- Email: [email protected]
Cytokine regulation of HIV-1 LTR transactivation in human hepatocellular carcinoma cell lines
CANCER LETTERS
ELSEVIER
Cancer
L.etters 94 (1995)
41-48
Cytokine regulation of HIV-l LTR transactivation hepatocellular carcinoma cell lines Mei-Ling
in human
Hsu, Shiuh-Wei Chen, Kwang-Huei Lin, Shun-Kuei Liao, Kenneth S.S. Chang*
Gruduate
Institute
of Clinical
Medicine.
Chang Gung Medical
College,
Taoyuan-Hsien,
Taiwan, Republic
of China
Received 5 December 1994; revision received 14 April 1995; accepted 17 April 1995
Abstract
Human hepatocellular carcinoma (HCC) cell lines, HEP-G2,55, and SK-HEP-1, which differ in their differentiation status, were compared for their trans-activating activities after treatment with cytokines or 12-O-tetradecanoylphorbol-13-acetate (TPA). These cells were transfected with a long terminal repeat (LTR) which was derived from human immunodeficiency virus type 1 (HIV-l) and ligated to chloramphenicol acetyl transferase (CAT) gene. After treatment with interleukin-la (ILla), interleukin-6 (IL-6), interferon-y (IFN-y), or TPA, they exhibited various degrees of enhancement of transactivation. The well differentiated HEP-G2 cells exhibited the highest degree of enhancement with these agents, while the poorly differentiated SK-HEP-1 cells showed no enhancement with cytokines and slight enhancement with TPA. The J5 cells, which were intermediate in their status of differentiation, showed a moderate degree of enhancement with cytokines and TPA. These results suggest that HCC cells at different stages of differentiation may produce different levels of cellular transacting factors activated by each of these agents. To map the cytokine response elements (CREs) in the HIV-I-LTR, HEP-GZ cells were transfected with nested series of 5’ deletion mutants of HIV-l-LTR and treated with each of these cytokines. It was found that not only the degrees but also the patterns of enhancement varied depending upon the presence of positive or negative regulatory sequences in HIV-l-LTR, and that the NF-KB sequence played an important role, either by itself or in conjunction with the 5’-proximal response elements (REs) to interact with cellular rrans-activating factors elicited by the cascade of transduction responses to cytokines. Despite the presence of promoters including KB and IPN-y RE as well as IL-6RE sequence in HIV-I-LTR-transfected cells, the poorly differentiated SK-HEP-1 cells showed no enhancement of transactivation by these cytokines, suggesting the lack of receptors or activity of some signal transduction factors which are present in well differentiated HEP-G2 and moderately differentiated J5 cells. Keywords:
Cytokines; Interleukin-la;
Interleukin-6;
Interferon-y; Transactivation;
1. Introduction We have been studying trans-activating of human hepatocellular carcinoma (HCC)
activities cell lines
* Corresponding author, Tel.: +886 3 3282144; Fax: +886 3 3280170.
Hepatoma
for the transfected promoter/enhancer (P/E) sequences of human immunodeficiency virus type 1 (HIV-l) long terminal repeat (LTR). The nested series of 5’ deletion mutants of HIV-l LTR, which contains various P/E elements similar to those of cells, have been useful for mapping the possible target sequences which may vary in their relative Importance
0304-3835/95/$09.50 0 1995 Elsevier Science Ireland Ltd. All rights reserved SSDI 0304-3835(95)03820-M
depending on the status of cellular differentiation. We have shown that human HCC cell lines. HEP-G2 and SK-HEP-I. exhibited marked difference in their constitutive as well as TPA-induced tr~ns-activating :ictivities (71. There 15 now ample evidence that one important consequence of cyfokine-receptor interaction at the ceil surface is the transactivation of previously quiescent genes. The specific effects induced by cytokines rn cells of different lineage ~111be determined by the selective activation of tissue-specific secondary response genes [IO]. We report here on the quantitative transactivation response of a transfected HIV- I-IXR m HCC cell lines to 12-O-tetradecanoylphorbol-13ncetate (TPA) or cytokines such as interleukin-la ; if.- lc?t, interleukin-6 (IL-6) and interferon-y (TIN-y‘) which are members of the family of inflammatory ..:ytokines produced by multiple cell types, and pos$2~5 essential roles in response to infection, and immunological homeostasis [2,1 I]. X rapid increase in the levels of these cytokines in serum in response to infection produces a cascade of biological effects deLectsble in many tissues including the liver. Among the three HCC cell lines tested, HEP-G2 cells, which are well differentiated, showed highest degrees of enhancement of transactivation of HIV-I-LTR activity; SK-HEP-1 cells, which are poorly differentiated, showed low or very low enhancement; and J5 cells, which are intermediate in their status of differentiation, responded with intermediate degree of enhancement to TPA and to each of these cytokines. The cycokine response elements (CR%) in the HIV-I-LTR were mapped by transfectmg HEP-G2 cells with nested series of 5’ deletion mutants of HIV- I-LTR and treating with each of these cytokines. It was found that the degree of enhancement varied depe~nding upon the presence of negative or positive regulatory sequences in these LTR mutants. These results revealed positive and negative regulation of crosstalk between cellular rruns-activating factors produccd or activated as a result of cytokine treatment and those CREs present in various cehular genes and also represented by some sequences within HIV- l-LTR. 2. Materials
and methods
3. i. Cell lines The HEP-G2
and SK-HEP-I
lines of HCC and
their differentiation characteristics have been described previously 171. Another HCC cell line, J5, was kindly provided by Dr. C.S. Yang, National Taiwan University College of Medicine, who established it in culture from a Taiwanese HCC patient. The HEP-G2 cells produced I5 kinds of plasma protein including albumin, a*-macroglobulin, a,-antitrypsin. and transferrin, etc. [5], while the J5 cells produced albumin and a?-maeroglobulin only (unpublished). In contrast. the SK-HEP- I cells produced none of these [Sj. Based on the morphological characteristics and the ability to secrete human plasma proteins, HEP-G2 cells have been considered to be well differentiated, J5 cells moderately differentiated, and the SK-HEP- I cells poorly differentiated. -.u. ’ 7 Cytokines and reagents The recombinant human IL-la and IFN-)/ were purchased from Genzyme Corporation (Boston, MA). The 18 kDa recombinant human IL- 1~ preparation had a specific activity of -2 X lo8 to - 1 X 1O9 units (U)/mg. The recombinant human IFN-)/ had a specific activity of -2.5 X 10’ U/mg. The molecular size was 17.15 kDa for the monomer and 34 kDa for the dimer. The human IL-6 purified from the T-cell culture supernatant was purchased from Boehringer and Mannheim, and had a specific activity of 1 x IO8 U/mg. The ‘%-labeled acetyl-CoA (CAT assay grade) was purchased from New England Nuclear-DuPont (Wilmington DE). 2.3. Plasmids The HIV-l wild-type LTR (-670 construct) and a nested series of its 5’ detetion mutants as well as a location within the LTR of various promoters and negative regulatory elements have been described [6.7]. The -6706 construct was reported previously as having a deletion located between -5 12 and -528. but recent data indicate the exact location of deletion (-5 17 to 527) which is substituted by the sequence as indicated in Fig. 1
The plasmids were introduced into cells by the DEAE dextran method as described previously [7]. Briefly, 3 x 10’ cells were plated into each of 60 mm culture dishes containing Dulbecco’s modified minimal essential medium (DMEM) supplemented with
M.-L.
