63 °C for 45 s, extension at 72 °C for 60 s, then final extension at 72 °C for 10 min. The PCR amplification product was examined by 1% agarose gel. The PCR product was purified and ligated into the pMD18-T Vector (Takara, Dalian, China). Three different individual positive clones were sequenced on an ABI 3700 sequencer (Applied Biosystems) by Sangon Biotech Co., Ltd. (Shanghai, China). Sequence homology analysis was obtained from Blast suite program of NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and the deduced amino acid sequence was analyzed by the Protparam program of ExPASy (http://web.expasy.org/protparam/). The signal peptide cleavage site was predicted by the SignalP 4.0 Server (http:// www.cbs.dtu.dk/services/SignalP/). Putative transmembrane domain was predicted by using TMHMM Server v. 2.0. Protein domains were predicted by prosite program of ExPASy (http://prosite.expasy.org/ prosite.html).
Table 1 Primers used for cloning and real-time PCR. Sequence (5′–3′)
Function
Lhx2
F: GGATCCATGCTGTTCCACAGCCTGTC R: AGCTTTTAGAAAAGGTTGGTAAGAGTCG F: TACCCGAGCAGCCAGAAGA R: GTCGGGGTTGTGGTTAATGG F: TGAACCCCAAAGCCAACC R: AGAGGCGTACAGGGACAGCA
Cloning
β-actin
Total RNA from 12 different tissues, including skin, muscle, subcutaneous fat, brain, heart, liver, spleen, lung, kidney, rumen, large intestine and small intestine, were extracted to investigate the mRNA expression profile of the Lhx2 gene in cashmere goat using qPCR. The β-actin gene was used as the internal reference gene. The primers for Lhx2 and β-actin were designed and showed in Table 1. The qPCR was carried out on an iQ5 system (Bio-Rad, Hercules, CA, USA) using SYBR Premix Ex Taq (TaKaRa, Dalian, China) according the manufacturer’s instructions. The thermal cycling conditions used in the qPCR were 95 °C for 3 min, followed by 40 cycling of 95 °C for 5 s and 60 °C for 1 min. The specificity of the SYBR green PCR signal was confirmed by melting curve analysis. There were three biological and technical replicates, respectively. Relative quantification analyses were performed using the comparative CT method, and the relative gene expression was calculated by using the 2−△△Ct method (Livak and Schmittgen, 2001). 1.4. Localization of Lhx2 in secondary hair follicle by immunohistochemistry Skin tissues were harvested and fixed with 4% paraformaldehyde in PBS at 4 °C for 12 h. The fixed samples were dehydrated, embedded with paraffin, and cut into 10 μm thick section. HE staining was performed on rehydrated samples. For immunohistochemistry, sections were rehydrated, blocked with 5% goat serum, and incubated overnight at 4 °C with primary antibody of rabbit antiLhx2 polyclonal antibody (Bioss, Woburn, MA, USA) according to the recommended ratio. Sections were then incubated with the secondary antibody. The labeled samples were then counterstained with DAB, and a Leica confocal microscope was used to observe and document the results. 1.5. Analysis of the expression pattern of Lhx2 in different development stages of secondary hair follicle The secondary hair follicles were collected from three development stages including anagen, catagen and telogen. Total RNA was extracted from secondary hair follicles of three stages by using RNAprep pure Micro kit (Tiangen, Beijing, China) according to the manufacturer’s protocol. The first strand cDNA was synthesized from purified RNA by reverse transcription PCR and qPCR reaction was also performed according to previous Lhx2 gene expression analysis in different tissues. For the western blot analysis, total proteins were extracted with Total Protein Extraction Kit (KeyGEN, Nanjin, China) from frozen secondary hair follicles of each stage according to the instructions provided by the manufacturer. Equal amounts of total protein were loaded per lane on SDS-PAGE gel. Following electrophoresis, proteins were transferred to a polyvinylidene fluoride membrane, which was then probed with the primary antibodies against Lhx2 or β-actin (Bioss). Then, horseradish peroxidase-conjugated secondary antibody was used. Antibody binding was visualized using an enhanced chemiluminescence system and quantified by densitometric analysis. 1.6. Statistical analysis
Gene
Lhx2
1.3. Tissue-specific expression of Lhx2 gene
qPCR qPCR
The statistical analysis was performed by SPSS 13.0. Significant difference was carried out to compare expression levels using a oneway analysis of variance (ANOVA). The relationship between Lhx2 mRNA and protein expression was examined with the Pearson’s correlation coefficient statistical method. Statistical significance was considered significant at P < 0.05.
R. Geng et al./Gene Expression Patterns 16 (2014) 31–35
33
2. Results 2.1. Molecular cloning and sequence analysis of the Lhx2 gene in cashmere goat The cloned cDNA of Lhx2 gene was 1233 bp, with an open reading frame (ORF) of 1221 bp (KJ872671) coding for a polypeptide of 406 amino acids. The theoretical isoelectric point (pI) and molecular weight (Mw) of Lhx2 protein was 8.48 and 44.38 KDa, respectively. The deduced Lhx2 protein was predicted to possess no signal peptide and transmembrane domain. It included all functionally important domains conserved among vertebrate Lhx2, which consisted of two LIM zinc-binding domains and a homeobox domain. The Lhx2 gene sequence of cashmere goat shared highest identity (99%) to that of the Bos taurus Lhx2 gene (NM_001191175). The deduced amino acid sequence of cashmere goat Lhx2 shared the 100% identity with that of Bos taurus (NP_001178104) and Sus scrofa (NP_001163990), 99% with Homo sapiens (BAG51357), 98% with Ovis aries (XP_004005697), and also shared relatively high identity with other mammalian species. 2.2. Lhx2 mRNA expression profile in different tissues The expression of the Lhx2 mRNA in different tissues was analyzed by qPCR analysis. Although Lhx2 mRNA was ubiquitously expressed in all sampled tissues, its expression level varied dramatically in different tissues (Fig. 1). The Lhx2 mRNA was highly expressed in the skin. A very low expression level was found in other tissues including liver, brain, muscle, subcutaneous fat, heart, spleen, lung, kidney, rumen, large intestine and small intestine. The expression level in the skin was significantly different from those in other tissues (P < 0.05). 2.3. Immunohistochemical analysis of Lhx2 in secondary hair follicle Immunohistochemical detection of Lhx2 in cashmere goat skin showed that it was highly expressed in secondary hair follicles but no expression was found in blank control hair follicles (Fig. 2). In secondary hair follicles, Lhx2 was detected in dermal papilla, matrix, inner root sheath and outer root sheath. Staining intensity of dermal papilla appeared to be slightly weaker than that of matrix, although quantitative analysis was not performed. Immunohistochemical localization of Lhx2 in cashmere goat skin revealed that Lhx2 was expressed in secondary hair follicles. 2.4. Expression profiles of Lhx2 in secondary hair follicle at different development stages The temporal expression profile of Lhx2 mRNA in secondary hair follicle at different development stages was analyzed by qPCR (Fig. 3). A highly significant difference was found between different stages (P < 0.05). The highest expression level was detected at the anagen stage, whereas the telogen stage showed the lowest expression. The expression tendency of Lhx2 mRNA during the development stages was that it increased from telogen to anagen, decreased from anagen to catagen, and decreased from catagen to telogen. The western blotting revealed that Lhx2 protein was expressed in all examined development stages (Fig. 4a). The highest expression of the protein was detected at the anagen stage. The protein level was remarkably decreased at the catagen stage and the telogen stage (Fig. 4b). The relative protein expression levels at different development stages were significantly different (P < 0.05). The level of the Lhx2 protein and mRNA in secondary hair follicles during development stages showed a similar pattern (Fig. 3 and
Fig. 1. The expression patterns of Lhx2 in different tissues. Significant differences (P < 0.05) are indicated by different superscripts and the same superscript means no significance.
Fig. 4b). Correlation analysis between Lhx2 protein and mRNA expression levels showed that the Pearson’s correlation coefficient value was 0.996 and the correlation relationship was significant (P < 0.05). 3. Discussion In the present study, a strategy of reverse transcription PCR method was used to obtain the Lhx2 cDNA sequence. A protein of 406 amino acids encoded by the 1233 bp cDNA sequence was obtained from cashmere goat skin. The length of Lhx2 amino acids sequence in cashmere goat was the same as that of mammalian Lhx2. The obtained cDNA sequence was named as cashmere goat Lhx2 since the deduced protein sequence exhibits more than 98% identity with known cattle and sheep Lhx2 amino acid sequence. It implied that the coding region of cashmere goat Lhx2 gene was successfully cloned for the first time and the whole ORF region was 1221 bp in length. Analysis of amino acid sequence showed that the Lhx2 putative protein sequence of cashmere goat contained three conserved motifs, including two LIM zinc-binding domains and a homeobox
34
R. Geng et al./Gene Expression Patterns 16 (2014) 31–35
Fig. 2. Immunohistochemical localization of Lhx2 in secondary hair follicles of cashmere goat. Positive staining is shown on the left but blank control showed almost no positive staining on the right. Immuno-stained product is observed as a brown deposit.
