CYP19 (cytochrome P450 aromatase) gene polymorphism in murrah buffalo heifers of different fertility performance

Research in Veterinary Science 86 (2009) 427–437

Contents lists available at ScienceDirect

Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc

CYP19 (cytochrome P450 aromatase) gene polymorphism in murrah buffalo heifers of different fertility performance O. Suneel Kumar, Deepti Sharma, Dheer Singh *, M.K. Sharma Molecular Endocrinology Lab, Animal Biochemistry Division, National Dairy Research Institute, Karnal-132001, Haryana, India

a r t i c l e

i n f o

Article history: Accepted 23 September 2008

Keywords: Buffalo CYP19 gene Aromatase SSCP

a b s t r a c t The most common cause of infertility in buffaloes is anestrum. During late maturity the ovaries are in a state of true anestrum. One of the predominant causes of true anestrum is a low level of ovarian estrogens. The key enzyme in estrogen biosynthesis is cytochrome P450 aromatase, encoded by CYP19 gene. In the present study, CYP19 gene polymorphism was analyzed by Single Strand Conformational Polymorphism (SSCP) in buffaloes of different fertility performance. The SSCP and sequence analysis revealed 4 allelic variants in coding exons and introns which unaltered the protein sequence. However, a significant polymorphism (T/C heterozygote) was found near TATA binding protein region in regulatory part (a facet of promoter II) at position 23 of CYP19 exon 2, in all late matured and 50% of late maturing animals. Based on these observations and remarks of earlier workers, a hypothesis is proposed for the physiology of late maturity in buffaloes. Ó 2008 Elsevier Ltd. All rights reserved.

1. Introduction Buffaloes are premier dairy animals in India. One of the limiting factors for quick genetic improvement in the buffalo population is poor reproduction. Field surveys on reproductive disorders revealed that anestrum was the most common single cause of infertility in buffaloes (Dessouky and Juma, 1973; Pandit et al., 1982; Serur et al., 1982; Hussain and Muniraju, 1984; Singh et al., 1985; Singal and Lohan, 1988; Benjamin and Ansari, 1992; Kumar and Kumar, 1993; Singla and Verma, 1994; Ashturkar et al., 1995; Singh and Sahni, 1995). The minimum economic loss is Rs. 12,000/ animal/year if a buffalo does not come into estrus in right time. Among the causes of anestrum, true anestrum is the predominant one in buffaloes (Lundgren, 1958; Barr, 1963; El-Wishy, 1965; Samad et al., 1984; Singal et al., 1984; Vale, 1994; Newar et al., 1999; Baruah et al., 2000). The late maturity is essentially due to late functioning of the ovaries which are in a state of true anestrum (Viswanath et al., 2002). True anestrum is due to quiescent ovaries with absence of cyclic activity. In true anestrus, the animal is nonpregnant with smooth ovaries giving no palpable evidence of either follicular or luteal activity on per-rectal examination. One of the physiological causes for true anestrum is a low level of ovarian estrogens (Hafez and Hafez, 2000). Estrogens are imperative for reproductive development, fertility, bone growth and sexual behavior. The key enzyme in estrogen biosynthesis is cytochrome P450 aromatase (EC1.14.14.1), the pro* Corresponding authors. Tel.: +91 184 2259135; fax: +91 184 2250042. E-mail addresses: [email protected], [email protected] (D. Singh). 0034-5288/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.rvsc.2008.09.008

tein product of CYP19 gene. The CYP19 gene has been mapped to band q2.6 on chromosome 10, q21.2 on chromosome 15, q26 on chromosome 10, q24 ? q31 on chromosome 7 and q2.6 on chromosome 11 in cattle (Goldammer et al., 1994; Furbass et al., 1997), human (Simpson et al., 1994; Chen et al., 1988) goat, sheep (Goldammer et al., 1999) and buffalo (Iannuzzi et al., 2001), respectively. The gene size ranges from 56 kb to 120 kb in different species. It consists of 10 exons. The coding region includes exon II–X with translation start site in exon II. Upstream of exon II there are a number of alternative first exons (I.1, I.2, I.3, I.4 and I.5) that are spliced into 50 -untranslated region (50 UTR) of the transcript in a tissue specific fashion (Simpson and Davis, 2001). In adipose tissue, skin, ovary and placenta, the CYP19 transcripts with different 50 UTRs were resulted by most efficient use of existing and recruitment of additional novel tissue specific promoters. For instance, the proximal ovarian specific promoter (PII) gives rise to a 50 -UTR contiguous with first coding exon (exon II), where as, a constitutively active distal promoter (I.1) in placenta is the basis of strikingly elevated levels of estrogen (100–000 times normal) in pregnant woman (Shozu et al., 1991; Bulun, 1996). Though transcripts in different tissues have different 50 UTRs, the coding region and thus the aromatase protein expressed in various tissue sites is always the same regardless of the promoter used. Hence polymorphic analysis of the coding region is very important in addition to the study of tissue specific regulation of CYP19 gene. Fisher et al.1998) characterized the mice deficient in aromatase (ArKO) due to targeted disruption of the CYP19 gene. It was found that female ArKO mice displayed underdeveloped external genitalia and uteri, ovaries having numerous follicles that are arrested

428

O. Suneel Kumar et al. / Research in Veterinary Science 86 (2009) 427–437

before ovulation, no corpora lutea, atretic follicles and prepubertal mammary gland development. The mutations in CYP19 gene cause aromatase deficiency that result in sexual ambiguity with clitoromegaly, amenorrhea multicystic ovaries, pseudohermaphroditism, progressive signs of virilization, tall stature, and pubertal failure with no signs of estrogen action in females (Ito et al., 1993; Morishima et al., 1995; Grumbach and Auchus, 1999; Palter et al., 2001; Layman, 2002). Furbass et al. 1997) proposed that the gene variants in CYP19 might influence the fertility of cattle. However, the buffalo aromatase gene and its allelic variants in animals of different levels of fertility have not been studied. Keeping this in view the present pilot work has been done to find out the polymorphisms of CYP19 gene in murrah buffaloes of different fertility performance. In this study, four CYP19 variants were found and the T/C heterozygote condition was observed in the putative promoter region of late matured and late maturing animals. 2. Materials and methods 2.1. Selection criteria and grouping of animals The lactating and heifer buffalos were grouped into three groups. The lactating/normal cyclic buffaloes (n = 20, age at first calving 35.45 ± 0.869 months) from the herd of National Dairy Research Institute, Karnal, Haryana, India, were grouped as group 1. A total of 37 buffalo heifers were grouped as late matured (group 2, n = 17, >42 months of age) and late maturing / true anestrus (group 3, n = 20, >42 months of age) animals. Out of 37, 24 buffalo heifers were selected from villages near Karnal, Haryana, India and 13 animals were from Govt. Livestock Farm, Manmoor, Warangal District, Andhra Pradesh, India. The heifers were screened with permission of NDRI Animal Ethics Committee as well as Govt. Livestock Farm, Manmoor. The selection criteria for groups 2 and 3 is represented in a case sheet (Fig. 1). Briefly, the selection criteria is as follows. The animal’s age was determined by dentition patterns. Animals with four pairs of matured incisors and more than 275 kg body weight were considered in the present study. On per-rectal examination, those animals which did not have any palpable follicle, corpus luteum and developed genitalia, were included in groups 2 and 3. Later all those selected 37 animals were treated for anestrus with ayurvedic ovulation inducers such as Prajana (Natural remedies, India) at the rate of 3 bolus/day for three consecutive days. If animal did not come to oestrus, the treatment was repeated after 12th day. Like that the treatment was conducted for one year. Prajana is a formulation with potent combinations of herbs (Citrullus cococynthis,

