- Email: [email protected]
Cynomolgus monkey embryonic stem cell lines express green fluorescent protein
JOURNAL OF BIOSCIENCE AND BIOENGINEERING Vol. 102, No. 1, 14–20. 2006 DOI: 10.1263/jbb.102.14
© 2006, The Society for Biotechnology, Japan
Cynomolgus Monkey Embryonic Stem Cell Lines Express Green Fluorescent Protein Shigehiko Ueda,1 Masahide Yoshikawa,2* Yukiteru Ouji,2 Ko Saito,1 Kei Moriya,2 Mariko Nishiofuku,2 Noriko Hayashi,2 Shigeaki Ishizaka,2 Keiji Shimada,3 Noboru Konishi,3 and Hiroshi Fukui1 Department of Gastroenterology and Hepatology, Nara Medical University, Kashihara, Nara 634-8521, Japan,1 Department of Parasitology, Nara Medical University, Kashihara, Nara 634-8521, Japan,2 and Department of Pathology, Nara Medical University, Kashihara, Nara 634-8521, Japan 3 Received 20 February 2006/Accepted 4 April 2006
We successfully established cynomolgus monkey embryonic stem (cES) cell lines expressing enhanced green fluorescent protein (GFP) by introducing a GFP-encoding gene under cytomegalovirus immediate early enhancer (CMVIE) promoter regulation into cES cells. The cells maintained the ability of in vitro differentiation toward ectodermal, mesodermal, and endodermal lineages, and produced teratomas composed of tissues derived from the three embryonic germ layers when transplanted into severe combined immunodeficient disease mice. GFP expression was also observed in the differentiated cells. These GFP-expressing cES cell lines are considered useful for basic research, including cell transplantation. [Key words: primate embryonic stem cell, differentiation, embryoid body, teratoma, green fluorescent protein]
Embryonic stem (ES) cells are self-renewing, pluripotent cells derived from the inner cell mass of preimplantation blastocysts (1, 2). They can be expanded without limit and they retain the potential to differentiate into various somatic cell types of the three germ layers. They also show many of the characteristics required of a cell source for cell-replacement therapy, including proliferation and differentiation capacities. We previously demonstrated the differentiation of mouse ES (mES) cells into various cell types, including hepatocytes (3–5), insulin-producing cells (6, 7), intestinal tract-related cells (8), dopamine-producing cells (9) and photoreceptor-like cells (10). Several characteristics are different between mES and primate ES cells (11–13). Therefore, to better understand the differentiation ability and therapeutic potential of human ES cells, the use of primate ES cells is indispensable. Monkey ES cells are considered to be one of the best candidates for studying the potential ability of ES cells for regenerative medicine, as human ES cells are not freely available for research. In this study, we successfully established cynomolgus monkey ES (cES) cell lines expressing enhanced green fluorescent protein (GFP) by introducing a GFP-encoding gene under cytomegalovirus immediate early enhancer (CMVIE) promoter regulation into cES cells, and examined them in regard to in vitro differentiation and in vivo tumor formation. The cells retained an ability of in vitro differentiation toward ectodermal, mesodermal, and endodermal lineages, and also produced teratomas composed of tissues de-
rived from the three embryonic germ layers when transplanted into severe combined immunodeficient disease (SCID) mice. We believe that these GFP-expressing cES cells are useful for basic research, including cell transplantation. MATERIALS AND METHODS cES cells cES cell line (14) was obtained from Asahi Techno Glass, Tokyo. Undifferentiated cES cells were maintained on a feeder layer of 40 Gy-irradiated mouse embryonic fibroblasts (MEF) in DMEM/F-12 (Asahi Techno Glass) supplemented with 20% Knockout Serum Replacement (KSR; GIBCO-Invitrogen, Carlsbad, CA, USA), 0.1 mM 2-mercaptoethanol, 1 mM sodium pyruvate, 2 mM l-glutamine, 0.1 mM nonessential amino acids, and a penicillin (25 U/ml)–streptomycin (25 µg/ml) mixture. The medium was changed daily. Cell colonies composed of closely packed cells were split every 3–4 d by incubation in 0.25% trypsin–EDTA solution for 5 min at 37°C before transfer by pipetting onto 40 Gyirradiated MEF cells. Plasmid and transfection A pIRES2-EGFP vector (Clontech Laboratories, Takara Biotech, Ohtsu, Shiga) was used to obtain stably transfected cell lines. This vector, which contains IRES between the multiple cloning site (MCS) and EGFP coding regions, was transfected to cES cells while carrying no genes in the MCS. For stable transfection, cES cells were collected from three 6-cm dishes containing approximately 1000 cES colonies in total and plated on a single 6-cm gelatin-coated dish containing 1×106 feeder cells, then cultured for 48 h. Next, 40 µl of transfection reagent and 1000 µl of DMEM/F-12 were mixed (solution 1), and 8 µg of DNA and 1000 µl of DMEM/F-12 were mixed (solution 2), then the two solutions were combined to make the DNA–Lipofectamine 2000 complex. Twenty minutes after producing the DNA–Lipofectamine 2000 complex, it was added to dishes containing 4 ml of normal medium containing 20% KSR. The cells were then incu-
* Corresponding author. e-mail: [email protected] phone: +81-(0)744-22-3051 ext. 3415 fax: +81-(0)744-24-7122 14
VOL. 102, 2006