domain. All these motifs were crucial to the functional Lhx2 protein (Dawid et al., 1998; Hobert and Westphal, 2000; Jurata and Gill, 1998). Lhx2 proteins contain two zinc-coordinated, finger-like LIM domains, that are located N-terminally of the homeodomain. These structures mediated both interactions with other proteins (including transcriptional coregulators and other transcription factors) and intramolecular modulation of DNA binding properties. A centrally located homeobox domain allows interaction with DNA recognition elements in target genes. A number of studies have shown that Lhx2 is essential for the normal development of the forebrain, eye, olfactory system, liver, pituitary and nervous system (Hirota and Mombaerts, 2004; Kolterud et al., 2004; Porter et al., 1997; Shetty et al., 2013; Zhao et al., 2010). qPCR analysis revealed strong tissue-specific expression patterns of the Lhx2 gene in cashmere goat. The Lhx2 mRNA was expressed in all analyzed tissues, which suggests that the Lhx2 gene is ubiquitously expressed in adult cashmere goat and may have multiple functions. However, although Lhx2 was detected in all these tissues, its expression quantity varied from one to the other. The highest mRNA level was detected in the skin, followed by the liver and brain, and meanwhile the lowest mRNA level was observed in the spleen. Further experiments confirmed that Lhx2 protein was located in the secondary hair follicles of cashmere goat skin by im-
Fig. 3. The expression level of Lhx2 mRNA in secondary hair follicle of cashmere goat at different development stages. Significant differences (P < 0.05) are indicated by different superscripts.
Fig. 4. The expression level of Lhx2 protein in secondary hair follicle of cashmere goat at different development stages. (a) Western blotting results. (b) Relative protein levels. Significant differences (P < 0.05) are indicated by different superscripts.
munohistochemistry method. Specifically speaking, the highest mRNA level was detected in the skin and relatively low in all other tissues, implying that Lhx2 might be involved more in skin metabolism than in any other tissues. Since the Lhx2 mRNA expression level in skin was much higher than that in all the other 11 tissues, it was essential to provide additional evidences of expression patterns for better understanding of its role at different development stages in secondary hair follicles. The function of Lhx2 in the hair follicle has been addressed previously, concluding that Lhx2 is important for maintaining the quiescence of the stem cells located in the bulge region (Rhee et al., 2006). It is also founded that Lhx2 is primarily expressed by precursor cells outside of the bulge region where the hair follicle stem cells are located, and it is periodically expressed in regulation of hair formation. Until now, there is no report that focused on Lhx2 expression profile at different development stages of hair follicle in cashmere goat, especially in secondary hair follicle development. To further understanding the function of Lhx2 in the development of cashmere goat secondary hair follicle, we conducted qPCR analysis in the secondary hair follicle cycles. The results showed that the Lhx2 gene expression reached its peak at the anagen stage and decreased at other stages, implying that Lhx2 may stimulate the activity of hair follicles and control the growth of fibers. The expression of Lhx2 protein was also low at the telogen stage, increased and reached a maximum at the anagen stage, and then decreased at the catagen stage. Moreover, the expression pattern of Lhx2 protein was largely consistent with the relative mRNA expressions in secondary hair follicle at different development stages, together with a significant correlation between them. Hence, the mRNA and protein expression of Lhx2 were consistent throughout the development cycle in secondary hair follicles. Their relative expression varied according to the development stage of secondary hair follicle cycle, which was higher at the anagen stage, lower at the catagen and telogen stages. These findings suggested that the cyclic expression of Lhx2 might have physiological roles in secondary hair follicle development in cashmere goat. Nevertheless, these evidences were not sufficient to draw a conclusive inference about the role of Lhx2 in this process.
R. Geng et al./Gene Expression Patterns 16 (2014) 31–35
Acknowledgments This research was supported by the National Natural Science Foundation of China (Grant No. 31101684 and 31101747), the Natural Science Foundation of Jiangsu Province (BK20141259), the Natural Science Foundation (2014JM3068) and International SciTech Cooperation Program (2014KW14-01) of Shaanxi province, the Major Projects for New Varieties of Genetically Modified Organisms of China (2014ZX08008-002) and sponsored by Qing Lan Project of Jiangsu Province. References Ansari-Renani, H.R., Ebadi, Z., Moradi, S., Baghershah, H.R., Ansari-Renani, M.Y., Ameli, S.H., 2011. Determination of hair follicle characteristics, density and activity of Iranian cashmere goat breeds. Small Rumin. Res. 95 (2–3), 128–132. Dahl, L., Richter, K., Hägglund, A.C., Carlsson, L., 2008. Lhx2 expression promotes self-renewal of a distinct multipotential hematopoietic progenitor cell in embryonic stem cell-derived embryoid bodies. PLoS ONE 3 (4), e2025. Dawid, I.B., Breen, J.J., Toyama, R., 1998. LIM domains: multiple roles as adapters and functional modifiers in protein interactions. Trends Genet. 14, 156–162. Geng, R.Q., Yuan, C., Chen, Y.L., 2013. Exploring differentially expressed genes by RNA-Seq in cashmere goat (Capra hircus) skin during hair follicle development and cycling. PLoS ONE 8 (4), e62704. Geng, R.Q., Yuan, C., Chen, Y.L., 2014. Molecular cloning and expression analysis of prostaglandin E receptor 2 gene in cashmere goat (Capra hircus) skin during hair follicle development. Anim. Biotechnol. 25 (2), 98–107. He, Y., Cheng, L., Wang, J., Liu, X., Luo, Y., 2012. Identification of the secondary follicle cycle of hexi cashmere goat. Anat. Rec. 295, 1520–1528. Hirota, J., Mombaerts, P., 2004. The LIM-homeodomain protein Lhx2 is required for complete development of mouse olfactory sensory neurons. Proc. Natl. Acad. Sci. USA. 101 (23), 8751–8755. Hobert, O., Westphal, H., 2000. Functions of LIM-homeobox genes. Trends Genet. 16 (2), 75–83. Jurata, L.W., Gill, G.N., 1998. Structure and function of LIM domains. Curr. Top. Microbiol. Immunol. 228, 75–113. Kolterud, A., Wandzioch, E., Carlsson, L., 2004. Lhx2 is expressed in the septum transversum mesenchyme that becomes an integral part of the liver and the formation of these cells is independent of functional Lhx2. Gene Expr. Patterns 4 (5), 521–528.
35
Le Bot, N., 2011. Hair follicles run by clockwork. Nat. Cell Biol. 13, 1394. Li, Y.R., Fan, W.B., Li, C.Q., Yin, J., Zhang, Y.J., Li, J.Q., 2008. Histomorphology research of the secondary follicle cycling of Inner Mongolia cashmere goat. Sci. Agric. Sin. 41 (11), 3920–3926. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T). Method Methods 25, 402–408. McDonald, B., Hoey, W., Hopkins, P., 1987. Cyclical fleece growth in cashmere goats. Crop Pasture Sci. 38, 597–609. Millar, S.E., 2002. Molecular mechanisms regulating hair follicle development. J. Invest. Dermatol. 118, 216–225. Nixon, A.J., Gurnsey, M.P., Betteridge, K., Mitchell, R.J., Welch, R.A.S., 1991. Seasonal hair follicle activity and fibre growth in some New Zealand cashmere-bearing goats&LPKT; Capra hircus&RPKT. J. Zool. 224, 589–598. Park, K.S., Kim, K.K., Kim, K.E., 2012. Histone modification-mediated Lhx2 gene expression. Biochem. Biophys. Res. Commun. 427 (4), 718–724. Porter, F.D., Drago, J., Xu, Y., Cheema, S.S., Wassif, C., Huang, S.P., et al., 1997. Lhx2, a LIM homeobox gene, is required for eye, forebrain, and definitive erythrocyte development. Development 124, 2935–2944. Rhee, H., Polak, L., Fuchs, E., 2006. Lhx2 maintains stem cell character in hair follicles. Science 312, 1946–1949. Ryder, M.L., 1966. Coat structure and seasonal shedding in goats. Anim. Prod. 8, 289–302. Schmidt-Ullrich, R., Paus, R., 2005. Molecular principles of hair follicle induction and morphogenesis. Bioessays 27 (3), 247–261. Shetty, A.S., Godbole, G., Maheshwari, U., Padmanabhan, H., Chaudhary, R., Muralidharan, B., et al., 2013. Lhx2 regulates a cortex-specific mechanism for barrel formation. Proc. Natl Acad. Sci. U.S.A. 110 (50), E4913–E4921. Stenn, K.S., Paus, R., 2001. Controls of hair follicle cycling. Physiol. Rev. 81, 449–494. Törnqvist, G., Sandberg, A., Hägglund, A.C., Carlsson, L., 2010. Cyclic expression of lhx2 regulates hair formation. PLoS Genet. 6 (4), e1000904. Xu, T., Guo, X., Wang, H., Hao, F., Du, X., Gao, X., et al., 2013. Differential gene expression analysis between anagen and telogen of Capra hircus skin based on the de novo assembled transcriptome sequence. Gene 520 (1), 30–38. Zhao, Y., Mailloux, C.M., Hermesz, E., Palkóvits, M., Westphal, H., 2010. A role of the LIM-homeobox gene Lhx2 in the regulation of pituitary development. Dev. Biol. 337 (2), 313–323. Zhu, B., Xu, T., Yuan, J., Guo, X., Liu, D., 2013. Transcriptome sequencing reveals differences between primary and secondary hair follicle-derived dermal papilla cells of the Cashmere goat (Capra hircus). PLoS ONE 8 (9), e76282. Zhu, B., Xu, T., Zhang, Z., Ta, N., Gao, X., Hui, L., et al., 2014. Transcriptome sequencing reveals differences between anagen and telogen secondary hair follicle-derived dermal papilla cells of the Cashmere goat (Capra hircus). Physiol. Genomics 46 (3), 104–111.