Owner name: Address: Murrah Breed Characteristics: Jet black colour Tightly curled horns Long tail with white switch White markings: Face Tail History:

Age:

> 42 months

No. of permanent incisors: 4 pair

Perrectal examination: Ovaries: smooth/ follicle/ CL

Case sheet

Extremeties

BW: (Girth in cm X length in cm) 2 100

Uterus: infantile/ developed

Treatment : Prajana, fertivet, Mineral mix, lugol’s Iodine touch etc. Animal screening was done in winter season

Fig. 1. Selection criteria for group 2 and 3 animals.

Piper nigam, Piper longum, Zinziber officinale and Sesamum indicum) formulated to induce ovarian activity in anoestrus animals. Prajana’s action is closely similar to gonadotrophin and helps release of hormones for inducing ovulatory oestrus (http://agtr.ilri.cgiar.org/library/docs/yakpro/SessionD21.htm). In addition cervical touch of Lugol’s iodine, a counter irritant which enhances blood supply to reproductive system, frequent ovarian massage and GnRH injections were also given to these animals for a period of one year. Among 37 animals only 9 animals responded to above treatments and came to oestrus. These were included in group 2. All 13 animals selected from Govt. Livestock farm, Manmoor, Warangal District, Andhra Pradesh, India did not respond to the above treatments. Hence they were fed with Andhra Pradesh Bajra Napier grass (APBN) at the rate of 35 kg/day/animal. Among those 13, 8 animals started showing estrus signs after 1.5 months of the feeding trail. These 8 animals were also included in group 2. Overall the animals (9 + 8 = 17) responded to above treatments and feed, and showed estrus signs were grouped as group 2 or late matured animals and those (n = 20) did not respond to treatment and feed, and remained immatured were grouped as group 3 or late maturing/true anestrus animals. During the screening period, 17b-estradiol levels were estimated (17b-Estradiol kit Cat. # RE52041, IBL Immunobiological Laboratories, Hamburg, Germany) in the blood taken from normal, late matured and late maturing animals. The animals that had undetected levels of 17b-estradiol were considered (n = 37) for groups 2 and 3. 2.2. Amplification of CYP19 exons The DNA was isolated from blood using Flexi gene Kit (Qiagen Cat. # 51204). The primers were designed based on homology between cattle and sheep CYP19 gene sequences for amplification of buffalo CYP19 exons. They were designed in introns or exon–intron boundaries to study the polymorphisms in exon–intron boundaries also. The primers for exons 2–10 are presented in Table 1. The PCR was performed in a total volume of 50 ll of reaction mixture consisting of 120–150 ng of DNA, 1 PCR buffer [10 mM Tris–HCl (pH 9), 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin], 0.15 mM of each dNTP, 0.2 lM of each primer and 1 U Taq DNA polymerase. The amplification was performed in a thermocycler using cycle conditions as follows: initial denaturation at 94 °C for 2 min, 35 cycles of amplification with denaturation at 94 °C for 1 min, annealing at 60 °C for 1 min, extension at 72 °C for 1 min and final extension at 72 °C for 5 min. The same PCR conditions were followed for amplification of all 9 exons of CYP19 gene. 2.3. Scanning of PCR products by single strand conformational polymorphism (SSCP) analysis For SSCP analysis, the procedure was followed according to Buntup et al. (2002) with some modifications. The PCR products (5 ll) were mixed with 5 ll of SSCP dye (97% formamide, 10 mM NaOH, 20 mM EDTA, 0.025% bromophenol blue, 0.025% xylene cyanol) in 0.2 ml PCR tubes. The tubes were incubated at 95 °C for 10 min for denaturation and plunged in ice for 3 min to form single strand conformers. The conformers were electrophoresed in a 0.5 mm thick minigel (Biorad) of native polyacrylamide in different concentrations ranging from 10% to 15% (the ratio of acrylamide to bis-acrylamide was 49:1), 5% glycerol, 0.05% ammonium persulphate, 0.1% N,N,N0 ,N0 -tetramethylenediamine in 0.5 TBE (10 TBE, pH 8.3 contained 54g Tris, 27.5g boric acid and 3.722g EDTA in 500 ml of triple distilled water). The optimal polymerization time was about 1.5 h. The gel was pre-electrophoresed at 60 V for 15 min with 0.5 TBE as electrode buffer. The conformers of PCR products were separated in the gel at 14–16 °C using constant voltage of 60 V for 14–20 h for different exons in different percentages of acrylamide gels.

429

O. Suneel Kumar et al. / Research in Veterinary Science 86 (2009) 427–437 Table 1 Primers (F, forward and R, reverse) for buffalo CYP19 exons.

347

2–153 (152)

EF126036

347

174–329 (156)

EF126034

210

27–223 (176)

DQ489714

298

107–222 (116)

EF126036

241

5–117 (113)

EF178281

362

50–216 (167)

EF126036

446

171–413 (243)

EF126036

318

17–286 (270)

DQ489713

2.4. Detection of SSCP conformers

exon 2 of CYP19 was considered to have putative proximal promoter (promoter II) (Gali, 2006). In addition the sequence of exon 2 was analyzed by TFSEARCH software for predicting transcription factor binding sites.

All steps were followed in dark conditions for detection of SSCP conformers, as mentioned by Caetano-Anolles and Gresshoff (1994) with slight modifications. After electrophoresis, the gel was kept in fixing solution (10% acetic acid) for 20 min on a rocking platform for proper fixing of SSCP conformers in the gel. The fixing was followed by washing three times with triple distilled water for 3 min. After washing, silver impregnation was performed by immersing the gel in staining solution (0.15% silver nitrate and 0.056% formaldehyde) for 30 min, followed by washing the gel with distilled water for 20 s. The gel was then treated with developer (3% sodium carbonate, 0.056% formaldehyde and empirically very small crystal of sodium thiosulphate) until the visualization of silver stained SSCP conformers as brown bands.