p-670
Hsu et al. I Cancer
&
Letters
94 (1995)
43
4148
-67OA
-680
acgagctgagccagcagcag
atggggtggg
agcagcatct
cgagac//+aacatgg IL-6RE
-620
agcaatcaca
cagcagctac
caatgctgct
tgtgcctggc
-560
agaggaggaggaggtgggtt
ttccagtcac
ac
-500
caaggcagctgtagatctta
gccacttttt
aaaagaaaag
-440
tcactcccaa
atatccttgatctgtggatctaccacacac
-380
CcctgatTGAcagaactaca
agtagcaaca
agaagacaag
caccagggcc
tagaagcaca
aagac
caatgactta
ggggg4mqgggctaat IL-6RE aaggctactt
t c a ga ~~~~~~~~~~~~~~~~~~~~'
agg
APl
#@&
p-278
-320
IL-Z/IL-ZR/IFN-y -260 -200 -140 r-48
T-65 -80
agggdm4 SPl(II1)
Spl (II)
trdgagcc SPl(I)
NFKB
NFKB ctca
atcct
I gee t&Z/
-20
LBP-1 gaaccca
+41
+101
gcatataagc
aaaaaacccc
cccccccccc
TAR gtgcttcaaa
ctgcttaagc
ctcAATAAAg
cttgccttga
cccccccgca
agcttgcaag
ctt,~~~~~~~~~~~~
Fig. 1. The HIV-l LTR nucleotide sequence ligated to CAT gene. The 5’ end of sequence for each of the deletion mutants is marked by an arrow sign. The -670A construct has a deletion (-517 to -527) which is substituted by the sequence CTCTAGAGCTCTAGAG. The shaded regions indicate locations for negative regulatory elements, NRE-I, NRE-2 and NRF-binding sites. The locations for positive regulatory elements, i.e. IL-6-RE, API, IL-2/IL-2R/IFN-y, NFAT-I, NFKB, SPl, LBP-I, TAR, and CTF, are marked by brackets,
10% fetal bovine serum,and after incubation at 37°C for 2 days, the cells were washed with serum free medium and covered with 2.5 ml of lOO~g/ml DEAE dextran containing 10 ,ug plasmid DNA. After incubation at 37°C for 1 h, the cells were washed once with phosphate buffered saline. The cells were fed with 4 ml culture medium per plate, and after
incubation at 37°C for 24 h, exposed to one of the cytokines or TPA at the following concentrations: ILla 2OOU/ml, IL-6 500 U/ml, IFW-)/ 10 U/ml, and TPA 10m7M. After further incubation for 48 h, the cells were harvested by trypsin-EDTA and equal amounts in terms of protein content (1oOpg) were assayedfor CAT activity by the method of Neumann
_.__-
-----
-..------.-
I
-.-
1
Treatment Fig. 2. Enhancement of tracts-activating activities of HEP-GZ, J5 and SK-HEP-1 cells transfected with wild-type (-670 construct) HIV-:-LTK and treated with IL-lu, IL-h, IFN-y. or TPA. Each cuperimenr was repeated three times and the results were ex pressed as the average fold increase in the tevel of activity x
of [llC]acetylchloramphenico1 produced was measuredas an indicator of the transactivation activity. Triplicate transfection experiments were performed under identical conditions for each plasmid-cell combination. To standardizetransfection efficiencies, 10,ug of the plasmid pSVfi iClontech) containing the bacterial P-galactosidase gene driven by the SV40 promoter, was cotransfected with the above mentioned plasmids. The p-galactositiase activity was assayedby the standard method and the OD?,, readings were then usedto normalize CAT activities. Each experiment was repeatedat least three times and the results were expressedas the average fold increase in the level of activity compared with that of the~control. The standard error was expressedby a bar for each histogram in Figs. 2 and 3. ci al. [?I 1. The amount
abdities of these cells to secrete plasma proteins, HEP-G2 cells are considered to be well differentiated, and J5 cells moderately differentiated, while SK-HEP-1 cells poorly differentiated. As illustrated m Fig. 2, the ability of constitutive cellular proteins to rmns-activate HIV-LTR-C.4T gene wild-type construct c-670) was markedly enhanced by treating these transfected cells with IL-la, IL-6 IFN)/ or TPA, at concentrations 200 U/ml. 500 U/ml, IO U/ml and IO-” M, respectively, in the medium. The results indicated that HEP-G2 cells exhibited 4-fold higher levels of CAT activity after treatment with IL-la. 2.9-fold higher levels with IL-6, and 3.3-fold higher levels with IFNy, while showing 6.5-fold higher levels with TPA, whereasthe degreesof enhancement after treatment of J5 cells were similar in trend but at slightly lower levels compared with those shown by HEPG2 cells, i.e. 3-fold with IL-la, 2.5-fold with both IL-6 and IFN-11,and 3.5-fold with TPA. In contrast, SK-KEP-1 cells showed no enhancement but rather a slight decreasein rrans-activating activities after treatment with cytokines, and only a slight (1.4fold) increase with TPA treatment, Thus the enhancement of transactivation by cytokine treatment was generally highest in HEP-G2 cells, moderate in J5 cells, reduced or none in SK-HEP-I cells. Therefore, different fmns-activating efficiencies with which various HCC cell lines respond to treatment
1
3. Results i 1. Eserts qf’cytokines and TPA on tram-activntinp ucrivities We have previously observed a striking difference in the degreeswith which HIV-LTR-CAT gene transactivating activities of HEP-G2 and SK-HEP-I cells :Ire enhanced after TPA treatment [7] Based on the
Fig. 3. Delineation of the cytokine-responsive regions of HIV-II-TR by observing the cytokine-induced enhancement of rrunsactivating activities of HEP-G7 cells transfected with S’-dcketion mutants of HIV-I-LTR. The average fold increase in the level of activity was compared with that of the untreated control cells transfected with the wild-type (-670 construct). The standard error was expressed by a bar for each histogram.
M.-L.
Hsu et al. I Cancer
with these cytokines as well as TPA may serve as a marker of status of cellular differentiation. 3.2. Mapping l-LTR
of cytokine
responsive
regions
in HIV-
Since different target promoter/enhancer sequencespresent in the HIV-LTR may be affected by different cellular trans-activating factors induced by various cytokine transduction pathways, we examined the ability of different deletion mutants of the LTR to respondto each of thesecytokines in order to locate the relevant target P/E sequences. Fig. 3 shows the normalized fold-increase in CAT activities, by using the CAT activity exhibited by untreated cells transfected with the wild-type (-670 construct) as the base, to compare the degree of enhancement of trans-activating activities of HEP-G2 cells transfected with nested series of 5’-deletion mutants. While the untreated cells showed a marked decreasein their trans-activating activities when the -278 deletion mutant was used, the -176 mutant showed a less depressedresponse.This may reflect the fact that the -176 mutant lacked the NRE-1 sequence [27] as well as most of the NRE-2 element [13], although the NRF sequence[19] was still present. Further deletion beyond -176 resulted in little or no increasein truns-activating activities. Treatment of HEP-G2 cells with IL-la resulted in a 4-fold increasein transactivation with the wild-type construct, but the -670A mutant exhibited a marked decline to 1.6-fold increase. However, there was an up-regulation again when the -278 mutant was used, resulting in a 3.2-fold increase.The -176, -117 and -103 mutants showedlesserdegreesof enhancement, i.e. 2.5-, 2.4- and 1.3-fold increases,respectively. The up-regulation obtained with the -278 mutant was also observed with the IL-6 treatment and may be due to similar reasons. Treatment of HEP-G2 cells with IL-6 resulted in a 2.7-fold increase in transactivation when the wildtype -670 construct was used. The mutants -67OA, -176 and -117 showedsimilar degreesof increasein transactivation asdid the -670 construct, whereasthe -278 mutant exhibited a marked (6-fold) increasein transactivation. The -278 mutant lacked a portion of NRE- 1 but retained NRE-2 and NRF sequences.This would suggestthat the deleted region of NRE-1 contained a negative regulatory sequencewhich played a
Letters
94 (1995)
4148
4s
more important role than NRE-1 or NRF regions in exerting marked suppressive effects. The deletion mutant -103 showed lessincrease, i.e. only a 2-fold increase, of transactivation, while the -65 and -48 mutants showed no truns-activating activities regardlessof whether the HEP-G2 cells were treated or not with IL-6, IL-la, or IFN-y. The fact that the -103 mutant lost two basesfrom the 5’ proximal KB sequence may be the reason for its slight decline in transactivation efficiency. The trans-activating response of HEP-G2 cells after IFN-y treatment was enhanced3.4-fold with the wild-type construct, 1.7-fold with the -670A mutant, 1.2-fold with the -278 mutant, but up-regulated again to 2.4-fold with the -176 mutant. The fact that -176 mutant lacked the NRE-1 sequenceas well as most of the NRE-2 element would suggestthat these negative regulatory elementscould play an inhibitory role on the IFN-)/ responsive elements.Further deletion to -117 and -103 resulted in no enhancementof transactivation, despite the fact that both -117 and 103 mutants possessedcomplete or 2-bp deficient NF-lcB-binding sequences,respectively. 4. Discussion In the presentinvestigation, we demonstratedthat the transactivation-enhancing effects of cytokines, including IL-la, IL-6 and IFN-)I, as well as TPA were generally highest with well differentiated HEPG2 cells, intermediate with moderately differentiated J5 cells, and none, or rather reduced, with the poorly differentiated SK-HEP-1 cells. Since the statusof cellular differentiation of these HCC cell lines appears to be an important determinant for exhibition of the transactivation-enhancingeffects of cytokines as well as TPA, these effects may well serve as their functional markers. Further experiments with HEP-G2 cells transfected with nested series of 5’ deletion mutants of HIV-l-LTR delineated the possible regions of activation within the LTR, and, as observed in a previous report [7], the presence of negative regulatory sequence acting against the transactivation-enhancing effects of these cytokines. The nature of thesenegative elementsneedsto be further investigated. The presentinvestigation further indicated that the KB sequencewas a necessaryand important compo-
nets of the regions that were activated by these cyrokines. Numerous agents which can cause the release of NF-K-B from its inhibitory protein I& have been identified; they include inflammatory cytokines like TNF-rx and IL-i~r, TPA, bacterial LPS, DNAdamaging agents, double-stranded RNA, reactive e-1xyge.n intermediates, and infection by viruses in,:luding HIV- I [3]. IL- la is produced by multiple cell types. including cells of the monocytic lineage, T and ‘;r lymphocytes, fibroblasts. neutrophiis, and micro5<$a1 ceils [2,11]. IL-la is known to autoregulate its own synthesis by activating NF-KB which subseiluently binds to KB sequence presentin its own promoter. Since the promoters of IL-2 receptor a-chain tlL2Rcx) gene which contains I~B sequenceare also up-regulated [ 171,it is possiblethat these HCC cells after treatment with IL-In may produce more IL-in and IL-2Ru causing subsequentchain reactions of enhancementof transactivation. Our findings on the enhancementof transactivation by HEP-G2 and J5 ceils transfected with HIV- I-LTR which contains promoters for IL-2R and KB sequencesare in line wtth these possibilities. However, the SK-HEP- 1 c.tli%may iack receptors or sometransduction factors :rl [his pathway despite the presenceof KB and other promotel-sin the transfected HIV- I -IJT’R II.-6 1sinvolved in the differentiation of B and -1. celib, acts as a myeloma growth factor, and induces the synthesis of the acute-phaseplasma proteins in the liver [ 141. NF-IL6 protein, which is highly expressed in liver nuclei, is implicated as a master regulator of the acute-phaseresponse[1,2334], induced by IL-6 and other inflammatory mediators such as TNF~x [X,24]. Stimulation by TPA of the protein kinase C pathway increasesthe phosphorylalion of NF-11-6. and enhancesIts transactivation ac!Ivlty on several cytokine genes,including IL,-6 itself, IL-K. TNFcf and G-CSF. becausecritical c&acting elementsof these genesinclude IL-6RE. The NF-IL6 protein may be induced by IL-la since a sequence iposltions -72 to -62) on the human IL-6 geneshares 90% homology with the classicalKB sequence[27] which is up-regulated by IL-la. Thus exogenousILi
theseto specific receptors and activation of tyrosine kinaseswhich belong to the Januskinase(Jak) family 191.Latent cytoplastiic proteins termed ‘signal transducers and activators of transcription’ (STATS) also becomeactivated, presumably by the Jaks. The activated STATSare translocatedto the nucleuswhere by themselvesor in combination with otherwise weak DNA binding proteins, they bind to specific REs and stimulate transcription. IFN-), can cause immediate transactivation of several genes [4,10,16-l 8,221 as well as the initial RE in the IFN-y pathway [9]. The promoter for the gene encoding the transactivating human II%-response factor- 1 (IRF- 1) containstinreeputative NF-KB binding sites [26]. The KB-like sequencepresent in IRF-1 gene would also he up-regulated by IL-la. IL-6 or IFN-)/ itself. In studies using a Tat-expression vector, IFN-y was found to antagonize the trans-activating activities of Tat protein, mediated by inhibition by INF-), of the expression or the activity of cellular factors [ 121. Since a high level of II%-)/ is often associatedwith HIV-i infection, its suppressiveeffect on Tat would contribute to the establishmentof HIV-l latency in infected cells [12j. However, in our experiments where no Tat-expressjon vector was used, we found that IFN-y exhibited an enhancing effect on transactivation of the LTR in vitro. This would support the notion that there may be. a balancing effect between these two opposmg activities for regulation-of viral replication. Thus IFN-y could act as a double-edged sword for promotion or suppressionof viral replication through balancing these opposing effects of transactivation in in vivo situations. Acknawledgments We thank Dr. Stephen Josephs(Applied Sciences, Baxter Healthcare Corporation, Round Lake, IL 60073. USA) for providing us with the plasmidsfor the nested series of 5’ deletion mutants of HIV-ILTR. The present investigation was supported partly by the National Science Council (NSC-82-Q412B182-091) and partly by the Department of Health ;DOH83-HR-209). Taiwan, Republic of China. References 1I 1 Akira.
S.. Isshiki,
H.. Sugita.
T., Tanabe.
0..
Kinoshita
S..
M.-L.
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[lo]
[II] [12]
[13]
[14]
[15]
Hsu et al. I Cancer
Nishio, Y., Nakajima, T., Hirano, T. and Kishimoto, T. (1990) A nuclear factor for IL-6 expression (NF-II.@ is a member of a ClEBP family. EMBO J., 9, 1897-1906. Arai, K.I.. Lee, F., Miyajima, A., Miyatalce, S., Arai, N. and Yokota, T. (1990) Cytokines: coordinators of immune and inflammatory responses, Annu. Rev. Biochem., 59, 783839. Beg, A.A., Finco, T.S., Nantermet, P.V. and Baldwin, Jr., AS. (1993) Tumor necrosis factor and interleukin-I lead to phosphorylation and loss of bcBa: a mechanism for NF-KB activation. Mol. Cell. Biol., 13, 3301-3310. Briskin, M., Kuwabara, M.D., Sigman, D.S. and Wall, R. (1988) Induction of IC transcription by interferon-y without activation of NF-KB. Science, 242, 10361037. Chang, C., Lin, Y., O-Lee, T.-W., Chou, C-K., Lee, T.-S., Liu, T.-J., P’eng, F-K., Chen, T.-Y. and Hu, C.-P. (1983) Induction of plasma protein secretion in a newly established human hepatoma cell line. Mol. Cell. Biol., 3, 11331137. Chang, K.S.S., Liu, W.T. and Josephs, S.F. (1991) Regulation of cellular trclns-activating activities in two different promonocytic leukemia cell lines, Cancer Lett., 60,75-83. Chang, KS..?.., Hsu, M.-L. and Josephs, SF. (1993) Regulation of HIV-l LTR frans-activating activities in two different human hepatocellular carcinoma cell lines. Cancer Len., 74, 75-83. Darlington, G.J., Wilson, D.R. and Lachman, L.B. (1986) Monocyte-conditioned medium, interleukin-1, and tumor necrosis factor stimulate the acute phase response in human hepatoma cells in vitro. J. Cell Biol., 103, 787-793. Darnell, Jr., J.E., Kerr, I.M. and Stark, G.R. (1994) Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science, 264, 1415-1421. Decker, T., Lew, D.J., Mirkovitch, J. and Darnell, Jr., J.E. (1991) Cytoplasmic activation of GAP, an IFN-y-regulated DNA-binding factor, EMBO J., 10, 927-932. Dinarello, CA. (1991) Interleukin 1 and interleukin 1 antagonism. Blood, 77, 1627-1652. Emilie, D., Maillot, M-C., Nicolas, J.-E, Fior, R. and Galanaud, P. (1992) Antagonistic effect of interferon-y on tatinduced transactivation of HIV long terminal repeat. J. Biol. Chem., 267,20565-20570. Garcia, J.A., Wu, F.K., Mitsuyasu, R. and Gaynor, R.B. (1987) Interactions of cellular proteins involved in the tmnscriptional regulation of the human immunodeficiency virus. EMBO J., 6.3761-3770. Heinrich, P.C., Duthues, G., Flohe, S., Horn, F., Krause, E., Kriittgen, A., Legres, L., Lenz, D., Liitticken, C., Schooltink, H., Stoyan, T., Conradt, H.S. and Rose-John, S. (1991) Interleukin-6, its hepatic receptor and the acute phase response in liver. In: Molecular Aspects of Inflammation, pp. 129-145. Editors: H. Sies, L. Flohe and G. Zimmer. Springer, Berlin. Hiscott, J., Marois, J., Garoufalis, J., D’Addario, M., Roulston, A., Kwan, I., Pepin, N., Lacoste, J., Nguyen, H., Bensi, G. and Fenton, M. (1993) Characterization of a functional NF-KB site in the human interleukin 18 promoter: evidence
Letters
94 (1995)
4148
47
for a positive autoregulatory loop. Mol. Cell. Biol., 13, 6231-6240. [16] Kanno, Y., Kozak, CA., Schindler, C., Driggers, P.H., Ennist, D.L., Gleason, S.L., Damell, Jr., J.E. and Ozato, K. (1993) The genomic structure of the murine ICSBP gene reveals the presence of the gamma interferon-responsive element, to which an ISGF3a subunit [or similar] molecule binds. Mol. Cell. Biol., 13, 3951-3963. [17] Lew, D.J., Decker, T. and Damell, Jr., J.E. 11989) Alpha interferon and gamma interferon stimulate transcription of a single gene through different signal transduction pathways. Mol. Cell. Biol., 9, 5404-5411, [18] Lew, D., Decker, T., Strehlow, I. and Darnell, Jr., J.E. (1991) Overlapping elements in the guanylate-bindin protein gene promoter mediate transcriptional induction by alpha and gamma interferons. Mol. Cell. Biol., 11, 182. [19] Lu, Y., Touzjian, N., Stenzel, M., Dorfman, T., Sodroski, J.G. and Haseltine, W.A. (1990) Identification of &-acting repressive sequences within the negative regulatory element of human immunodeticiency virus type 1. .I. Viral., 64, 5226-5229. [20] Ltltticken, C., Wegenka, U.M., Yuan, J., Buschmann, J., Schindler, C., Ziemicki, A., Harpur, A.G., Wilks, A.F., Yasukawa, K., Taga, T., Kishimoto, T., Barbieri, G., Pellegrini, S., Sendtner, M., Heimich, P.C. and Horn, E (1994) Association of the transcription factor APRF and protein kinase Jakl with the IL-6 signal transducer gp130. Science, 263,89-92. [21] Neumann, J.R., Motency, CA. and Russian, K.O. (1987) A novel rapid assay for chloramphenicol acetyltransferase gene expression. Biotechniques, 5,444-447. [22] Pearse, R.N., Feinman, R., Shuai, K., Darnell. Jr., J.E. and Ravetch, J.V. (1993) Interferon y-induced transcription of the high-affinity Fc receptor for IgG requires assembly of a complex that includes the 91-kDa subunit of transcription factor ISGF3. Proc. Natl. Acad. Sci. USA, 90,4314-4318. [23] Poli, V and Cortese, R. (1989) Interleukin 6 induces a liverspecific nuclear protein that binds to the promoter of acutephase genes. Proc. Natl. Acad. Sci. USA, 86,8202-X06. [24] Poli, V, Mancini, F.P. and Cortese, R. (1990) ILdDBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to CiEBP. Cell, 63,643-653. [25] Rosen, C.A., Sodroski, J.G. and Haseltine, WA. (1985) The location of &s-acting regulatory sequences in the human T cell lymphotropic virus type III (HTLV-IIYLAV) long terminal repeat. Cell, 41, 813-823. [26] Ruff-Jamison, S., Chen, K. and Cohen, S. (1993) Induction by EGF and interferon-y of tyrosine phosphorylated DNA binding proteins in mouse liver nuclei. Science, 261, 17331736. [27] Sen, R. and Baltimore, D. (1986) Inducibility of K immunoglobulin enhancer-binding protein NF-KB by a posttranslational mechanism. Cell, 47, 921-928. 1281 Trautwein, C., Caelles, C., van der Geer, P., Hunter, T., Karin, M. and Chojkier, M. (1993) Transactivation by NFIL6/LAP is enhanced by phosphorylation of its activation domain. Nature, 364, 544-547.
!ZGl
Wegrnka. U.M., Buschmann. J., Liitticken, C.. Heimich. P.C and Horn. E ( 1991) Acute-phase response factor, a nu clear factor binding to acute-phase response elements. is rnpidly activated by interleukin-6 at the posttranslational level. Mol. Cell. Biol., 13. 276288.
Ii01
Yuan,
J
Wegenkn.
U.M..
Liitticken.
C
Ruschmnnn.
I..
Decker. T., Schindler, C.. Heinrich, P.C. and Horn, F. I 1994) The signaling pathways of interleukin-6 and gamma interferon converge by the activation of different transcription factors which bind to common responsive DNA elements. Mol. Cell. Biol . 14. 1657-1668
ELSEVIER
Cancer
L.etters 94 (1995)
41-48
Cytokine regulation of HIV-l LTR transactivation hepatocellular carcinoma cell lines Mei-Ling
in human
Hsu, Shiuh-Wei Chen, Kwang-Huei Lin, Shun-Kuei Liao, Kenneth S.S. Chang*
Gruduate
Institute
of Clinical
Medicine.
Chang Gung Medical
College,
Taoyuan-Hsien,
Taiwan, Republic
of China
Received 5 December 1994; revision received 14 April 1995; accepted 17 April 1995
Abstract
Human hepatocellular carcinoma (HCC) cell lines, HEP-G2,55, and SK-HEP-1, which differ in their differentiation status, were compared for their trans-activating activities after treatment with cytokines or 12-O-tetradecanoylphorbol-13-acetate (TPA). These cells were transfected with a long terminal repeat (LTR) which was derived from human immunodeficiency virus type 1 (HIV-l) and ligated to chloramphenicol acetyl transferase (CAT) gene. After treatment with interleukin-la (ILla), interleukin-6 (IL-6), interferon-y (IFN-y), or TPA, they exhibited various degrees of enhancement of transactivation. The well differentiated HEP-G2 cells exhibited the highest degree of enhancement with these agents, while the poorly differentiated SK-HEP-1 cells showed no enhancement with cytokines and slight enhancement with TPA. The J5 cells, which were intermediate in their status of differentiation, showed a moderate degree of enhancement with cytokines and TPA. These results suggest that HCC cells at different stages of differentiation may produce different levels of cellular transacting factors activated by each of these agents. To map the cytokine response elements (CREs) in the HIV-I-LTR, HEP-GZ cells were transfected with nested series of 5’ deletion mutants of HIV-l-LTR and treated with each of these cytokines. It was found that not only the degrees but also the patterns of enhancement varied depending upon the presence of positive or negative regulatory sequences in HIV-l-LTR, and that the NF-KB sequence played an important role, either by itself or in conjunction with the 5’-proximal response elements (REs) to interact with cellular rrans-activating factors elicited by the cascade of transduction responses to cytokines. Despite the presence of promoters including KB and IPN-y RE as well as IL-6RE sequence in HIV-I-LTR-transfected cells, the poorly differentiated SK-HEP-1 cells showed no enhancement of transactivation by these cytokines, suggesting the lack of receptors or activity of some signal transduction factors which are present in well differentiated HEP-G2 and moderately differentiated J5 cells. Keywords:
Cytokines; Interleukin-la;
Interleukin-6;
Interferon-y; Transactivation;
1. Introduction We have been studying trans-activating of human hepatocellular carcinoma (HCC)
activities cell lines
* Corresponding author, Tel.: +886 3 3282144; Fax: +886 3 3280170.
Hepatoma
for the transfected promoter/enhancer (P/E) sequences of human immunodeficiency virus type 1 (HIV-l) long terminal repeat (LTR). The nested series of 5’ deletion mutants of HIV-l LTR, which contains various P/E elements similar to those of cells, have been useful for mapping the possible target sequences which may vary in their relative Importance
0304-3835/95/$09.50 0 1995 Elsevier Science Ireland Ltd. All rights reserved SSDI 0304-3835(95)03820-M
depending on the status of cellular differentiation. We have shown that human HCC cell lines. HEP-G2 and SK-HEP-I. exhibited marked difference in their constitutive as well as TPA-induced tr~ns-activating :ictivities (71. There 15 now ample evidence that one important consequence of cyfokine-receptor interaction at the ceil surface is the transactivation of previously quiescent genes. The specific effects induced by cytokines rn cells of different lineage ~111be determined by the selective activation of tissue-specific secondary response genes [IO]. We report here on the quantitative transactivation response of a transfected HIV- I-IXR m HCC cell lines to 12-O-tetradecanoylphorbol-13ncetate (TPA) or cytokines such as interleukin-la ; if.- lc?t, interleukin-6 (IL-6) and interferon-y (TIN-y‘) which are members of the family of inflammatory ..:ytokines produced by multiple cell types, and pos$2~5 essential roles in response to infection, and immunological homeostasis [2,1 I]. X rapid increase in the levels of these cytokines in serum in response to infection produces a cascade of biological effects deLectsble in many tissues including the liver. Among the three HCC cell lines tested, HEP-G2 cells, which are well differentiated, showed highest degrees of enhancement of transactivation of HIV-I-LTR activity; SK-HEP-1 cells, which are poorly differentiated, showed low or very low enhancement; and J5 cells, which are intermediate in their status of differentiation, responded with intermediate degree of enhancement to TPA and to each of these cytokines. The cycokine response elements (CR%) in the HIV-I-LTR were mapped by transfectmg HEP-G2 cells with nested series of 5’ deletion mutants of HIV- I-LTR and treating with each of these cytokines. It was found that the degree of enhancement varied depe~nding upon the presence of negative or positive regulatory sequences in these LTR mutants. These results revealed positive and negative regulation of crosstalk between cellular rruns-activating factors produccd or activated as a result of cytokine treatment and those CREs present in various cehular genes and also represented by some sequences within HIV- l-LTR. 2. Materials
and methods
3. i. Cell lines The HEP-G2
and SK-HEP-I
lines of HCC and
their differentiation characteristics have been described previously 171. Another HCC cell line, J5, was kindly provided by Dr. C.S. Yang, National Taiwan University College of Medicine, who established it in culture from a Taiwanese HCC patient. The HEP-G2 cells produced I5 kinds of plasma protein including albumin, a*-macroglobulin, a,-antitrypsin. and transferrin, etc. [5], while the J5 cells produced albumin and a?-maeroglobulin only (unpublished). In contrast. the SK-HEP- I cells produced none of these [Sj. Based on the morphological characteristics and the ability to secrete human plasma proteins, HEP-G2 cells have been considered to be well differentiated, J5 cells moderately differentiated, and the SK-HEP- I cells poorly differentiated. -.u. ’ 7 Cytokines and reagents The recombinant human IL-la and IFN-)/ were purchased from Genzyme Corporation (Boston, MA). The 18 kDa recombinant human IL- 1~ preparation had a specific activity of -2 X lo8 to - 1 X 1O9 units (U)/mg. The recombinant human IFN-)/ had a specific activity of -2.5 X 10’ U/mg. The molecular size was 17.15 kDa for the monomer and 34 kDa for the dimer. The human IL-6 purified from the T-cell culture supernatant was purchased from Boehringer and Mannheim, and had a specific activity of 1 x IO8 U/mg. The ‘%-labeled acetyl-CoA (CAT assay grade) was purchased from New England Nuclear-DuPont (Wilmington DE). 2.3. Plasmids The HIV-l wild-type LTR (-670 construct) and a nested series of its 5’ detetion mutants as well as a location within the LTR of various promoters and negative regulatory elements have been described [6.7]. The -6706 construct was reported previously as having a deletion located between -5 12 and -528. but recent data indicate the exact location of deletion (-5 17 to 527) which is substituted by the sequence as indicated in Fig. 1
The plasmids were introduced into cells by the DEAE dextran method as described previously [7]. Briefly, 3 x 10’ cells were plated into each of 60 mm culture dishes containing Dulbecco’s modified minimal essential medium (DMEM) supplemented with
M.-L.
p-670
Hsu et al. I Cancer
&
Letters
94 (1995)
43
4148
-67OA
-680
acgagctgagccagcagcag
atggggtggg
agcagcatct
cgagac//+aacatgg IL-6RE
-620
agcaatcaca
cagcagctac
caatgctgct
tgtgcctggc
-560
agaggaggaggaggtgggtt
ttccagtcac
ac
-500
caaggcagctgtagatctta
gccacttttt
aaaagaaaag
-440
tcactcccaa
atatccttgatctgtggatctaccacacac
-380
CcctgatTGAcagaactaca
agtagcaaca
agaagacaag
caccagggcc
tagaagcaca
aagac
caatgactta
ggggg4mqgggctaat IL-6RE aaggctactt
t c a ga ~~~~~~~~~~~~~~~~~~~~'
agg
APl
#@&
p-278
-320
IL-Z/IL-ZR/IFN-y -260 -200 -140 r-48
T-65 -80
agggdm4 SPl(II1)
Spl (II)
trdgagcc SPl(I)
NFKB
NFKB ctca
atcct
I gee t&Z/
-20
LBP-1 gaaccca
+41
+101
gcatataagc
aaaaaacccc
cccccccccc
TAR gtgcttcaaa
ctgcttaagc
ctcAATAAAg
cttgccttga
cccccccgca
agcttgcaag
ctt,~~~~~~~~~~~~
Fig. 1. The HIV-l LTR nucleotide sequence ligated to CAT gene. The 5’ end of sequence for each of the deletion mutants is marked by an arrow sign. The -670A construct has a deletion (-517 to -527) which is substituted by the sequence CTCTAGAGCTCTAGAG. The shaded regions indicate locations for negative regulatory elements, NRE-I, NRE-2 and NRF-binding sites. The locations for positive regulatory elements, i.e. IL-6-RE, API, IL-2/IL-2R/IFN-y, NFAT-I, NFKB, SPl, LBP-I, TAR, and CTF, are marked by brackets,
10% fetal bovine serum,and after incubation at 37°C for 2 days, the cells were washed with serum free medium and covered with 2.5 ml of lOO~g/ml DEAE dextran containing 10 ,ug plasmid DNA. After incubation at 37°C for 1 h, the cells were washed once with phosphate buffered saline. The cells were fed with 4 ml culture medium per plate, and after
incubation at 37°C for 24 h, exposed to one of the cytokines or TPA at the following concentrations: ILla 2OOU/ml, IL-6 500 U/ml, IFW-)/ 10 U/ml, and TPA 10m7M. After further incubation for 48 h, the cells were harvested by trypsin-EDTA and equal amounts in terms of protein content (1oOpg) were assayedfor CAT activity by the method of Neumann
_.__-
-----
-..------.-
I
-.-
1
Treatment Fig. 2. Enhancement of tracts-activating activities of HEP-GZ, J5 and SK-HEP-1 cells transfected with wild-type (-670 construct) HIV-:-LTK and treated with IL-lu, IL-h, IFN-y. or TPA. Each cuperimenr was repeated three times and the results were ex pressed as the average fold increase in the tevel of activity x
of [llC]acetylchloramphenico1 produced was measuredas an indicator of the transactivation activity. Triplicate transfection experiments were performed under identical conditions for each plasmid-cell combination. To standardizetransfection efficiencies, 10,ug of the plasmid pSVfi iClontech) containing the bacterial P-galactosidase gene driven by the SV40 promoter, was cotransfected with the above mentioned plasmids. The p-galactositiase activity was assayedby the standard method and the OD?,, readings were then usedto normalize CAT activities. Each experiment was repeatedat least three times and the results were expressedas the average fold increase in the level of activity compared with that of the~control. The standard error was expressedby a bar for each histogram in Figs. 2 and 3. ci al. [?I 1. The amount
abdities of these cells to secrete plasma proteins, HEP-G2 cells are considered to be well differentiated, and J5 cells moderately differentiated, while SK-HEP-1 cells poorly differentiated. As illustrated m Fig. 2, the ability of constitutive cellular proteins to rmns-activate HIV-LTR-C.4T gene wild-type construct c-670) was markedly enhanced by treating these transfected cells with IL-la, IL-6 IFN)/ or TPA, at concentrations 200 U/ml. 500 U/ml, IO U/ml and IO-” M, respectively, in the medium. The results indicated that HEP-G2 cells exhibited 4-fold higher levels of CAT activity after treatment with IL-la. 2.9-fold higher levels with IL-6, and 3.3-fold higher levels with IFNy, while showing 6.5-fold higher levels with TPA, whereasthe degreesof enhancement after treatment of J5 cells were similar in trend but at slightly lower levels compared with those shown by HEPG2 cells, i.e. 3-fold with IL-la, 2.5-fold with both IL-6 and IFN-11,and 3.5-fold with TPA. In contrast, SK-KEP-1 cells showed no enhancement but rather a slight decreasein rrans-activating activities after treatment with cytokines, and only a slight (1.4fold) increase with TPA treatment, Thus the enhancement of transactivation by cytokine treatment was generally highest in HEP-G2 cells, moderate in J5 cells, reduced or none in SK-HEP-I cells. Therefore, different fmns-activating efficiencies with which various HCC cell lines respond to treatment
1
3. Results i 1. Eserts qf’cytokines and TPA on tram-activntinp ucrivities We have previously observed a striking difference in the degreeswith which HIV-LTR-CAT gene transactivating activities of HEP-G2 and SK-HEP-I cells :Ire enhanced after TPA treatment [7] Based on the
Fig. 3. Delineation of the cytokine-responsive regions of HIV-II-TR by observing the cytokine-induced enhancement of rrunsactivating activities of HEP-G7 cells transfected with S’-dcketion mutants of HIV-I-LTR. The average fold increase in the level of activity was compared with that of the untreated control cells transfected with the wild-type (-670 construct). The standard error was expressed by a bar for each histogram.
M.-L.
Hsu et al. I Cancer
with these cytokines as well as TPA may serve as a marker of status of cellular differentiation. 3.2. Mapping l-LTR
of cytokine
responsive
regions
in HIV-
Since different target promoter/enhancer sequencespresent in the HIV-LTR may be affected by different cellular trans-activating factors induced by various cytokine transduction pathways, we examined the ability of different deletion mutants of the LTR to respondto each of thesecytokines in order to locate the relevant target P/E sequences. Fig. 3 shows the normalized fold-increase in CAT activities, by using the CAT activity exhibited by untreated cells transfected with the wild-type (-670 construct) as the base, to compare the degree of enhancement of trans-activating activities of HEP-G2 cells transfected with nested series of 5’-deletion mutants. While the untreated cells showed a marked decreasein their trans-activating activities when the -278 deletion mutant was used, the -176 mutant showed a less depressedresponse.This may reflect the fact that the -176 mutant lacked the NRE-1 sequence [27] as well as most of the NRE-2 element [13], although the NRF sequence[19] was still present. Further deletion beyond -176 resulted in little or no increasein truns-activating activities. Treatment of HEP-G2 cells with IL-la resulted in a 4-fold increasein transactivation with the wild-type construct, but the -670A mutant exhibited a marked decline to 1.6-fold increase. However, there was an up-regulation again when the -278 mutant was used, resulting in a 3.2-fold increase.The -176, -117 and -103 mutants showedlesserdegreesof enhancement, i.e. 2.5-, 2.4- and 1.3-fold increases,respectively. The up-regulation obtained with the -278 mutant was also observed with the IL-6 treatment and may be due to similar reasons. Treatment of HEP-G2 cells with IL-6 resulted in a 2.7-fold increase in transactivation when the wildtype -670 construct was used. The mutants -67OA, -176 and -117 showedsimilar degreesof increasein transactivation asdid the -670 construct, whereasthe -278 mutant exhibited a marked (6-fold) increasein transactivation. The -278 mutant lacked a portion of NRE- 1 but retained NRE-2 and NRF sequences.This would suggestthat the deleted region of NRE-1 contained a negative regulatory sequencewhich played a
Letters
94 (1995)
4148
4s
more important role than NRE-1 or NRF regions in exerting marked suppressive effects. The deletion mutant -103 showed lessincrease, i.e. only a 2-fold increase, of transactivation, while the -65 and -48 mutants showed no truns-activating activities regardlessof whether the HEP-G2 cells were treated or not with IL-6, IL-la, or IFN-y. The fact that the -103 mutant lost two basesfrom the 5’ proximal KB sequence may be the reason for its slight decline in transactivation efficiency. The trans-activating response of HEP-G2 cells after IFN-y treatment was enhanced3.4-fold with the wild-type construct, 1.7-fold with the -670A mutant, 1.2-fold with the -278 mutant, but up-regulated again to 2.4-fold with the -176 mutant. The fact that -176 mutant lacked the NRE-1 sequenceas well as most of the NRE-2 element would suggestthat these negative regulatory elementscould play an inhibitory role on the IFN-)/ responsive elements.Further deletion to -117 and -103 resulted in no enhancementof transactivation, despite the fact that both -117 and 103 mutants possessedcomplete or 2-bp deficient NF-lcB-binding sequences,respectively. 4. Discussion In the presentinvestigation, we demonstratedthat the transactivation-enhancing effects of cytokines, including IL-la, IL-6 and IFN-)I, as well as TPA were generally highest with well differentiated HEPG2 cells, intermediate with moderately differentiated J5 cells, and none, or rather reduced, with the poorly differentiated SK-HEP-1 cells. Since the statusof cellular differentiation of these HCC cell lines appears to be an important determinant for exhibition of the transactivation-enhancingeffects of cytokines as well as TPA, these effects may well serve as their functional markers. Further experiments with HEP-G2 cells transfected with nested series of 5’ deletion mutants of HIV-l-LTR delineated the possible regions of activation within the LTR, and, as observed in a previous report [7], the presence of negative regulatory sequence acting against the transactivation-enhancing effects of these cytokines. The nature of thesenegative elementsneedsto be further investigated. The presentinvestigation further indicated that the KB sequencewas a necessaryand important compo-
nets of the regions that were activated by these cyrokines. Numerous agents which can cause the release of NF-K-B from its inhibitory protein I& have been identified; they include inflammatory cytokines like TNF-rx and IL-i~r, TPA, bacterial LPS, DNAdamaging agents, double-stranded RNA, reactive e-1xyge.n intermediates, and infection by viruses in,:luding HIV- I [3]. IL- la is produced by multiple cell types. including cells of the monocytic lineage, T and ‘;r lymphocytes, fibroblasts. neutrophiis, and micro5<$a1 ceils [2,11]. IL-la is known to autoregulate its own synthesis by activating NF-KB which subseiluently binds to KB sequence presentin its own promoter. Since the promoters of IL-2 receptor a-chain tlL2Rcx) gene which contains I~B sequenceare also up-regulated [ 171,it is possiblethat these HCC cells after treatment with IL-In may produce more IL-in and IL-2Ru causing subsequentchain reactions of enhancementof transactivation. Our findings on the enhancementof transactivation by HEP-G2 and J5 ceils transfected with HIV- I-LTR which contains promoters for IL-2R and KB sequencesare in line wtth these possibilities. However, the SK-HEP- 1 c.tli%may iack receptors or sometransduction factors :rl [his pathway despite the presenceof KB and other promotel-sin the transfected HIV- I -IJT’R II.-6 1sinvolved in the differentiation of B and -1. celib, acts as a myeloma growth factor, and induces the synthesis of the acute-phaseplasma proteins in the liver [ 141. NF-IL6 protein, which is highly expressed in liver nuclei, is implicated as a master regulator of the acute-phaseresponse[1,2334], induced by IL-6 and other inflammatory mediators such as TNF~x [X,24]. Stimulation by TPA of the protein kinase C pathway increasesthe phosphorylalion of NF-11-6. and enhancesIts transactivation ac!Ivlty on several cytokine genes,including IL,-6 itself, IL-K. TNFcf and G-CSF. becausecritical c&acting elementsof these genesinclude IL-6RE. The NF-IL6 protein may be induced by IL-la since a sequence iposltions -72 to -62) on the human IL-6 geneshares 90% homology with the classicalKB sequence[27] which is up-regulated by IL-la. Thus exogenousILi
theseto specific receptors and activation of tyrosine kinaseswhich belong to the Januskinase(Jak) family 191.Latent cytoplastiic proteins termed ‘signal transducers and activators of transcription’ (STATS) also becomeactivated, presumably by the Jaks. The activated STATSare translocatedto the nucleuswhere by themselvesor in combination with otherwise weak DNA binding proteins, they bind to specific REs and stimulate transcription. IFN-), can cause immediate transactivation of several genes [4,10,16-l 8,221 as well as the initial RE in the IFN-y pathway [9]. The promoter for the gene encoding the transactivating human II%-response factor- 1 (IRF- 1) containstinreeputative NF-KB binding sites [26]. The KB-like sequencepresent in IRF-1 gene would also he up-regulated by IL-la. IL-6 or IFN-)/ itself. In studies using a Tat-expression vector, IFN-y was found to antagonize the trans-activating activities of Tat protein, mediated by inhibition by INF-), of the expression or the activity of cellular factors [ 121. Since a high level of II%-)/ is often associatedwith HIV-i infection, its suppressiveeffect on Tat would contribute to the establishmentof HIV-l latency in infected cells [12j. However, in our experiments where no Tat-expressjon vector was used, we found that IFN-y exhibited an enhancing effect on transactivation of the LTR in vitro. This would support the notion that there may be. a balancing effect between these two opposmg activities for regulation-of viral replication. Thus IFN-y could act as a double-edged sword for promotion or suppressionof viral replication through balancing these opposing effects of transactivation in in vivo situations. Acknawledgments We thank Dr. Stephen Josephs(Applied Sciences, Baxter Healthcare Corporation, Round Lake, IL 60073. USA) for providing us with the plasmidsfor the nested series of 5’ deletion mutants of HIV-ILTR. The present investigation was supported partly by the National Science Council (NSC-82-Q412B182-091) and partly by the Department of Health ;DOH83-HR-209). Taiwan, Republic of China. References 1I 1 Akira.
S.. Isshiki,
H.. Sugita.
T., Tanabe.
0..
Kinoshita
S..
M.-L.
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[lo]
[II] [12]
[13]
[14]
[15]
Hsu et al. I Cancer
Nishio, Y., Nakajima, T., Hirano, T. and Kishimoto, T. (1990) A nuclear factor for IL-6 expression (NF-II.@ is a member of a ClEBP family. EMBO J., 9, 1897-1906. Arai, K.I.. Lee, F., Miyajima, A., Miyatalce, S., Arai, N. and Yokota, T. (1990) Cytokines: coordinators of immune and inflammatory responses, Annu. Rev. Biochem., 59, 783839. Beg, A.A., Finco, T.S., Nantermet, P.V. and Baldwin, Jr., AS. (1993) Tumor necrosis factor and interleukin-I lead to phosphorylation and loss of bcBa: a mechanism for NF-KB activation. Mol. Cell. Biol., 13, 3301-3310. Briskin, M., Kuwabara, M.D., Sigman, D.S. and Wall, R. (1988) Induction of IC transcription by interferon-y without activation of NF-KB. Science, 242, 10361037. Chang, C., Lin, Y., O-Lee, T.-W., Chou, C-K., Lee, T.-S., Liu, T.-J., P’eng, F-K., Chen, T.-Y. and Hu, C.-P. (1983) Induction of plasma protein secretion in a newly established human hepatoma cell line. Mol. Cell. Biol., 3, 11331137. Chang, K.S.S., Liu, W.T. and Josephs, S.F. (1991) Regulation of cellular trclns-activating activities in two different promonocytic leukemia cell lines, Cancer Lett., 60,75-83. Chang, KS..?.., Hsu, M.-L. and Josephs, SF. (1993) Regulation of HIV-l LTR frans-activating activities in two different human hepatocellular carcinoma cell lines. Cancer Len., 74, 75-83. Darlington, G.J., Wilson, D.R. and Lachman, L.B. (1986) Monocyte-conditioned medium, interleukin-1, and tumor necrosis factor stimulate the acute phase response in human hepatoma cells in vitro. J. Cell Biol., 103, 787-793. