Cystatin C levels are decreased in acute myocardial infarction

International Journal of Cardiology 101 (2005) 213 – 217 www.elsevier.com/locate/ijcard

Cystatin C levels are decreased in acute myocardial infarction Effect of cystatin C G73A gene polymorphism on plasma levels Davide Noto a,1, Angelo Baldassare Cefalu’ a,1, Carlo Maria Barbagallo a, Antonio Pace a, Manfredi Rizzo a, Giuseppina Marino a, Rosalia Caldarella a, Antonio Castello b, Vincenzo Pernice c, Alberto Notarbartolo a, Maurizio Rocco Averna a,* a

Department of Internal Medicine and Geriatrics, University of Palermo, Via del Vespro 141, Palermo I-90127, Italy b Division of Cardiology, ‘‘Buccheri La Ferla’’ Hospital, Palermo, Italy c Division of Cardiology, ‘‘Villa Maria Eleonora’’ Hospital, Palermo, Italy Received 8 September 2003; received in revised form 5 January 2004; accepted 1 March 2004 Available online 1 June 2004

Abstract Background: Cystatin C is the most abundant protease inhibitor in the plasma. Low plasma levels have been found in patients with aortic aneurysms and they seem correlated with the extension of the aortic lesions in early aneurysms detected by ultrasonography. Methods: In this study, plasma levels of cystatin C have been investigated in patients with acute myocardial infarction (AMI), unstable angina and controls. The effect on plasma levels of the G73A polymorphism of the CST3 gene has been also evaluated. Results: Patients with acute myocardial infarction showed significantly lower levels of cystatin C compared to unstable angina and controls, but levels were nearly normal in a week after the acute event. The genotype distribution of the G73A polymorphism was not different among the groups. Nevertheless, cystatin C levels decreased proportionally with the number of A alleles. Cystatin C levels were positively correlated with age, triglyceride/HDL cholesterol ratio and creatinine, and negatively with HDL cholesterol and the number of A alleles. All variables, but not HDL cholesterol, were independently correlated in a multivariate analysis. Conclusions: Cystatin C is decreased in acute myocardial infarction. It is still not clear whether lower cystatin C levels are causally linked to the acute event or just represent a negative acute phase response. The CST3 gene G73A polymorphism functionally affects cystatin C plasma levels. D 2004 Elsevier Ireland Ltd. All rights reserved. Keywords: Cystatin C; Coronary artery disease; Acute myocardial infarction; Unstable angina

Cardiovascular events, such as myocardial infarction and stroke, are often caused by atherosclerotic plaque remodeling and rupture. The shoulder of an unstable plaque represents a weak area more subjected to disruption and thrombosis. Many studies have investigated the process of weakening of the fibrous cap, highlighting the role of degradation of the extracellular matrix through the activation of proteases released by activated macrophages and smooth muscle cells in the plaque [1,2]. Metalloproteinases (MMPs) [3,4], serine proteinases [5,6] and other elastasedegrading enzymes, like cysteine-proteases cathepsin S [7] and cathepsin K, which is involved in the lysis of collagen I * Corresponding author. Istituto di Medicina Interna e Geriatria, Policlinico ‘‘Paolo Giaccone’’, Via del Vespro 141, Palermo I-90127, Italy. Tel.: +39-91-6552861; fax: +39-91-6552936. E-mail address: [email protected] (M.R. Averna). 1 These authors equally contributed to this work. 0167-5273/$ - see front matter D 2004 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.ijcard.2004.03.018

and III [8,9], have been found in the extracellular matrix of the plaque. Cystatin C is the most abundant cysteineprotease inhibitor in the plasma. The gene maps in chromosome 20 and clusters with other cystatin genes, such as cystatin D, S and SA [10]. Cystatin C is expressed costitutively and its concentration is very stable, so that its plasma level is considered a marker of renal ultrafiltration efficiency. Then, cystatin C levels describe early renal impairment better than creatinine levels [11]. In a recent paper, reduced expression of cystatin C has been demonstrated in the arterial walls of patients with aortic aneurysm and cystatin C plasma levels were negatively correlated with the extension of the aneurysm [12]. To investigate the role of cystatin C on the stability of the atherosclerotic plaque, in terms of an unbalanced proteases/antiproteases ratio, we assessed the cystatin C plasma levels in patients with different expression of coronary artery disease such as acute myocardial infarc-

214

D. Noto et al. / International Journal of Cardiology 101 (2005) 213–217

tion (AMI) and unstable angina. The working hypothesis was that a lack of antiproteolytic activity could, at least partly, explain the increased susceptibility to rupture of the atherosclerotic plaque in these patients. Furthermore, because we found (unpublished observation) that the G73A polymorphism of the cystatin C gene affects cystatin C plasma levels, we evaluated the effect of CST3 gene polymorphism across the study groups.

1. Methods 1.1. Patients A total of 61 patients with acute myocardial infarction (AMI) have been selected from a series of 350 consecutive AMI admitted in 1 year to a coronary unit respecting the overall age and gender distribution. AMI patients were enrolled if they matched the Joint European Society of Cardiology/American College of Cardiology Committee 2000 criteria [13], if elevated levels of enzymes (including CK –MB or troponin I or T) together with clinical symptoms or ECG changes suggestive of ischemia were detected. All 61 patients with unstable angina have been selected from a casistic of a hemodynamic laboratory. Unstable angina was assessed according to the American College of Cardiology/American Heart Association 2000 criteria [14] in patients with typical symptoms of prolonged chest pain without specific enzymes elevation and coronary lesions detected by coronary angiography. Coronary arteries were evaluated by coronary angiography; 17 patients had one vessel disease, 14 patients had two vessels disease, 12 patients had three vessels disease. Fourteen patients suffered from a previous MI, and a coronary by pass was implanted in 12 patients. The different study groups, plus a group of subjects without coronary artery disease, were matched for age and sex with the AMI group. 1.2. Laboratory procedures Total cholesterol (TC), triglycerides (TG), HDL cholesterol (HDL-C), after phosphotungstic acid precipitation and creatinine plasma levels were measured using standard enzymatic – colorimetric procedures [15] on a COBAS MIRA plus autoanalyzer (Roche Diagnostics, Basel, Switzerland). LDL cholesterol (LDL-C) was calculated by Friedewald formula: LDL-C (mg/dl) = TC (mg/dl) TG (mg/dl)/ 5 HDL-C (mg/dl). After calculations, all parameters were converted to mmol/l. Cystatin C plasma levels were assessed by immunonephelometry on a Berhing Nephelometer using a certified assay kit (Dade Behring, Newark, DE, USA) [16]. 1.3. Cystatin C gene polymorphism DNA was isolated by standard method. Polymerase chain reaction (PCR) was performed in a total volume of 30

Al (100 to 200 ng of genomic DNA, 1 U Taq DNA polymerase, 20 pmol of each primer, 200 nmol of each dNTP and 1.5 mmol MgCl2). The exon 1 region of CST3 gene encompassing the G73A polymorphism was amplified by the primers GGTCCTCTCTATCTAGCTCC, and CTCCTGGAAGCTGATCTTAG on a GeneAmp PCR System 2400 (Perkin – Elmer Boston, MA, USA) under the following conditions: an initial denaturation at 95 jC for 5 min, followed by 35 cycles at 94 jC for 60 s, at 58 jC for 60 s and at 72 jC for 60 s. The final extension step was prolonged to 5 min. DNA from all patients and controls was amplified and digested. The 558 bp PCR product was cleaved in appropriate buffer with 5 U of SacII (Fermentas, Vilnius, Lithuania) in a total volume of 20 Al at 37 jC. The DNA fragments were separated by electrophoresis in a 1.5% agarose gel containing 0.5 mg/ml of ethidium bromide and visualized under UV light. Digestion of the PCR products yielded bands of 422 and 135 bp in G/G homozygotes, 558, 422 and 135 bp in G/A heterozygotes and 558 in A/A homozygotes. 1.4. Statistics All investigated parameters were tested for normality with the Shapiro –Wilks normality test before performing parametric tests. Differences of allelic distribution between groups were assessed by chi-squared test. Differences in the investigated parameters among the study groups were assessed by ANOVA test. In order to avoid the influence of creatinine on cystatin C levels, all patients with creatinine plasma levels over 1.3 mg/dl (90th percentile) were excluded from calculations; cystatin C plasma levels were adjusted for creatinine levels and the Cystatin C/creatinine ratio has been used in some of the calculation. Univariate correlations were assessed by Pearson’s correlation, while a multiple-regression analysis with a stepwise model was performed in order to investigate independent correlation. All statistics were performed using the Crunch 4.0 statistical package (Crunch Software, Oakland, CA, USA).

2. Results Mean values of relevant clinical data and assayed biochemical parameters are shown in Table 1. Lower levels of total LDL cholesterol were found in AMI patients, while lower levels of HDL cholesterol were found in all groups of patients vs. controls. Cystatin C was lower in AMI patients but the difference did not reach statistical significance. Nevertheless, when cystatin C/creatinine ratio was considered, significantly lower values were found in acute AMI patients. Cystatin C plasma levels increased in the same AMI patients at hospital discharge (cystatin C/creatinine ratio at 12 h after admission was 1.02 vs. 1.14 at hospital discharge). The raise was evident in all patients

D. Noto et al. / International Journal of Cardiology 101 (2005) 213–217 Table 1 Biochemical parameters in investigated groups (creatinine < 1.3 mg/dl)

Observations Age (years) Gender (M/F) Total cholesterol (mmol\l) Triglyceride (mmol\l) HDL cholesterol (mmol/l) LDL cholesterol (mmol/l) Cystatin C (Ag/ml) Creatinine (mg/dl) Cystatin C/creatinine CYS3 G73A (GG/AG/AA; %)

Controls

Unstable angina

AMI

pa

61 59 F 9.7 48/13 5.34 F 1.28

61 59 F 11.9 48/13 4.79 F 1.12c

61 61 F 9.7 48/13 4.33 F 1.04c

– n.s. n.s.b < 0.001

1.38 F 0.89

1.49 F 0.77

1.32 F 0.82

n.s.

215

Table 3 Cystatin C levels according to the investigated risk factors

Gender (M/F) Smoke H.B.P.b Diabetes Dyslipidemia C.V.D.c

Yes

No

pa

0.93 F 0.23 0.88 F 0.22 0.92 F 0.24 0.95 F 0.32 0.94 F 0.19 0.86 F 0.22

0.92 F 0.27 0.91 F 0.25 0.91 F 0.26 0.91 F 0.23 0.88 F 0.25 0.95 F 0.27

n.s. n.s. n.s. n.s. n.s. 0.03

a

Age and creatinine levels adjusted ANOVA test. High blood pressure. c Cardiovascular disease, i.e., history of AMI, angina, stroke. b

c

c

1.25 F 0.37

0.82 F 0.22

1.03 F 0.60

< 0.00001

3.44 F 1.15

3.29 F 0.97

2.7 F 0.89c

< 0.0001

0.90 F 0.24

0.97 F 0.27

0.85 F 0.23

0.038

0.83 F 0.43

0.90 F 0.43

0.87 F 0.96

n.s.

1.18 F 0.46

1.09 F 0.29

1.02 F 0.38c n.s.

67.9/26.8/5.4 75.4/21.3/3.3 62.3/36.1/1.3 n.s.d

a

Age-adjusted ANOVA test (n.s.: not significant). v2 test. c t-test; p < 0.05 vs. controls. d 2 v test. CST3 genotype distribution. All groups were in Hardy – Weimberg equilibrium. b

cystatin C levels were positively correlated with age, creatinine (all patients with creatinine above 1.3 mg/dl were excluded from calculation) and triglyceride/HDL cholesterol ratio, and were negatively correlated with HDL cholesterol and with the number of A alleles of the G73A genotype. The same variables but HDL cholesterol, when triglyceride/HDL cholesterol ratio was included in the model, were also independently correlated with cystatin C levels in a multiple-regression analysis (Table 4, column B) with a multiple R = 0.43.

3. Discussion divided according to the CST3 gene G73A polymorphism (Table 2). This table also shows the effect of the CST3 gene polymorphism on the cystatin C/creatinine ratio for all the study groups. Table 3 shows age and creatinine adjusted cystatin C levels according to the investigated risk factor. Only the presence of cardiovascular disease, i.e., a record of previous or acute AMI, angina or cerebrovascular accidents, was linked to significantly lower levels of cystatin C. In Table 3, levels of cystatin C according to G73A gene polymorphism are shown. The presence of the A allele was linked to lower levels of cystatin C. Nevertheless, no difference in the genotypic distribution was found across groups as shown in Table 1. Table 4 shows the correlation of cystatin C levels with the investigated parameters. At univariate analyses (Table 4, column A),

Table 2 Cystatin C/creatinine ratios in all patients according to the study group and the CST3 gene G73A polymorphism GG

All Controls Unstable angina AMI, 12 h AMI, discharge

1.10 F 0.38 (120) 1.06 F 0.42 (56) 0.71 F 0.42 (7) < 0.03 1.22 F 0.50 (45) 0.95 F 0.34 (14) 0.72 F 0.05 (2) < 0.04 1.1 F 0.31 (44) 1.08 F 0.21 (14) 0.88 F 0.02 (3) n.s.

a b

GA

AA

pa

Patients

0.98 F 0.0 (36)

1.12 F 0.0 (24)

0.51 F 0.0 (1)

n.s.

1.16 F 0.0b (36)

1.13 F 0.0 (24)

0.94 F 0.0 (1)

n.s.

Age-adjusted ANOVA test. t-test for paired data vs. AMI at 12 h.

Cystatin C, a potent protease inhibitor able to inhibit different cathepsins, is believed to play a role in the balance of the proteolytic/antiproteolytic activities in the arterial wall [17]. Lower plasma levels, as well as low intralesion cystatin C expression, have been found in patients with established aortic aneurysm [12]. This finding has been recently expanded in a larger sample of early aneurysmatic lesions detected by ultrasonography, where Cystatin C plasma levels were correlated with the progression of the

Table 4 Univariate correlation and multiple regression analysisa (creatinine < 1.3 mg/dl)

Age Creatinine Total cholesterol Triglyceride HDL cholesterol LDL cholesterol TG/HDL ratio No. of A allelesb a b

Pearson’s R ( p)

Multiple beta ( p)

+ 0.22 (0.004) + 0.17 (0.03) n.s.

+ 0.26 (0.01) + 0.16 (0.03) n.s.

n.s. 0.25 (0.002)

n.s. n.s.

n.s.

n.s.

+ 0.27 (0.0008)

+ 0.28 (0.0005)

0.16 (0.04)

0.17 (0.03)

MRA multiple R = 0.43. CST3 gene G73A polymorphism.

216

D. Noto et al. / International Journal of Cardiology 101 (2005) 213–217

aneurysm [18]. In the present paper, we investigated the role of cystatin C levels in patients with coronary atherosclerosis, such as patients with acute myocardial infarction and unstable angina. Our population was composed of patients with acute myocardial infarction and unstable angina, together with an equal number of patients without coronary artery disease and of comparable age and gender distribution. Because cystatin C levels were strongly correlated with creatinine levels (Pearson’s R = 0.68; p < 0.00001; data not shown); all patients with creatinine levels above 1.3 mg/dl (90th percentile) were excluded. Because cystatin C levels were still correlated with age and creatinine levels (Table 4), then all calculation were age and creatinine adjusted. Plasma levels were also adjusted for the difference in CST3 gene polymorphism distribution across the study groups because the polymorphism affected cystatin C plasma levels. Under these conditions, cystatin C levels were not significantly different among the study groups. In detail, plasma levels were lower, but not significantly, in AMI patients. The difference became significant when cystatin C was normalized for creatinine levels (cystatin C/creatinine ratio). This difference among the study groups might be due to a negative acute phase response during acute myocardial infarction, as shown for other plasma proteins and lipoproteins such as apolipoprotein B, AI, high-density and low-density lipoproteins [19,20]. The finding that, in the same AMI patients at hospital discharge, after about 7 days of hospitalization, cystatin C plasma levels were nearly normal also supports this hypothesis. Nevertheless, other explanations could be taken into account; the decrease of cystatin C levels might also be due to the prevalence of the proteolytic activity of the inflamed plaque with antiproteolityc factors consumption, an event that precedes the rupture of the plaque itself. We have also shown that the G73A polymorphism of the CST3 gene affects cystatin C plasma levels, so that the number of A alleles is proportionally linked to lower cystatin C levels. Furthermore, the CST3 polymorphism affected the levels of cystatin C in controls, unstable angina and AMI patients, both in acute phase, when plasma levels were decreased, and after normalization at hospital discharge (Table 2). The degree of the cystatin C raise at discharge was statistically significant in patients with the GG alleles of CST3 polymorphism probably because of the low number of cases for the other genotypes, but the absolute increase was more relevant for the AA genotype. As far as we know, this is the first report describing a functional effect of the cystatin C G73A polymorphism on plasma levels. The G73A polymorphism leads to an alanine to threonine substitution in the penultimate amino acid of a signal peptide which is removed during synthesis. This variation alters the hydrophobicity of the signal sequence near the signal peptidase cleavage site and could be associated with changes in secretory processing of the peptide. This effect could be due to an alteration of the trafficking of cystatin C to the endoplasmic reticulum or Golgi or to an abnormal cleavage of the signal

peptide from the mature protein [21]. Cystatin C is normally present intracellularly as a monomer or inactive dimer which is converted to the active monomeric form before secretion [21]. In the case of production of mutant cystatin C in cerebral hemorrhage with amyloidosis—Icelandic type (HCHWA-I)—the mutant protein forms much more stable dimers than the wild type, and, although a small percentage of these dimers can be secreted, the overall effect of the mutation is a reduction in cystatin C secretion and activity followed by an intracellular build up of cystatin C aggregates. [21,22]. Nevertheless, the strong linkage disequilibrium of G73A polymorphism with two other gene polymorphisms located in the nearest promoter region of the CST3 gene (G157C and A72C) suggests that G73A polymorphism may be expression of genetic variation in the promoter region with an impairment of the transcriptional process. No difference in the polymorphism distribution across the study groups was found (Table 1). Among the risk factors, the presence of cardiovascular disease was linked to lower cystatin C levels (Table 3). The explanation of this finding could be that all patients with acute myocardial infarction were ranked as cardiovascular patients, representing the majority of the CVD positive patients, and the AMI group is linked to lower cystatin C levels as shown above. Analyzing the correlation between cystatin C plasma levels and the investigated parameters, we found that cystatin C increases with age and creatinine even in subjects with normal renal function (creatinine below 1.3 mg/dl). We also found a positive, independent correlation with the triglyceride/HDL cholesterol ratio mostly due to the negative correlation with HDL cholesterol. The explanation of this finding is not straightforward. Patients with lower cystatin C were AMI patients that also have lower HDL cholesterol levels; therefore, the correlation should be positive if this was a ‘‘trailing’’ effect of the AMI status. The triglyceride/HDL cholesterol ratio is a marker of the polymetabolic syndrome, and it is linked to an impairment of the insulin-dependent action of the endothelial lipoprotein lipase. It may be supposed that cystatin C plasma levels are somehow affected by the insulin sensitivity of the patients but this is far from being proven. Moreover, there was no correlation with other features of the polymetabolic syndrome such as diabetes mellitus and high blood pressure (Table 3). In conclusion, in a sample of patients with unstable angina and acute myocardial infarction, we found lower levels of cystatin C only in the AMI group. After 1 week from the acute event, the cystatin C levels were nearly normal. It is not clear whether decreased cystatin C plasma levels before the acute event were already present and able to trigger the plaque rupture in a coronary artery, or the transient decrease of cystatin C levels in the AMI patients is just a negative acute phase response, lasting less than a week. Finally, the G73A polymorphism of the CST3 gene affects the plasma cystatin C levels and its confounding effect has to be considered in the analysis of cystatin C plasma levels.

D. Noto et al. / International Journal of Cardiology 101 (2005) 213–217

References [1] Libby P, Geng YJ, Aikawa M, et al. Macrophages and atherosclerotic plaque stability. Curr Opin Lipidol 1996 Oct.;7(5):330 – 5. [2] Libby P. Molecular bases of the acute coronary syndromes. Circulation 1995;91:2844 – 50. [3] Newby AC, Southgate KM, Davies M. Extracellular matrix degrading metalloproteinases in the pathogenesis of arteriosclerosis. Basic Res Cardiol 1994;89(Suppl. 1):59 – 70. [4] Thompson RW, Parks WC. Role of matrix metalloproteinases in abdominal aortic aneurysm. Ann N Y Acad Sci 1996;800:157 – 74. [5] Carmeliet P, Moons L, Lijnen R, Baes M, et al. Urokinase-generated plasmin activates matrix metalloproteinases during aneurysm formation. Nat Genet 1997;17:439 – 44. [6] Rao SK, Reddy KV, Cohen JR. Role of serine proteases in aneurysm development. Ann N Y Acad Sci 1996;800:131 – 7. [7] Sukhova GK, Shi G-P, Simon DI, et al. Expression of elastolytic cathepsins S and K in human atheroma and regulation of their production in smooth muscle cells. J Clin Invest 1998;102:576 – 83. [8] Garnero P, Borel O, Byrjalsen I, et al. The collagenolytic activity of cathepsin K is unique among mammalian proteinases. J Biol Chem 1998;273:32347 – 52. [9] Kafienah W, Bromme D, Buttle DJ, et al. Human cathepsin K cleaves native type I and II collagens at the N-terminal end of the triple helix. Biochem J 1998;331:727 – 32. [10] Abrahamson M, Islam MQ, Szpirer J, et al. The human cystatin C gene (CST3), mutated in hereditary cystatin C amyloid angiopathy, is located on chromosome 20. Hum Genet 1989;82:223 – 6. [11] Shimizu-Tokiwa A, Kobata M, Io H, et al. Serum cystatin C is a more sensitive marker of glomerular function than serum creatinine. Nephron 2002;92(1):224 – 6. [12] Shi GP, Sukhova GK, Grubb A, et al. Cystatin C deficiency in human atherosclerosis and aortic aneurysms. J Clin Invest 1999;104(9): 1191 – 7. [13] The Joint European Society of Cardiology/American College of Car-

[14]

[15]

[16]

[17] [18]

[19]

[20]

[21]

[22]

217

diology Committee. Myocardial infarction redefined a consensus document of the Joint European Society of Cardiology/American College of Cardiology Committee for the redefinition of myocardial infarction. Eur Heart J 2000;21:1502 – 13. Braunwald E, Antman EM, Beasley JW, et al. ACC/AHA guidelines for the management of patients with unstable angina and non-STsegment elevation myocardial infarction. A report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines (Committee on the Management of Patients with Unstable Angina). J Am Coll Cardiol 2000 Sep.;36(3):970 – 1062. Noto D, Barbagallo CM, Cefalu’ AB, et al. Factor VII activity is an independent predictor of cardiovascular mortality in elderly women of a Sicilian population: results of an 11-year follow-up. Thromb Haemost 2002 Feb.;87(2):206 – 10. Uhlmann EJ, Hock KG, Issitt C, et al. Reference intervals for plasma cystatin C in healthy volunteers and renal patients, as measured by the Dade Behring BN II system, and correlation with creatinine. Clin Chem 2001 Nov.;47(11):2031 – 3. Parks WC. Who are the proteolytic culprits in vascular disease? J Clin Invest 1999;104(9):1167 – 8. Lindholt JS, Erlandsen EJ, Henneberg EW. Cystatin C deficiency is associated with the progression of small abdominal aortic aneurysms. Br J Surg 2001;88(11):1472 – 5. Pfohl M, Schreiber I, Liebich HM, et al. Upregulation of cholesterol synthesis after acute myocardial infarction—is cholesterol a positive acute phase reactant? Atherosclerosis 1999 Feb.;142(2):389 – 93. Wattanasuwan N, Khan IA, Gowda RM, et al. Effect of acute myocardial infarction on cholesterol ratios. Chest 2001 Oct.;120(4): 1196 – 9. Benedikz E, Merz GS, Schwenk V, et al. Cellular processing of the amyloidogenic cystatin C variant of hereditary cerebral hemorrhage with amyloidosis, Icelandic type. Amyloid 1999;6:172 – 82. Bjarnadottir M, Wulff BS, Sameni M, et al. Intracellular accumulation of the amyloidogenic L68Q variant of human cystatin C in NIH/3T3 cells. Mol Pathol 1998;51:317 – 26.