3. Results 3.1. 17b-Estradiol levels in normal cyclic, late matured and late maturing animals Irrespective of the stage of the estrous cycle, the 17b-estradiol levels were in the range of 2.7–20.09 pg/ml (mean, 7.38 pg/ml) in blood from group 1 (control) animals (n = 20). The levels of 17bestradiol were undetected in the late matured and late maturing/ true anestrus animals during the screening period. This indicated that the ovaries were not functional as far as the development of a dominant follicle was concerned.

2.5. Sequence analysis of PCR products

1

2

3

4

1

3.2. DNA isolation and amplification of CYP19 exons The genomic DNA preparations were of high purity (Fig. 2A) showing A260/A280 ratio as 1.70 ± 0.03. The amplified exons of CYP19 gene are illustrated in Fig. 2 B among 10 exons of CYP19 gene, coding exons (2–10) were amplified. The uncoding exon 1, part of exon 2 and 10 of CYP19 gene were not amplified.

Exon 2 (352bp)

DNA Ladder (100bp)

DNA ladder (100bp)

DNA sample 3

DNA sample 2

DNA Sample 1

The PCR products of all CYP19 gene exons from group 1 and the PCR products that demonstrated different SSCP patterns in animals of groups 2 and 3 were custom sequenced from Genex Life Sciences Pvt. Ltd., India. The sequences of the PCR products of these groups were aligned using T-Coffee multiple alignment software. Similarly all the sequences of amplified CYP19 exons from control buffaloes were aligned with that of cattle and sheep CYP19 sequences. The

2

3

4

5

DNA ladder (100bp)

10

EF126036

Exon 6 (298bp)

9

50–351 (302)

-Ve control

8

352

Exon 10 (318 bp)

7

Accession number

Exon 9 (446bp)

6

Exonic region (bp)

Exon 8 (362bp)

5

GGGCTTGCTTGTTTTGACTC 3 CTGGTATTGAGGATGTGTCC 30 CCCAGCTACTTTCTGGGAAT 30 CTCAGGTCTCAAGCAAACC30 TGGAGGAGGAGGTTCTTGTG 30 ATGTACCCGGCACCTGAATA 30 GCTCACTCTGATGTTGTCC 30 TCAGTACCATCCAAGGGGA 30 CCTGCTTAGAGTCCAAGATGCT30 CTTGCCGAAGAGGCCAGATA30 G/CCAGCAAGGACTTGAAAGATG 30 GAACCTGGTGGGCTACAGTC 3 TGCCACCTCCCTTTCTGT 30 CGACCCAATGACTTGCCTTA 30 TCTACGGAACAAGCACAGGA 30 GGCACGCTCAGTTTTAAGGA 30 TGATCTCTTTCCCAGGTTCC 30 CCCATGTGGAGTTCTGTTGA 30

Product size (bp)

Exon7 (241 bp)

4

F-5 R-50 F-50 R-50 F-50 R-50 F-50 R-50 F-50 R-50 F-50 R-50 F-50 R-50 F-50 R-50 F-50 R-50

0

Exon5 (210bp)

3

0

Exon 4 (347bp)

2

Primers

Exon 3 (347bp)

Exons

6

7

8

9

10

11

12

Fig. 2. (A) Representative agarose (0.8%) gel analysis of genomic DNA (100 ng). Lanes 2, 3 and 4 represent three different DNA samples isolated from buffalo blood. Lane 1 indicates 100 bp ladders. (B) Representative agarose (2%) gel analysis of PCR product showing different buffalo aromatase (CYP19) exons amplified. Lanes 1 and 12 represents 100 bp ladders. Lanes 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11 represent amplified PCR products of exons 2, 3, 4, 5, 7, 8, 9, 10, negative control, and 6, respectively. All the PCR products amplified have respective full exon and partial intronic regions on both sides. The length of PCR product and exonic region has been given in Table 1. The exonic region has been shown in italics in respective figures.

430

O. Suneel Kumar et al. / Research in Veterinary Science 86 (2009) 427–437

SSCP Pattern 1

SSCP Pattern 2

SSCP Pattern 3

12%; 12h

C

C

L

L

LM LM

LM

LM 15%; 20h

TBP

TATTAT AAAA CAAA GTG CCAA

TATTATAAAACAAAGC/TGCCAATC

GGGCTTGCTTGTTTTGACTCGTAACTATAAATTTGTCTTGTCTAAGTGTccaatcatattat aaaacaaagTgccaatctctacggtacagcatcctctgaagcaacaggagtcctgaatgtacattttggggattttctaatttttccactcttctg atctccacaggactttaaattacttcccctgagatcaagtaaaacaaaatgcttttggaagtgctgaacccaaggcattacaatgtcaccagc atggtgtccgaagttgtgcctattgctagcattgcagtcctgctgctcactggatttcttctcttggtttggaattatgaggacacatcctcaatacc agG

SSCP pattern 1

C

SSCP pattern 2

L

LM 12%, 17.5h

G G A TA

GG GT A

Tgtcccagctactttttgggaattgggcccctcatttcccactgcaggttcctttggatggggatcggcagtgcctgcaattactacaacaagatg tatggagaattcatgagagtctgggtatgtggagaggaaacccttattattagcaaGTAAGTCTCAATAATTGGAGAAA TACTTTAAAAATCAAGGTTGGGaTATTTCCTATTAAAAAGCAAACTCATTTTGATATT TTGCCATCTTTGTTTCCAATGTCTTTACTACTTAAATAAAGATGAGTGATTACCAGG TTAAAAATCTAACACTTGAGACAAACAGAATAATTGGGGTTTGCTTGAAACCTGAGG Fig. 3. SSCP Patterns and nucleotide sequence of aromatase exons 2–10. For every exon, representative gel and nucleotide sequence has been shown separately. C, control (normal cyclic); L, late matured; LM, late maturing, buffalo heifers. (A) Exon 2: the variation in SSCP patterns for exon 2 was due to allelic variation in exon 2 (part of regulatory region) position 23, where T/T (highlighted italics and upper case) homozygote is present in control animals. But T/T is replaced by T/C heterozygote in late matured and true anestrus animals at the same position. The 100% and 50% late matured (L) and late maturing (LM)/true anestrus animals showed different SSCP patterns compared to control animals. TBP indicates TATA binding protein region. (B) Exon 3: the 10% late maturing (LM)/ true anestrus animals showed different SSCP patterns compared to control (C) and late matured (L) animals. The difference is due to intronic sequence variation at position 46 (A–G) (mentioned in lower case and italics) in one case out of 20 cases of true anestrus animals. (C) Exon 4, (D) exon 5, (E) exon 6, (G) exon 8 and (I) exon 10: there is no difference in number as well as mobility shift of SSCP conformers in respective exons among the three groups. (F) Exon 7: the 10% late maturing (LM)/true anestrus animals showed different SSCP patterns compared to control and late matured animals. The difference is due to G/A heterozygosity at position 72 of intron 7 (mentioned in lowercase and italics) in late maturing animals rather than A/A homozygosity in control animals and late matured animals in the same location. (H) Exon 9: the 11% and 10% late matured (L) and late maturing (LM)/true anestrus animals showed different SSCP patterns compared to control animals. The difference is due to C/G heterozygosity at position 82 (mentioned in lower case and italic) in coding region of exon 9 in late matured and late maturing animals rather than G/G homozygosity in control animals in the same location. However, because of degeneracy of codons CCC and CCG, both the codons code for proline.

431

O. Suneel Kumar et al. / Research in Veterinary Science 86 (2009) 427–437

C

C

L

L

LM

LM

15%, 20h

TTGGAGGAGGAGGTTCTTGTGCTAACACAAATACTTATTTAATCTAA CACTAGAAATTATGCATTTTTGTCTAGATCAAATGCATTTGCTACAAG AGCCAACAGGTAGTCAAACTCATCATTTTGAGTTCTTGACCCTTAAA AATCAACACCAAGTTTTGCTTTTGCTGCAGgtcctcaagtatgttccatgtaatg aagcacagtcactacatatcccgatttggcagtaaacttgggttgcaattcatcggcatgcacga gaaaggcatcatatttaacaataacccaccctcggagaaagttgccccacctttataaaaaaga ggtA

C

C

C

L

L

LM

LM

15%, 15h

GCTCACTCTGATGTTGTCCCCTTCAGctttgtccggccctggc ctggtgcgcatggtgaccatctgtgctgattccatcaccaagcatctggacaggctgga ggaggtctgcaatgacttgggctatgtggacgtgttgaccctcatgcggcgcatcatgct ggacacctctaacgtgctcttcctggggatccccttggatgGTACTGA C

C

L

L

LM

LM

C

12%, 12h

C

L

L

LM

LM

15%, 14h

CCTGCTTAGAGTCCAAGATGCTAGGAGAGTCTACAGGGGATCTTCTTTCATTAGCATACC CTTCTTGGACTCATATTTTTGCTCATCTGCTTTGATGTTTTTGCAGaaagtgccatcgtggttaaaat ccaggggtattttgatgcatggcaagctctccttctcaaaccagacatcttctttaagatttcttggctgtgcagaaagtatgaa aagtctgtGTAAGTAACACATTTTGGAATAATTTTTGATGAGACTGATTTGTGTGTGTCTCAG ATATATCTGGCCTCTTCGGCAA Fig. 3 (continued)

3.3. SSCP analysis

3.4. Polymorphisms at nucleotide level

Monomorphic SSCP patterns were observed in all three groups for exons 4 (Fig. 3C), 5 (Fig. 3D), 6 (Fig. 3E) and 8 (Fig. 3G). In exons 3 (Fig. 3B) and 7 (Fig. 3F), the patterns were monomorphic in group 1 (normal cyclic) and group 2 (late matured) but dimorphic in 10% of group 3 (late maturing/true anestrus) buffalo heifers. The SSCP patterns of exon 2 in all late matured and 50% of late maturing animals were very different from the control animals (Fig. 3A). They were monomorphic within groups 1 and 2 and trimorphic in group 3. Similarly, monomorphic appearance of exon 9 was observed (Fig. 3H) in group 1 but it appeared as dimorphic in groups 2 and 3 animals. Trimorphic SSCP polymorphisms were observed (Fig. 3I) in all groups for exon 10 of CYP19 gene.

Sequence alignment of CYP19 exons amplified from group 1 (control or normal cyclic) animals with other species revealed that there was more than 90% homology among buffalo, cattle and sheep (Table 2) CYP19 exons. In exon 2 at position 23, T/C heterozygous condition was observed in groups 2 and 3 rather than homozygous TT condition in group 1 (Figs. 3A and 4) animals. In exon 3, the mobility shift of SSCP band (Fig. 3B) was due to a change of nucleotide from A to G at position 46 in intron 3 (in present study the PCR products contain part of introns along with exons) in 10% of late maturing animals (group 3). Similarly, the intronic polymorphism (AA to G/C) can be observed in exon 7 PCR product at position 72 of intron 7 (Figs. 3F and 4). Correspondingly, a heterozygote condition G/C was observed at position 82 of

432

O. Suneel Kumar et al. / Research in Veterinary Science 86 (2009) 427–437

SSCP pattern 1

SSCP pattern 2

C

LM

L 12%, 14h

T TAT T C

T TG/AT T Cc

GCAGcaaggacttgaaagatgccatggaaattctcatagaagaaaaaagacacaggatttcaatagcagagaagctggaagacagcata gatttcgccactgagttgatttttgctgAGGTACAGATTTACACTGACCATAATTCCCACACAACATATGT GTATGACTGTATGCAAGCGTACTCAGTTaTTCAGTCATGTCCTACTCTTTGTAACCCTA TGGACTGTAGCCCACCAGGTTC

C

C

C

L

L

LM

LM

12%, 15h

TTTCTGAACCTCACTCACTTTCCCATATTTCTCTCCCTTCCCATTCTTC AGaaacgtggtgaacttacaagagagaatgtaaaccagtgcatattggaaatgctgatcgcagcgccagacacca tgtctgtttctgtgttcttcatgctgtttctcattgcaaagcatccccaggttgaagaggcaataatgagggaaatccagac tgttgttgGTAAGAATTTATCAAACAAACACTAGAGCTCAGAAAATAATTTC TTGATATTAGCTTCTATGTCCTAAAATTTTATGTCAAAAACTTTGTTAA AATCTGCTCAGAGAACAATAAGGCAAGTTCATT GGGGTC Fig. 3 (continued)

exon 9 in 11.7% of group 2 and 10% of group 3 animals (Fig. 3H). As there was no difference in SSCP patterns of exons 4–6, 8 and 10, their sequences (Fig. 3C–E and G) were not aligned among the groups. In total four allelic variants of CYP19 gene were identified in the different groups of buffaloes (Table 3). 3.5. TFSEARCH analysis In silico analysis of exon 2 sequence for transcription factor binding revealed a E2F binding site in late matured and late maturing animals when there is nucleotide ‘C’ at position 23 of exon2. But the E2F binding cannot be seen when there T at the same position (see Fig. 5).

4. Discussion In the present study, four allelic variants of CYP19 gene were identified by PCR-SSCP and sequencing in buffalo heifers of varying fertility performance. The general strategy adopted for detecting mutations and single nucleotide polymorphisms is to amplify

the gene in small fragments and analyze the fragments by rapid technique to locate and identify the nature of mutation or polymorphism (Lakotia and Somasundaram, 2003). The very commonly used rapid techniques are single strand conformation polymorphism (Orita et al., 1989), enzymatic or chemical cleavage of mismatch base pair (Myers et al., 1985; Novack et al., 1986; Cotton et al., 1988; Ganguly and Prockop, 1990; Cotton, 1993; Youil et al., 1995) and differential unfolding of homoduplexes and heteroduplexes by denaturing gradient gel electrophoresis (Myers et al., 1987; Sheffield et al., 1989). Among these techniques, SSCP analysis of PCR products (PCR-SSCP) is very commonly used for detecting single nucleotide polymorphisms and mutations. It has been used for detection of genetic mutations in humans (Orita et al., 1989), rats (Pravence et al., 1992), cattle (Kirkpatrick, 1992; Raghavan, 2006), and in various bacteriological (Morohoshi et al., 1991) and viral (Fugita et al., 1992) systems. For instance a variation C286T in exon 7 of the CYP19 gene was observed by SSCP and sequencing in humans (Means et al., 1989; Watanabe et al., 1997). In addition the search for SSCP polymorphisms in candidate genes associated with quantitative genetic variation in traits of economic importance, could lead to the finding of genetic markers useful for improved selection of

433

O. Suneel Kumar et al. / Research in Veterinary Science 86 (2009) 427–437

Pattern 1

Pattern 2

15%, 20h

C

L C C

L

LM LM

C/GG

C

C

C

C

G

G

T

TCTACGGAACAAGCACAGGATATTTTACTCCAGTTACTGGTTTACATTAGAAT TATAGATATACATTTTTTCAACTAAGGGCAAACTGTTCGGTGGAAAATGTATG ATTTTAAACACTGACCATATATTGAAACTAACATGAGCTGTGTCTTTTTAATCT TATTCTACAGGtgaaagagacataaggattgatgatatgcaaaagctaaaagtggtggaaaactttattaatgagagcat gcggtaccagccGgttgtggacctggtcatgcgcaaagccttagaggatgacgtcatcgatggctacccggtgaaaaaggggact aacattatcctgaatcttggaagaatgcatagactcgagtttttcccaaagcctaatgagtttactcttgaaaactttgccaagaATG TAAGAGTCCTTCCTTAAAACTGAGCGTGCCAAG

Control

LM

L

15% 12h

TGATCTCTTTTCCCAGgttccttacaggtactttcagccatttggctttgggccccgggcctgtgcgggaaagtacatcgccat ggtgatgatgaaggtcatcctggtcacccttctgagacgcttccacgtgcagactttgcaagatcggtgcgttgagaagatgcagaagaaa aatgacttatccttgcatccagatgagaccagcgaccggctagaaatgattttcaccccaagaaattcagacaagtgcctcgagtgctaaA GAAGTTTGGTCAGTCCCTGCCCCAGAGCACTGCT CAACAGAACCTCCACATGGG Fig. 3 (continued)

agricultural populations. Therefore, SSCP followed by sequencing was implemented in the present study to discover polymorphism in CYP19gene. The variations in SSCP patterns are due to changes in nucleotide sequence or heterozygous conditions. Among four allelic variants, two were due to a change in nucleotide sequence of introns and two other were because of altered exonic sequences. However, these nucleotide changes did not alter the amino acid sequence of aromatase protein. Generally, the polymorphisms at splice junctions of exon/intron boundaries were considered as significant due to the insertion of extra nucleotides in mRNA thereby a change in amino acid sequence in proteins. In the present work, two intron polymorphisms (intron 3, A ? G; intron 7 A/A ? A/G) were observed and were not at the splice junctions. However, some studies signified that the changes in non-coding DNA sequences often manifest themselves in clinical and circumstantial malfunctions (Mattick and Gagen, 2001; Kazuhiro et al., 2003). Numerous genes in these protein non-coding regions, encode microRNAs, which are

responsible for RNA-mediated gene silencing through RNA interference (RNAi)-like pathways. Intron-derived miRNA (Id-miRNA) is a new class of miRNA, derived from the processing of gene introns. The intronic miRNA requires type-II RNA polymerases (PolII) and spliceosomal components for their biogenesis. Several kinds of Id-miRNA have been identified in C. elegans, mouse, and human cells, However, neither function nor application have been reported. Recently, it was reported that intron-derived miRNAs are able to induce RNA interference in not only human and mouse cells, but also in zebrafish, chicken embryos, and adult mice, demonstrating the evolutionary preservation of intron-mediated gene silencing via functional miRNA in cell and in vivo (Lin et al., 2006). These reports suggested an intracellular miRNA-mediated gene regulatory system, fine-tuning the degradation of proteincoding messenger RNAs. Along similar lines, the polymorphisms in introns of CYP19 gene in late matured and late maturing animals may be useful for future studies to know their role for the regulation of CYP19 mRNA function.

434

O. Suneel Kumar et al. / Research in Veterinary Science 86 (2009) 427–437

Table 2 Sequence homology of buffalo CYP19 exons with other species. Buffalo CYP19 exons (accession number)

Other species

Accession number

Percent homology

2 (EF126036)

Cattle Sheep Cattle Sheep Cattle Sheep Cattle Sheep Cattle Sheep Cattle Sheep Cattle Sheep Cattle Sheep Cattle Cattle Sheep

Z69242 AJ012144 Z69243 AJ012145 Z69244 AJ012146 Z69245 AJ012147 Z69246 AJ012148 Z69247 AJ012149 Z69248 AJ012150 Z69249 AJ012151 Z69250 AJ133699 AJ012152

98 96 98 96 98 98 99 98 98 96 97 94 97 97 98 97 98 97 97

3 (EF126036) 4 (EF126034) 5 (DQ489714) 6 (EF126036) 7 (EF178281) 8 (EF126036) 9 (EF126036) 10 (DQ489713)

Fig. 4. Comparison of amplified CYP19 exon 2 sequences from control (normal), late matured and late maturing/true anestrus animals using T-COFFEE, Version_1.41 multiple sequence software tool. The stars indicate 100% homology. The variation in nucleotide sequence is shown in lower case. The italics indicate exon and normal font indicates intron. The transcription factor binding sites (TATA and CAAT), transcription start sites and putative methylation sites are highlighted.

Table 3 Summary of allelic variants of cyp19 (aromatase P450) gene in buffalo of differentiated fertility performance. Exon/intron

Position

Control

Late matured

Late maturing

Exon 2 Intron 3 Intron 7 Exon 9

23 46 72 82

T/T A/A A/A G/G

T/C G/G A/A C/G

T/C G/G G/C C/G

The polymorphism in exon 2 was due to T/C heterozygotic condition in a regulatory region of CYP19 gene. This change seems to be very important because in normal lactating animals (group 1) it was TT homozygotic condition. The C at position 23 and adjacent to putative TATA binding element in exon 2, was present at 19 bp upstream of transcription start site for one of the major aromatase transcripts directed by promoter II in buffalo granulosa cells (Gali, 2006). It was reported that ‘C’, which was in the same site, but +18

O. Suneel Kumar et al. / Research in Veterinary Science 86 (2009) 427–437

435

Fig. 5. Insilico prediction of transcription factor binding sites in putative proximal promoter in CYP19 exon2. The transcription factor (TF) binding sites were predicted by TFSEARCH (Ver 1.3) software in the sequence of CYP19 gene exon 2. The sequence from control animals (A) did not have E2F transcription factor binding site whereas the sequence of late matured animals (B) had E2F transcription factor binding site because of the presence of ‘C’ rather than ‘T ‘at position 23 of exon2 (in this figure, position is 22).

in the case of cattle CYP19 gene, was a putative significant methylation site. This site is under epigenetic regulation for suppressing the expression of CYP19 gene during lutenization of granulosa cells (Vanselow et al., 2005). Therefore, based on the data of the present study and the views of previous workers, a hypothesis was made in such a way that the late maturity may be due to methylation of C in the T/C heterozygote condition in regulatory region near to TATA binding protein (TBP) site of CYP19 gene present on one chromosome. As methylation is tissue specific and inhibits the binding of transcription factors to the respective DNA elements by occupying the same regions with methyl binding proteins and therefore, distorts the DNA orientation for transcriptional factors binding, the transcription of CYP19 gene from one chromosome may be inhibited in granulosa cells of late matured animals. Therefore, the levels of aromatase transcripts may be low in T/C heterozygotic condition. This may result in low levels of 17b-estradiol which may not reach the threshold required for follicular development and gonadotrophin release. The lack of circulatory 17b-estradiol will inhibit the LH beta gene due to high levels of local 17b-estradiol in the pituitary. This is due to elevated expression of pituitary aromatase in response to low circulatory 17b-estradiol. Recently it was reported that high circulatory 17b-estradiol inhibits the pituitary aromatase expression in tissue specific fashion (Galmiche et al., 2006). Therefore, if ovarian aromatase levels are low, the 17b-estradiol and LH levels will be low. As a result follicles may not become dominant and the animal may not show estrous symptoms. As mentioned in materials and methods, some animals (n = 8) expressed estrous after feeding APBN. This observation indicates that nutritional factors may reverse the methylation of ‘C’ as methylation is a reversible process (Ramchandani et al., 1999). Sec-

ondly, nutritional factors may enhance the activity of the other promoter (P1.1) of aromatase which usually operates at a low level in the granulosa cells. The observations in the present study may not give conclusive findings. Therefore, further studies are required to confirm the methylation status of the regulatory region after studying the promoters and cis elements of CYP gene in buffalo ovary in detail. However, the results obtained and this hypothesis may be helpful to conduct further studies on late maturity in buffalo heifers by focusing on T/C heterozygotic condition. In addition transfac analysis revealed that transcripton factor E2 F can bind to the promoter if there is C rather than T at this promoter. Generally E2F stimulates the transcription of the genes to which it binds. But the gene expression of human telomerase reverse transcriptase (hTERT) is suppressed by its interaction (Won et al., 2002). Hence a similar type of suppression can also be predicted for buffalo aromatase when there is T/C heterozygote situation. Similarly, another heterozygotic condition (C/G) was observed in CYP19 exon 9 of late matured and true anestrus animals. Though there was a change from GG homozygote (control) to C/G heterozygote of late matured and true anestrus animals, the amino acid encoded by both the codons (CCC and CCG) is proline due to the degeneracy of the genetic code (Watson et al., 2004). Thus, the aromatase amino acid sequence will be unaltered, retaining its activity. Therefore, this condition may not be related to late maturity. In conclusion, a pilot project on single strand conformation polymorphism analysis of aromatase gene found 4 allelic variants in coding exons and introns in lactating (control) buffaloes, late matured and true anestrus/late maturing buffalo heifers. The nucleotide change in these variants unaltered the amino acid sequence of aromatase protein.

436

O. Suneel Kumar et al. / Research in Veterinary Science 86 (2009) 427–437

However, the T/C heterozygous condition near TATA binding region in major ovarian promoter, which is a part of exon 2, may be methylated in late matured animals. This may be ascertained by future studies on a larger number of animals. Acknowledgements Authors are very grateful to Director NDRI, Karnal for providing necessary facilities for this work. We thank Dr. Vinay Kumar Katneni, Dr. Sreedhar and Mool chand for their kind help in screening of animals. This work was supported by SRF fellowship from NDRI to (OSK and Deepti) and Project grant from Department of Biotechnology Govt. of India (to DS). References Ashturkar, R.W., Aher, V.D., Bhokre, A.P., 1995. Studies on infertility problems in non-descript buffaloes and cows. Indian Veterinary Journal 72, 1050–1052. Barr, M.A.S., 1963. Field investigations about infertility and sterility in cattle and buffaloes in the United Arab Republic. In: Proceedings of the Fourth Arab Veterinary Congress. Cairo, Egypt, pp. 333–340. Baruah, K.K., Newar, S., Baruah, A., Bhuyan, D., 2000. Status of macro and micro mineral levels in postpartum anestrous swamp buffaloes in relation to soil and plants. Indian Journal of Dairy Science 53, 424–427. Benjamin, B.R., Ansari, M.R., 1992. Studies on the effect of season on the estrus, conception rates and reproductive disorders in rural cattle and buffaloes. Indian Veterinary Journal 16, 27–33. Bulun, S.E., 1996. Clinical reviews 78, aromatase deficiency in women and men: would you have predicted the phenotype? Journal of Clinical Endocrinology and Metabolism 81, 867–871. Buntup, D., Petmitrb, S., Wongkajornsilpc, A., Chanyavanich, V., Sangrujie, T., Theerapancharoenf, V., Kotchabhadia, N., Jutapakdeegula, N., Hayashig, K., Thangnipona, W., 2002. Mutational analysis of the PTEN gene localized at chromosome 10q23 in Thai patients with gliomas. Science Asia 28, 417–422. Caetano-Anolles, G., Gresshoff, P.M., 1994. Staining nucleic acids with silver: an alternative to radioisotopic and fluorescent labeling. Promega notes Magazine No. 45, 13–20. Chen, S.A., Besman, M.J., Sparkes, R.S., Zollman, S., Klisak, I., Mahandas, T., Hall, P.F., Shively, J.E., 1988. Human aromatase: cDNA cloning, southern blot analysis, and assignment of the gene to chromosome 15. DNA 7 (1), 27–38. Cotton, R.G.H., 1993. Current methods in mutation detection. Mutation Research 285, 125–144. Cotton, R.G.H., Robdigues, N.R., Campbell, R.D., 1988. Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations. Proceedings of National Academy of Science USA 85, 4397–4401. Dessouky, F., Juma, K.H., 1973. Infertility problems among cows and buffaloes in Iraq. Indian Journal of Animal Science 43, 187–192. El-Wishy, A.B., 1965. Clinical studies on diagnosis of pregnancy and infertility in buffaloes and possible treatment. Veterinary Medical Journal (Giza) 11, 7–48. Fisher, C.R., Graves, K.H., Parlow, A.F., Simpson, E.R., 1998. Characterization of mice deficient in aromatase (ArKO) because of targeted disruption of CYP19 gene. Proceedings of National Academy of Sciences USA 95, 6965–6970. Fugita, K., Silver, J., Peden, K., 1992. Changes in both gp120 and gp41 can count for increased growth potential and expanded host range of human immunodeficiency virus type 1. Journal of Virology 66, 4445–4451. Furbass, R., Kalbe, C., Vanselow, J., 1997. Tissue-specific expression of the bovine aromatase-encoding gene uses multiple transcriptional start sites and alternative first exons. Endocrinology 138 (7), 2813–2819. Gali, J.M., 2006. Characterization of 5’-end of aromatase cytochrome P450 (cyp19) transcripts in buffalo ovary. M.Sc., thesis submitted to National Dairy Research Institute, Karnal, India. Galmiche, G., Richard, N., Corvaisier, S., Marie-Laure, K., 2006. The expression of aromatase in gonadotropes is regulated by estradiol and GnRH in a manner that differs from the regulation of LH. Endocrinology 147 (9), 4234–4244. Ganguly, A., Prockop, D.J., 1990. Detection of single-base mutations by reaction of DNA heteroduplexes with a water-soluble carbodiimide followed by primer extension: application to products from the polymerase chain reaction. Nucleic Acids Research 18, 87–91. Goldammer, T., Brunner, R.M., Vanselow, J., Zsolnai, A., Furbass, R., Schwerin, M., 1999. Assignment of the bovine aromatase encoding gene CYP19 to 10q26 in goat and 7q24 ? q31 in sheep. Cytogenetics and cell genetics 85, 258–259. Goldammer, T., Guerin, G., Brunner, R.M., Vanselow, J., Furbass, R., Schwerin, M., 1994. Chromosomal mapping of the bovine aromatase gene (CYP19) and an aromatase pseudogene to chromosome 10 and syntenic group U5. Mammalian genome 5, 826–827. Grumbach, M.M., Auchus, R.J., 1999. Estrogen: consequences and implications of human mutations in synthesis and action. Journal of Clinical Endocrinology and Metabolism 84 (12), 4677–4694. Hafez, E.S.E., Hafez, B., 2000. Reproduction in farm animals, seventh ed. Lippincott Williams and Wilkins publications. pp. 261–263.

Hussain, M.P., Muniraju, L., 1984. Study of the incidence of reproductive disorders of bovines in a part of southern Karnataka. Livestock Advisor 9, 13–16. Iannuzzi, L., Di Meo, G.P., Perucatti, A., Schibler, L., Incarnato, D., Cribiu, E.P., 2001. Comparative FISH-mapping in river buffalo and sheep chromosomes: assignment of forty autosomal type I loci from sixteen human chromosomes. Cytogenetics and cell genetics 94, 43–48. Ito, Y., Fisher, C.R., Conte, F.A., Crumbach, M.M., Simpson, E.R., 1993. Molecular basis of aromatase deficiency in an adult female with sexual infantilism and polycystic ovaries. Proceedings of National Academy of Sciences USA 90, 11673–11677. Kazuhiro, S., Haruki, N., Hiroshi, M., Hidekazu, K., Hironobu, O., Nobuaki, O., Tomoyuki, T., Seiji, N., Masaru, H., Hidetoshi, O., 2003. Association of the genetic polymorphism of the CYP19 intron 4 [TTTA] [n] repeat with familial prostate cancer risk in a Japanese population. Anticancer Research 23 (6), 4941–4946. Kirkpatrick, B.W., 1992. Detection of a three-allele single strand conformation polymorphism (SSCP) in the fourth intron of the bovine growth hormone gene. Animal Genetics 23, 179–181. Kumar, S., Kumar, H., 1993. Clinical analysis of anestrum in rural bovines. Indian Journal of Dairy Science 46, 80–81. Lakotia, S., Somasundaram, K., 2003. Conformation-sensitive gel electrophoresis for detecting BRCA1 mutations. Methods in Molecular Biology 223, 403–412. Layman, L.C., 2002. Human gene mutations causing infertility. Journal of Medical Genetics 39, 153–161. Lin, S.L., Miller, J.D., Ying, S.Y., 2006. Intronic microRNA (miRNA). Journal of Biomedicine and Biotechnology 4, 26818. Lundgren, B., 1958. Report to the Government of UAR (Egypt) on A.I. and Sexual Health Control in Cattle and Buffaloes. FAO, Rome, Italy. 27pp. Mattick, J.S., Gagen, M.J., 2001. The evolution of controlled multitasked gene networks: the role of introns and other noncoding RNAs in the development of complex organisms. Molecular Biology and Evolution 18 (9), 1611–1630. Means, G.D., Mahendroo, M.S., Jo Cobin, C., Manthis, J.M., Powell, F.E., Mendelson, C.R., Simpson, E.R., 1989. Structural analysis of the gene encoding human aromatase cytochrome P-450, the enzyme responsible for estrogen biosynthesis. Journal of Biological Chemistry 264 (32), 19385–19391. Morishima, A., Grumbach, M.M., Simpson, E.R., Fisher, C., Qin, K., 1995. Aromatase deficiency in male and female siblings caused by a novel mutation and the physiological role of estrogens. Journal of Clinical Endocrinology and Metabolism 80, 3689–3698. Morohoshi, F., Hayashi, K., Munakata, N., 1991. Molecular analysis of Bacillus subtilis ada mutants deficient in the adaptative response to simple alkylating agents. Journal of Bacteriology 173, 7834–7840. Myers, R.M., Larin, Z., Maniatis, T., 1985. Detection of single base substitutions by ribonuclease cleavage at mismatches in RNA: DNA duplexes. Science 230, 1242–1246. Myers, R.M., Maniatis, T., Lerman, L.S., 1987. Detection and localization of single base changes by denaturing gradient gel electrophoresis. Methods in Enzymology 155, 501–527. Newar, S., Baruah, K.K., Baruah, B., Bhuyan, D., Kalita, D., Baruah, A., 1999. Effect of mineral mixture on certain macro- and micro-mineral constituents in postpartum anestrous swamp buffaloes. Indian Veterinary Journal 76, 102–104. Novack, D.F., Casna, N.J., Fischer, S.G., Ford, J.P., 1986. Detection of single base pair mismatches in DNA by chemical modification followed by electrophoresis in 15% polyacrylamide gel. Proceedings of National Academy of Sciences USA 83, 586–590. Orita, M., Iwarana, H., Kanazawa, H., Hayashi, K., Sekiya, T., 1989. Detection of polymorphisms of human DNA by gel electrophoresis as single strand conformation polymorphisms. Proceedings of National Academy of Sciences USA 86, 2766–2770. Palter, S.F., Tavares, A.B., Hourvitz, A., Veldhuis, J.D., Adashi, S.H., 2001. Are estrogens of import to primate/human ovarian folliculogenesis? Endocrine Reviews 22 (3), 389–424. Pandit, R.K., Gupta, S.K., Raman, S.R.P., 1982. Incidence of various reproductive disorders in cattle and buffaloes. Livestock Advisor 7, 51–53. Pravence, M., Simonet, L., Kren, V., St. Lezin, E., Levan, G., Szpirer, J., Szpirer, C., Kurtz, T., 1992. Assignment of rat linkage group V to chromosome 19 by single strand conformation polymorphism analysis of somatic cell hybrids. Genomics 12, 350–356. Raghavan, V.S., 2006. Single nucleotide polymorphisms of diacyl glycerol acyl transferase 1 (DGAT 1) gene in indigenous cattle and buffaloes. Ph.D. thesis submitted to National Dairy Research Institute, Karnal, India. Ramchandani, S., Battacharya, S.K., Cervoni, N., 1999. DNA methylation is a reversible biological signal. Proceedings of National Academy of Sciences USA 96, 6107–6112. Samad, H.A., Ali, C.S., Ahmad, K.M., Rehman, N.U., 1984. Reproductive diseases of the water buffalo. In: Proceedings of the 10th International Congress on Animal Reproduction and AI, vol. IV. Urbana, USA, pp. XIV-25–XIV-33. Serur, B.M., Farrag, A.A., Goma, A., 1982. Incidence of certain infertility problems among cows and buffaloes in Upper Egypt. Assiut Veterinary Medical Journal 10, 209–214. Sheffield, V.C., Cox, D.R., Lerman, L.S., Myers, R.M., 1989. Attachment of a 40-basepair G rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes. Proceedings of National Academy of Sciences USA 86, 232–236. Shozu, M., Akasafu, K., Harada, T., Kubota, Y.J., 1991. A new cause of female pseudohermaphroditism: placental aromatase deficiency. Journal of Clinical Endocrinology and Metabolism 72, 560–566.

O. Suneel Kumar et al. / Research in Veterinary Science 86 (2009) 427–437 Simpson, E.R., Davis, S.R., 2001. Minireview: aromatase and the regulation of estrogen biosynthesis – some new perspectives. Endocrinology 142 (11), 4589– 4594. Simpson, E.R., Mahendroo, M.S., Means, G.D., Kilgore, M.W., Hinshelwood, M.M., Graham-Lorence, S., Amarnh, B., Ito, Y., Fisher, C.R., Michael, M.D., Mendelson, C.R., Bulun, S.E., 1994. Aromatase cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocrine Reviews 15 (3), 342–355. Singal, S.P., Lohan, I.S., 1988. Studies on the incidence and reproductive management of infertility in breeadable dairy animals in rural Haryana State, India. In: Proceedings of the 11th International Congress on Animal Reproduction and AI, III, No. 544. Dublin, Ireland, p. 3. Singal, S.P., Dhanda, O.P., Razdan, M.N., 1984. Some managemental and therapeutic approaches in the treatment of physiological infertility of water buffaloes (Bubalus bubalis). In: Proceedings of the 10th International Congress on Animal Reproduction and AI, vol. III, No. 471. Urbana, USA, p. 3. Singh, B., Sahni, K.L., 1995. Causes of infertility in cattle and buffaloes under field conditions. Indian Journal of Animal Science 65, 1119–1121. Singh, G., Singh, G.B., Bains, G.S., 1985. Studies on incidence of anestrus in village buffaloes. Indian Journal of Animal Reproduction 19, 57–60.

437

Singla, V.K., Verma, H.K., 1994. Analysis of reproductive disorders of buffaloes. Livestock Advisor 19, 14–15. Vale, W.G., 1994. Prospects of buffalo production in Latin America. In: Proceedings of the FourthWorld Buffalo Congress, vol. I. Sao Paulo, Brazil, pp. 75–87. Vanselow, J., Pohland, R., Furbass, R., 2005. Promoter-2-derived CYP19 expression in bovine granulose cells coincided with gene-specific DNA hypo-methylation. Molecular and Cellular Endocrinology 233, 57–64. Viswanath, C.S., Kumar, A.T., Pandey, J.G., and Pradhan, S., 2002. Handbook of Animal Husbandary, Indian Council of Agricultural Research (ICAR). pp. 697. Watanabe, J., Harada, N., Suemasu, K., Higashy, Y., Gotoh, O., Kawajiri, K., 1997. Arginine-cysteine polymorphism at codon 264 of the human CYP19 gene does not affect aromatase activity. Pharmacogenetics 7, 419–424. Watson, J.D., Baker, T.A., Bell, S.P., Gann, A., Levine, M., Losick, R., 2004. Molecular Biology of the Gene, fifth ed., p. 358. Won, J., Yim, J., Kookim, T., 2002. Opposing regulatory roles of E2F in human telomerase reverse transcriptase (hTERT) gene expression in human tumor and normal somatic cell. The FASEB Journal 16, 1943–1945. Youil, R., Kemper, B.W., Cotton, R.G., 1995. Screening for mutations by enzyme mismatch cleavage with T4 endonuclease VII. Proceedings of National Academy of Sciences USA 92, 87–91.