bated for 24 h in these dishes and rinsed twice with PBS, after which they were cultured for 1 d in fresh medium containing 20% KSR. Two days after transfection, cES cells were collected by trypsin treatment and cultured in 60-mm gelatin-coated tissue culture dishes containing neomycin-resistant mouse embryonic fibroblasts (Dainippon Sumitomo Pharma, Tokyo) as feeder cells. Three days after transfection, G418 was added at a final concentration of 200 µg/ml. G418-resistant colonies that appeared after 14 d were selected, dissociated, and plated onto 24-well gelatin-coated feedercontaining plates, and then grown as described above and subjected to further analysis. Culture for in vitro differentiation To investigate the differentiation of cES cells expressing GFP, undifferentiated cells were cultured for 5 d in hanging drops, during which they formed cellular aggregates, known as embryoid bodies (EBs). To successfully produce EBs, a large number of cES cells were required, as compared with our previous experiments using mouse ES cells (4–8). Two thousand cES cells were cultured in 20 µl drops of DMEM supplemented with 10% FBS, 0.1 mM 2-mercaptoethanol, 0.1 mM nonessential amino acids, and 1 mM sodium pyruvate. After 5 d, the resulting EBs (n =20) were plated onto a 10-cm gelatin-coated plastic dish and allowed to attach for an outgrowth culture. After 3 weeks of spontaneous differentiation in the attachment culture, differentiated cells were immunocytochemically examined. In some experiments, 5-day-old EBs were dissociated and cultured on laminin-coated dishes in the presence of all trans-retinoic acid (ATRA; Sigma, St. Louis, MO, USA) at a final concentration of 5× 10–7 M for 14 d. Alkaline phosphatase (ALP) reaction For an ALP reaction, the cells were fixed with 4% paraformaldehyde for 10 min at 4°C and treated with 99.5% ethanol for 10 min. Then, the cells were bathed in distilled water for 30 min and ALP activity was detected using a Vector Red Alkaline Phosphatase Substrate kit I (Vector Laboratories, Burlingame, CA, USA). Immunocytochemistry For immunocytochemistry, the cells were fixed with 99.5% ethanol at −30°C and incubated overnight with goat anti-nestin polyclonal antibody (G-20; Santa Cruz Biotech, Santa Cruz, CA, USA), mouse anti-smooth muscle actin (SMA) monoclonal antibody (CGA7; Chemicon, Temecula, CA, USA), mouse anti-human α-fetoprotein (AFP) (Biomeda, Foster City, CA, USA), and mouse anti-neurofilament (NF) L antibody (DA2; Zymed, Invitrogen), followed by treatment with secondary antibodies (Alexa 488 rabbit anti-goat IgG, Alexa 488 rabbit antimouse IgG, Alexa 594 rabbit anti-mouse IgG, Alexa 594 rabbit anti-mouse IgG; Molecular Probes, Invitrogen). RT-PCR For RNA extraction and RT-PCR analysis, total RNA was purified using Trizol (Invitrogen) following the protocol of the manufacturer. One microgram of DNase-treated total RNA was used for the first-strand cDNA reaction, which was performed using a random primer (Invitrogen) and M-MLV reverse transcriptase (Promega, Madison, WI, USA). cDNA samples were subjected to PCR amplification using specific primers under linear conditions to reflect the original amount of the specific transcript. The cycling parameters were as follows: denaturation at 94°C for 1 min, annealing at 55–60°C for 1 min (depending on the primer), and elongation at 72°C for 1 min (40 cycles). The PCR primers and length of the amplified products were as follows: GAPDH, CTCA AGATCATCAGCAATGCC and GATGGTACATGACAAGGT GC, 755 bp; GEP, AGCAAGGGCGAGGAGCTGTT and GTAG GTCAGGGTGGTCACGA, 195 bp; Oct3/4, CGACCATCTGCC GCTTTGAG and CCCCCTGTCCCCCATTCCTA, 577 bp; Rex1, GCGTACGCAAATTAAAGTCCAGA and CAGCATCCTAAAC AGCTCGCAGAAT, 306 bp. The PCR products were run on 1.5% agarose gels. Teratoma formation To investigate the differentiation potential of cES cells in vivo, 5 ×105 cells were grafted into the peri-
MONKEY ES CELLS EXPRESSING GFP
15
toneal cavity of two SCID mice and the resulting teratomas were analyzed.
RESULTS cES clones expressing GFP (GFP-cES clones) Clones stable for selection were screened for GFP fluorescence microscopically, after which three clones were finally selected and named cES1, cES2, and cES3. All three cES clones expressed mRNA for GFP, Oct3/4, and Rex1 (Fig. 1A). Oct3/4 is a representative marker of an undifferentiated state in mouse and primate ES cells (11–13), whereas Rex1 is expressed in human ES cells (15). cES1, cES2, and cES3 colonies all showed green fluorescence under UV light and distinct ALP activity. The colonies of cES1 cells on day 4, after passage 12, are shown in Fig. 1B and 1C. All the cES1 colonies were fluorescent (Fig. 1B) and showed high ALP activity (Fig. 1C). The feeder cells were not fluorescent under UV light nor stained red by the procedure for detecting ALP activity. After more than 30 passages, the GFP-cES cells retained their fluorescence and ALP activity. Because each GFP-expressing clone presented similar results in the following experiments, the results for cES1 are presented as representative of all the clones for the following findings. In vitro differentiation cES1 cells were cultured for 5 days in hanging drops and formed EBs, which were allowed to attach while being cultured (20 EBs per 10-cm dish). Figure 2A shows a single EB just after attaching to a dish. After 5 d, the EBs retained fluorescence and after 10 d, beating cells emerged in about half of the EB outgrowths. Three weeks after allowing the EBs to attach during culture, the cells were immunostained for SMA (mesoderm-derived marker), AFP (endoderm-derived marker), and nestin (ectoderm-derived marker). SMA-immunopositive cells, as well as nestin- and AFP-immunopositive cells, were found in the EB outgrowths (Fig. 2B), indicating the ability of cES1 cells to differentiate into derivatives from the three embryonic germ layers in vitro. We also found that cES cells differentiated into mature neurons in the EB cultures in the presence of ATRA, a stimulator of neuronal differentiation. Cells harboring long neurites were also observed and the neurites were distinctly immunoreactive to the anti-neurofilament antibody (Fig. 2C). In vivo differentiation In vivo differentiation was examined by inoculating 5 ×105 cES1 cells into the peritoneal cavity of two SCID mice. Two months later, tumor formation was evident in both mice. Figure 3A shows one of the mice developing a cES1-derived tumor in the peritoneal cavity. The tumor was macroscopically composed of various components, including cyst-like structures, and emitted green fluorescence under UV light (Fig. 3B). Furthermore, hairs had formed in the tumor, some of which were visible on the tumor surface. As shown in Fig. 4A, it was microscopically confirmed that the tumor was composed of various tissues. Histological analysis further revealed that it contained various tissues derived from the three embryonic germ layers: squamous cells, hair, neurons, and melanocytes (ectoderm), bone, cartilage, muscle, and fat cells (mesoderm), and ciliated columnar epithelia and gut epithelia (en-
16
J. BIOSCI. BIOENG.,
UEDA ET AL.
FIG. 1. cES clones expressing GFP (GFP-cES clones). (A) The cES1, cES2, and cES3 clones, but not parental cES cells, expressed mRNA for GFP. The three clones also expressed mRNA for Oct-3/4 and Rex-1, as obseved with the parental cES cells. (B, C) Colonies from cES1 cells on day 4, after passage 12, are shown (asterisk). All of the cES1 colonies were fluorescent (B) and showed high levels of ALP activity (C).
doderm) (Fig. 4B–M). DISCUSSION ES cells are clonal cell lines derived from the inner cell mass of developing blastocysts. The distinguishing features
of these cells are their capacity to renew themselves and differentiate into a broad spectrum of derivatives of all three embryonic germ layers; ectoderm, mesoderm, and endoderm. Mouse ES cells were first established in 1981 (1, 2) and human ES cells in 1998 (16). The multi-lineage differentiation ability of ES cells has drawn clinical attention to
VOL. 102, 2006
MONKEY ES CELLS EXPRESSING GFP
17
FIG. 2. Retained ability of in vitro differentiation. (A) The cES1 cells could form EBs in hanging drop cultures and retained fluorescence. (B) EB outgrowths containing cells differentiated into lineages of the three embryonic germ layers are shown. Immunopositivities against smooth muscle actin (SMA), α-fetoprotein (AFP), and nestin were used as representative makers for mesoderm-, endoderm-, and ectoderm-derived cells, respectively. (C) In the EB outgrowths cultured in the presence of ATRA, cells with long neurites were observed. The neurites were immunostained with the anti-neurofilament (NF) antibody.
18
UEDA ET AL.
J. BIOSCI. BIOENG.,
FIG. 3. Tumor formation in SCID mice. (A) A teratoma, outlined by the red dotted line, developed in the peritoneal cavity of a SCID mouse two months after inoculation of 5 ×105 cES1 cells is shown. (B) The excised tumor was macroscopically found to be composed of various components, including cyst-like structures, and emitted green fluorescence under UV light. Hairs were visible on the surface of the tumor.
their possible use in novel therapeutic strategies, such as cell transplantation and tissue regeneration. However, several characteristics are different between mouse and human ES cells, including the techniques required for maintaining cultures of undifferentiated cells, whereas nonhuman primate ES cells are much more similar to human ES cells than mouse ES cells (11–13). Therefore, increasing knowledge
concerning nonhuman ES cells is indispensable before starting human ES-based therapy. In the present study, we were able to obtain cynomolgus ES (cES) cells expressing GFP. Although human ES cells expressing GFP have already been established (17), human ES cells are not freely available at this time. Regarding the establishment of cES cells expressing GFP, two studies have been reported (18, 19).
VOL. 102, 2006
MONKEY ES CELLS EXPRESSING GFP
19
FIG. 4. Histological analysis of the tumor. (A) The tumor was composed of various tissues. (B–M) The various tissues included squamous epithelia (B, C), hair follicles (D, E), rosette-like structures (F), brain tissue-like structures (G), pigment cells (H), bone formation (I, asterisk), cartilage formation (J), adipose tissue (K), epithelia containing goblet cells (L), and ciliated columnar epithelia (M). (Panels C and E correspond to the areas outlined by squares in panels B and D, respectively.)
20
J. BIOSCI. BIOENG.,
UEDA ET AL.
Sasaki et al. (18) used the non-integrating Sendai virus vector to introduce the GFP gene into cES cells and noted that the GFP gene remained stably expressed in the cES cells for up to one year. However, the non replicating transgene was diluted out of the cells with repeated division. Takada et al. (19) also successfully produced cES cells expressing GFP by introducing a GFP expression vector construct using electroporation. In this study, we applied a lipofection technique to introduce the GFP gene to cES cells. We transfected a plasmid containing the GFP coding gene under the CMVIE promoter into cES cells and obtained three cES clones expressing GFP. Each clone could differentiate into derivatives of the three embryonic germ layers in vitro and produced teratomas in SCID mice. The EBs formed in vitro and the teratomas formed in SCID mice emitted green fluorescence under UV light, suggesting that stable expression of the transfected EGFP gene was maintained during differentiation. In this study, we did not perform implantation of GFPcES cells into blastocysts, thus the ability of these cells to form chimeras in developing fetus tissues was not examined. In a strict sense, GFP-cES cells should be called stem cell-like cells based on the results presented. However, parental cES cells have been well characterized as ES cells (14). Because GFP-expressing cES cells were obtained by a gene transfection technique, they are considered likely to behave as ES cells and are useful for basic research, including cell transplantation.
7.
8.
9.
10.
11. 12. 13. 14.
REFERENCES 1. Evans, M. J. and Kaufman, M. H.: Establishment in culture of pluripotent cells from mouse embryos. Nature, 292, 154– 156 (1981). 2. Martin, G. R.: Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. USA, 78, 7634– 7638 (1981). 3. Yamada, T., Yoshikawa, M., Kanda, S., Kato, Y., Nakajima, Y., Ishizaka, S., and Tsunoda, Y.: In vitro differentiation of embryonic stem cells into hepatocyte-like cells identified by cellular uptake of indocyanine green. Stem Cells, 20, 146–154 (2002). 4. Kanda, S., Shiroi, A., Ouji, Y., Birumachi, J., Ueda, S., Fukui, H., Tatsumi, K., Ishizaka, S., Takahashi, Y., and Yoshikawa, M.: In vitro differentiation of hepatocyte-like cells from embryonic stem cells promoted by gene transfer of hepatocyte nuclear factor 3 beta. Hepatol. Res., 26, 225–231 (2003). 5. Ishizaka, S., Shiroi, A., Kanda, S., Yoshikawa, M., Tsujinoue, H., Kuriyama, S., Hasuma, T., Nakatani, K., and Takahashi, K.: Development of hepatocytes from ES cells after transfection with the HNF-3beta gene. FASEB J., 6, 1444–1446 (2002). 6. Shiroi, A., Yoshikawa, M., Yokota, H., Fukui, H., Ishizaka,
15.
16.
17.
18.
19.
S., Tatsumi, K., and Takahashi, Y.: Identification of insulinproducing cells derived from embryonic stem cells by zincchelating dithizone. Stem Cells, 20, 284–292 (2002). Shiroi, A., Ueda, S., Ouji, Y., Saito, K., Moriya, K., Sugie, Y., Fukui, H., Ishizaka, S., and Yoshikawa, M.: Differentiation of embryonic stem cells into insulin-producing cells promoted by Nkx2.2 gene transfer. World J. Gastroenterol., 21, 161–166 (2005). Yamada, T., Yoshikawa, M., Takaki, M., Torihashi, S., Kato, Y., Nakajima, Y., Ishizaka, S., and Tsunoda, Y.: In vitro functional gut-like organ formation from mouse embryonic stem cells. Stem Cells, 20, 41–49 (2002). Nishimura, F., Yoshikawa, M., Kanda, S., Nonaka, M., Yokota, H., Shiroi, A., Nakase, H., Hirabayashi, H., Ouji, Y., Birumachi, J., Ishizaka, S., and Sakaki, T.: Potential use of embryonic stem cells for the treatment of mouse parkinsonian models: improved behavior by transplantation of in vitro differentiated dopaminergic neurons from embryonic stem cells. Stem Cells, 21, 171–180 (2003). Sugie, Y., Yoshikawa, M., Ouji, Y., Saito, K., Moriya, K., Ishizaka, S., Matsuura, T., Maruoka, S., Nawa, Y., and Hara, Y.: Photoreceptor cells from mouse ES cells by coculture with chick embryonic retina. Biochem. Biophys. Res. Commun., 332, 241–247 (2005). Odorico, J. S., Kaufman, D. S., and Thomson, J. A.: Multilineage differentiation from human embryonic stem cell lines. Stem Cells, 19, 193–204 (2001). Ulloa-Montoya, F., Verfaillie, C. M., and Hu, W. S.: Culture systems for pluripotent stem cells. J. Biosci. Bioeng., 100, 12–27 (2005). Boiani, M. and Scholer, H. R.: Regulatory networks in embryo-derived pluripotent stem cells. Nat. Rev. Mol. Cell. Biol., 6, 872–884 (2005). Suemori, H., Tada, T., Torii, R., Hosoi, Y., Kobayashi, K., Imahie, H., Kondo, Y., Iritani, A., and Nakatsuji, N.: Establishment of embryonic stem cell lines from cynomolgus monkey blastocysts produced by IVF or ICSI. Dev. Dyn., 222, 273–279 (2001). Henderson, J. K., Draper, J. S., Baillie, H. S., Fishel, S., Thomson, J. A., Moore, H., and Andrews, P. W.: Preimplantation human embryos and embryonic stem cells show comparable expression of stage-specific embryonic antigens. Stem Cells, 20, 329–337 (2002). Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel, J. J., Marshall, V. S., and Jones, J. M.: Embryonic stem cell lines derived from human blastocysts. Science, 282, 1145–1147 (1998). Liu, Y. P., Dovzhenko, O. V., Garthwaite, M. A., Dambaeva, S. V., Durning, M., Pollastrini, L. M., and Golos, T. G.: Maintenance of pluripotency in human embryonic stem cells stably over-expressing enhanced green fluorescent protein. Stem Cells Dev., 13, 636–645 (2004). Sasaki, K., Inoue, M., Shibata, H., Ueda, Y., Muramatsu, S. I., Okada, T., Hasegawa, M., Ozawa, K., and Hanazono, Y.: Efficient and stable Sendai virus-mediated gene transfer into primate embryonic stem cells with pluripotency preserved. Gene Ther., 12, 203–210 (2005). Takada, T., Suzuki, Y., Kondo, Y., Kadota, N., Kobayashi, K., Nito, S., Kimura, H., and Torii, R.: Monkey embryonic stem cell lines expressing green fluorescent protein. Cell Transplant., 11, 631–635 (2002).
© 2006, The Society for Biotechnology, Japan
Cynomolgus Monkey Embryonic Stem Cell Lines Express Green Fluorescent Protein Shigehiko Ueda,1 Masahide Yoshikawa,2* Yukiteru Ouji,2 Ko Saito,1 Kei Moriya,2 Mariko Nishiofuku,2 Noriko Hayashi,2 Shigeaki Ishizaka,2 Keiji Shimada,3 Noboru Konishi,3 and Hiroshi Fukui1 Department of Gastroenterology and Hepatology, Nara Medical University, Kashihara, Nara 634-8521, Japan,1 Department of Parasitology, Nara Medical University, Kashihara, Nara 634-8521, Japan,2 and Department of Pathology, Nara Medical University, Kashihara, Nara 634-8521, Japan 3 Received 20 February 2006/Accepted 4 April 2006
We successfully established cynomolgus monkey embryonic stem (cES) cell lines expressing enhanced green fluorescent protein (GFP) by introducing a GFP-encoding gene under cytomegalovirus immediate early enhancer (CMVIE) promoter regulation into cES cells. The cells maintained the ability of in vitro differentiation toward ectodermal, mesodermal, and endodermal lineages, and produced teratomas composed of tissues derived from the three embryonic germ layers when transplanted into severe combined immunodeficient disease mice. GFP expression was also observed in the differentiated cells. These GFP-expressing cES cell lines are considered useful for basic research, including cell transplantation. [Key words: primate embryonic stem cell, differentiation, embryoid body, teratoma, green fluorescent protein]
Embryonic stem (ES) cells are self-renewing, pluripotent cells derived from the inner cell mass of preimplantation blastocysts (1, 2). They can be expanded without limit and they retain the potential to differentiate into various somatic cell types of the three germ layers. They also show many of the characteristics required of a cell source for cell-replacement therapy, including proliferation and differentiation capacities. We previously demonstrated the differentiation of mouse ES (mES) cells into various cell types, including hepatocytes (3–5), insulin-producing cells (6, 7), intestinal tract-related cells (8), dopamine-producing cells (9) and photoreceptor-like cells (10). Several characteristics are different between mES and primate ES cells (11–13). Therefore, to better understand the differentiation ability and therapeutic potential of human ES cells, the use of primate ES cells is indispensable. Monkey ES cells are considered to be one of the best candidates for studying the potential ability of ES cells for regenerative medicine, as human ES cells are not freely available for research. In this study, we successfully established cynomolgus monkey ES (cES) cell lines expressing enhanced green fluorescent protein (GFP) by introducing a GFP-encoding gene under cytomegalovirus immediate early enhancer (CMVIE) promoter regulation into cES cells, and examined them in regard to in vitro differentiation and in vivo tumor formation. The cells retained an ability of in vitro differentiation toward ectodermal, mesodermal, and endodermal lineages, and also produced teratomas composed of tissues de-
rived from the three embryonic germ layers when transplanted into severe combined immunodeficient disease (SCID) mice. We believe that these GFP-expressing cES cells are useful for basic research, including cell transplantation. MATERIALS AND METHODS cES cells cES cell line (14) was obtained from Asahi Techno Glass, Tokyo. Undifferentiated cES cells were maintained on a feeder layer of 40 Gy-irradiated mouse embryonic fibroblasts (MEF) in DMEM/F-12 (Asahi Techno Glass) supplemented with 20% Knockout Serum Replacement (KSR; GIBCO-Invitrogen, Carlsbad, CA, USA), 0.1 mM 2-mercaptoethanol, 1 mM sodium pyruvate, 2 mM l-glutamine, 0.1 mM nonessential amino acids, and a penicillin (25 U/ml)–streptomycin (25 µg/ml) mixture. The medium was changed daily. Cell colonies composed of closely packed cells were split every 3–4 d by incubation in 0.25% trypsin–EDTA solution for 5 min at 37°C before transfer by pipetting onto 40 Gyirradiated MEF cells. Plasmid and transfection A pIRES2-EGFP vector (Clontech Laboratories, Takara Biotech, Ohtsu, Shiga) was used to obtain stably transfected cell lines. This vector, which contains IRES between the multiple cloning site (MCS) and EGFP coding regions, was transfected to cES cells while carrying no genes in the MCS. For stable transfection, cES cells were collected from three 6-cm dishes containing approximately 1000 cES colonies in total and plated on a single 6-cm gelatin-coated dish containing 1×106 feeder cells, then cultured for 48 h. Next, 40 µl of transfection reagent and 1000 µl of DMEM/F-12 were mixed (solution 1), and 8 µg of DNA and 1000 µl of DMEM/F-12 were mixed (solution 2), then the two solutions were combined to make the DNA–Lipofectamine 2000 complex. Twenty minutes after producing the DNA–Lipofectamine 2000 complex, it was added to dishes containing 4 ml of normal medium containing 20% KSR. The cells were then incu-
* Corresponding author. e-mail: [email protected] phone: +81-(0)744-22-3051 ext. 3415 fax: +81-(0)744-24-7122 14
VOL. 102, 2006
bated for 24 h in these dishes and rinsed twice with PBS, after which they were cultured for 1 d in fresh medium containing 20% KSR. Two days after transfection, cES cells were collected by trypsin treatment and cultured in 60-mm gelatin-coated tissue culture dishes containing neomycin-resistant mouse embryonic fibroblasts (Dainippon Sumitomo Pharma, Tokyo) as feeder cells. Three days after transfection, G418 was added at a final concentration of 200 µg/ml. G418-resistant colonies that appeared after 14 d were selected, dissociated, and plated onto 24-well gelatin-coated feedercontaining plates, and then grown as described above and subjected to further analysis. Culture for in vitro differentiation To investigate the differentiation of cES cells expressing GFP, undifferentiated cells were cultured for 5 d in hanging drops, during which they formed cellular aggregates, known as embryoid bodies (EBs). To successfully produce EBs, a large number of cES cells were required, as compared with our previous experiments using mouse ES cells (4–8). Two thousand cES cells were cultured in 20 µl drops of DMEM supplemented with 10% FBS, 0.1 mM 2-mercaptoethanol, 0.1 mM nonessential amino acids, and 1 mM sodium pyruvate. After 5 d, the resulting EBs (n =20) were plated onto a 10-cm gelatin-coated plastic dish and allowed to attach for an outgrowth culture. After 3 weeks of spontaneous differentiation in the attachment culture, differentiated cells were immunocytochemically examined. In some experiments, 5-day-old EBs were dissociated and cultured on laminin-coated dishes in the presence of all trans-retinoic acid (ATRA; Sigma, St. Louis, MO, USA) at a final concentration of 5× 10–7 M for 14 d. Alkaline phosphatase (ALP) reaction For an ALP reaction, the cells were fixed with 4% paraformaldehyde for 10 min at 4°C and treated with 99.5% ethanol for 10 min. Then, the cells were bathed in distilled water for 30 min and ALP activity was detected using a Vector Red Alkaline Phosphatase Substrate kit I (Vector Laboratories, Burlingame, CA, USA). Immunocytochemistry For immunocytochemistry, the cells were fixed with 99.5% ethanol at −30°C and incubated overnight with goat anti-nestin polyclonal antibody (G-20; Santa Cruz Biotech, Santa Cruz, CA, USA), mouse anti-smooth muscle actin (SMA) monoclonal antibody (CGA7; Chemicon, Temecula, CA, USA), mouse anti-human α-fetoprotein (AFP) (Biomeda, Foster City, CA, USA), and mouse anti-neurofilament (NF) L antibody (DA2; Zymed, Invitrogen), followed by treatment with secondary antibodies (Alexa 488 rabbit anti-goat IgG, Alexa 488 rabbit antimouse IgG, Alexa 594 rabbit anti-mouse IgG, Alexa 594 rabbit anti-mouse IgG; Molecular Probes, Invitrogen). RT-PCR For RNA extraction and RT-PCR analysis, total RNA was purified using Trizol (Invitrogen) following the protocol of the manufacturer. One microgram of DNase-treated total RNA was used for the first-strand cDNA reaction, which was performed using a random primer (Invitrogen) and M-MLV reverse transcriptase (Promega, Madison, WI, USA). cDNA samples were subjected to PCR amplification using specific primers under linear conditions to reflect the original amount of the specific transcript. The cycling parameters were as follows: denaturation at 94°C for 1 min, annealing at 55–60°C for 1 min (depending on the primer), and elongation at 72°C for 1 min (40 cycles). The PCR primers and length of the amplified products were as follows: GAPDH, CTCA AGATCATCAGCAATGCC and GATGGTACATGACAAGGT GC, 755 bp; GEP, AGCAAGGGCGAGGAGCTGTT and GTAG GTCAGGGTGGTCACGA, 195 bp; Oct3/4, CGACCATCTGCC GCTTTGAG and CCCCCTGTCCCCCATTCCTA, 577 bp; Rex1, GCGTACGCAAATTAAAGTCCAGA and CAGCATCCTAAAC AGCTCGCAGAAT, 306 bp. The PCR products were run on 1.5% agarose gels. Teratoma formation To investigate the differentiation potential of cES cells in vivo, 5 ×105 cells were grafted into the peri-
MONKEY ES CELLS EXPRESSING GFP
15
toneal cavity of two SCID mice and the resulting teratomas were analyzed.
RESULTS cES clones expressing GFP (GFP-cES clones) Clones stable for selection were screened for GFP fluorescence microscopically, after which three clones were finally selected and named cES1, cES2, and cES3. All three cES clones expressed mRNA for GFP, Oct3/4, and Rex1 (Fig. 1A). Oct3/4 is a representative marker of an undifferentiated state in mouse and primate ES cells (11–13), whereas Rex1 is expressed in human ES cells (15). cES1, cES2, and cES3 colonies all showed green fluorescence under UV light and distinct ALP activity. The colonies of cES1 cells on day 4, after passage 12, are shown in Fig. 1B and 1C. All the cES1 colonies were fluorescent (Fig. 1B) and showed high ALP activity (Fig. 1C). The feeder cells were not fluorescent under UV light nor stained red by the procedure for detecting ALP activity. After more than 30 passages, the GFP-cES cells retained their fluorescence and ALP activity. Because each GFP-expressing clone presented similar results in the following experiments, the results for cES1 are presented as representative of all the clones for the following findings. In vitro differentiation cES1 cells were cultured for 5 days in hanging drops and formed EBs, which were allowed to attach while being cultured (20 EBs per 10-cm dish). Figure 2A shows a single EB just after attaching to a dish. After 5 d, the EBs retained fluorescence and after 10 d, beating cells emerged in about half of the EB outgrowths. Three weeks after allowing the EBs to attach during culture, the cells were immunostained for SMA (mesoderm-derived marker), AFP (endoderm-derived marker), and nestin (ectoderm-derived marker). SMA-immunopositive cells, as well as nestin- and AFP-immunopositive cells, were found in the EB outgrowths (Fig. 2B), indicating the ability of cES1 cells to differentiate into derivatives from the three embryonic germ layers in vitro. We also found that cES cells differentiated into mature neurons in the EB cultures in the presence of ATRA, a stimulator of neuronal differentiation. Cells harboring long neurites were also observed and the neurites were distinctly immunoreactive to the anti-neurofilament antibody (Fig. 2C). In vivo differentiation In vivo differentiation was examined by inoculating 5 ×105 cES1 cells into the peritoneal cavity of two SCID mice. Two months later, tumor formation was evident in both mice. Figure 3A shows one of the mice developing a cES1-derived tumor in the peritoneal cavity. The tumor was macroscopically composed of various components, including cyst-like structures, and emitted green fluorescence under UV light (Fig. 3B). Furthermore, hairs had formed in the tumor, some of which were visible on the tumor surface. As shown in Fig. 4A, it was microscopically confirmed that the tumor was composed of various tissues. Histological analysis further revealed that it contained various tissues derived from the three embryonic germ layers: squamous cells, hair, neurons, and melanocytes (ectoderm), bone, cartilage, muscle, and fat cells (mesoderm), and ciliated columnar epithelia and gut epithelia (en-
16
J. BIOSCI. BIOENG.,
UEDA ET AL.
FIG. 1. cES clones expressing GFP (GFP-cES clones). (A) The cES1, cES2, and cES3 clones, but not parental cES cells, expressed mRNA for GFP. The three clones also expressed mRNA for Oct-3/4 and Rex-1, as obseved with the parental cES cells. (B, C) Colonies from cES1 cells on day 4, after passage 12, are shown (asterisk). All of the cES1 colonies were fluorescent (B) and showed high levels of ALP activity (C).
doderm) (Fig. 4B–M). DISCUSSION ES cells are clonal cell lines derived from the inner cell mass of developing blastocysts. The distinguishing features
of these cells are their capacity to renew themselves and differentiate into a broad spectrum of derivatives of all three embryonic germ layers; ectoderm, mesoderm, and endoderm. Mouse ES cells were first established in 1981 (1, 2) and human ES cells in 1998 (16). The multi-lineage differentiation ability of ES cells has drawn clinical attention to
VOL. 102, 2006
MONKEY ES CELLS EXPRESSING GFP
17
FIG. 2. Retained ability of in vitro differentiation. (A) The cES1 cells could form EBs in hanging drop cultures and retained fluorescence. (B) EB outgrowths containing cells differentiated into lineages of the three embryonic germ layers are shown. Immunopositivities against smooth muscle actin (SMA), α-fetoprotein (AFP), and nestin were used as representative makers for mesoderm-, endoderm-, and ectoderm-derived cells, respectively. (C) In the EB outgrowths cultured in the presence of ATRA, cells with long neurites were observed. The neurites were immunostained with the anti-neurofilament (NF) antibody.
18
UEDA ET AL.
J. BIOSCI. BIOENG.,
FIG. 3. Tumor formation in SCID mice. (A) A teratoma, outlined by the red dotted line, developed in the peritoneal cavity of a SCID mouse two months after inoculation of 5 ×105 cES1 cells is shown. (B) The excised tumor was macroscopically found to be composed of various components, including cyst-like structures, and emitted green fluorescence under UV light. Hairs were visible on the surface of the tumor.
their possible use in novel therapeutic strategies, such as cell transplantation and tissue regeneration. However, several characteristics are different between mouse and human ES cells, including the techniques required for maintaining cultures of undifferentiated cells, whereas nonhuman primate ES cells are much more similar to human ES cells than mouse ES cells (11–13). Therefore, increasing knowledge
concerning nonhuman ES cells is indispensable before starting human ES-based therapy. In the present study, we were able to obtain cynomolgus ES (cES) cells expressing GFP. Although human ES cells expressing GFP have already been established (17), human ES cells are not freely available at this time. Regarding the establishment of cES cells expressing GFP, two studies have been reported (18, 19).
VOL. 102, 2006
MONKEY ES CELLS EXPRESSING GFP
19
FIG. 4. Histological analysis of the tumor. (A) The tumor was composed of various tissues. (B–M) The various tissues included squamous epithelia (B, C), hair follicles (D, E), rosette-like structures (F), brain tissue-like structures (G), pigment cells (H), bone formation (I, asterisk), cartilage formation (J), adipose tissue (K), epithelia containing goblet cells (L), and ciliated columnar epithelia (M). (Panels C and E correspond to the areas outlined by squares in panels B and D, respectively.)
20
J. BIOSCI. BIOENG.,
UEDA ET AL.
Sasaki et al. (18) used the non-integrating Sendai virus vector to introduce the GFP gene into cES cells and noted that the GFP gene remained stably expressed in the cES cells for up to one year. However, the non replicating transgene was diluted out of the cells with repeated division. Takada et al. (19) also successfully produced cES cells expressing GFP by introducing a GFP expression vector construct using electroporation. In this study, we applied a lipofection technique to introduce the GFP gene to cES cells. We transfected a plasmid containing the GFP coding gene under the CMVIE promoter into cES cells and obtained three cES clones expressing GFP. Each clone could differentiate into derivatives of the three embryonic germ layers in vitro and produced teratomas in SCID mice. The EBs formed in vitro and the teratomas formed in SCID mice emitted green fluorescence under UV light, suggesting that stable expression of the transfected EGFP gene was maintained during differentiation. In this study, we did not perform implantation of GFPcES cells into blastocysts, thus the ability of these cells to form chimeras in developing fetus tissues was not examined. In a strict sense, GFP-cES cells should be called stem cell-like cells based on the results presented. However, parental cES cells have been well characterized as ES cells (14). Because GFP-expressing cES cells were obtained by a gene transfection technique, they are considered likely to behave as ES cells and are useful for basic research, including cell transplantation.
7.
8.
9.
10.
11. 12. 13. 14.
REFERENCES 1. Evans, M. J. and Kaufman, M. H.: Establishment in culture of pluripotent cells from mouse embryos. Nature, 292, 154– 156 (1981). 2. Martin, G. R.: Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. USA, 78, 7634– 7638 (1981). 3. Yamada, T., Yoshikawa, M., Kanda, S., Kato, Y., Nakajima, Y., Ishizaka, S., and Tsunoda, Y.: In vitro differentiation of embryonic stem cells into hepatocyte-like cells identified by cellular uptake of indocyanine green. Stem Cells, 20, 146–154 (2002). 4. Kanda, S., Shiroi, A., Ouji, Y., Birumachi, J., Ueda, S., Fukui, H., Tatsumi, K., Ishizaka, S., Takahashi, Y., and Yoshikawa, M.: In vitro differentiation of hepatocyte-like cells from embryonic stem cells promoted by gene transfer of hepatocyte nuclear factor 3 beta. Hepatol. Res., 26, 225–231 (2003). 5. Ishizaka, S., Shiroi, A., Kanda, S., Yoshikawa, M., Tsujinoue, H., Kuriyama, S., Hasuma, T., Nakatani, K., and Takahashi, K.: Development of hepatocytes from ES cells after transfection with the HNF-3beta gene. FASEB J., 6, 1444–1446 (2002). 6. Shiroi, A., Yoshikawa, M., Yokota, H., Fukui, H., Ishizaka,
15.
16.
17.
18.
19.
S., Tatsumi, K., and Takahashi, Y.: Identification of insulinproducing cells derived from embryonic stem cells by zincchelating dithizone. Stem Cells, 20, 284–292 (2002). Shiroi, A., Ueda, S., Ouji, Y., Saito, K., Moriya, K., Sugie, Y., Fukui, H., Ishizaka, S., and Yoshikawa, M.: Differentiation of embryonic stem cells into insulin-producing cells promoted by Nkx2.2 gene transfer. World J. Gastroenterol., 21, 161–166 (2005). Yamada, T., Yoshikawa, M., Takaki, M., Torihashi, S., Kato, Y., Nakajima, Y., Ishizaka, S., and Tsunoda, Y.: In vitro functional gut-like organ formation from mouse embryonic stem cells. Stem Cells, 20, 41–49 (2002). Nishimura, F., Yoshikawa, M., Kanda, S., Nonaka, M., Yokota, H., Shiroi, A., Nakase, H., Hirabayashi, H., Ouji, Y., Birumachi, J., Ishizaka, S., and Sakaki, T.: Potential use of embryonic stem cells for the treatment of mouse parkinsonian models: improved behavior by transplantation of in vitro differentiated dopaminergic neurons from embryonic stem cells. Stem Cells, 21, 171–180 (2003). Sugie, Y., Yoshikawa, M., Ouji, Y., Saito, K., Moriya, K., Ishizaka, S., Matsuura, T., Maruoka, S., Nawa, Y., and Hara, Y.: Photoreceptor cells from mouse ES cells by coculture with chick embryonic retina. Biochem. Biophys. Res. Commun., 332, 241–247 (2005). Odorico, J. S., Kaufman, D. S., and Thomson, J. A.: Multilineage differentiation from human embryonic stem cell lines. Stem Cells, 19, 193–204 (2001). Ulloa-Montoya, F., Verfaillie, C. M., and Hu, W. S.: Culture systems for pluripotent stem cells. J. Biosci. Bioeng., 100, 12–27 (2005). Boiani, M. and Scholer, H. R.: Regulatory networks in embryo-derived pluripotent stem cells. Nat. Rev. Mol. Cell. Biol., 6, 872–884 (2005). Suemori, H., Tada, T., Torii, R., Hosoi, Y., Kobayashi, K., Imahie, H., Kondo, Y., Iritani, A., and Nakatsuji, N.: Establishment of embryonic stem cell lines from cynomolgus monkey blastocysts produced by IVF or ICSI. Dev. Dyn., 222, 273–279 (2001). Henderson, J. K., Draper, J. S., Baillie, H. S., Fishel, S., Thomson, J. A., Moore, H., and Andrews, P. W.: Preimplantation human embryos and embryonic stem cells show comparable expression of stage-specific embryonic antigens. Stem Cells, 20, 329–337 (2002). Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel, J. J., Marshall, V. S., and Jones, J. M.: Embryonic stem cell lines derived from human blastocysts. Science, 282, 1145–1147 (1998). Liu, Y. P., Dovzhenko, O. V., Garthwaite, M. A., Dambaeva, S. V., Durning, M., Pollastrini, L. M., and Golos, T. G.: Maintenance of pluripotency in human embryonic stem cells stably over-expressing enhanced green fluorescent protein. Stem Cells Dev., 13, 636–645 (2004). Sasaki, K., Inoue, M., Shibata, H., Ueda, Y., Muramatsu, S. I., Okada, T., Hasegawa, M., Ozawa, K., and Hanazono, Y.: Efficient and stable Sendai virus-mediated gene transfer into primate embryonic stem cells with pluripotency preserved. Gene Ther., 12, 203–210 (2005). Takada, T., Suzuki, Y., Kondo, Y., Kadota, N., Kobayashi, K., Nito, S., Kimura, H., and Torii, R.: Monkey embryonic stem cell lines expressing green fluorescent protein. Cell Transplant., 11, 631–635 (2002).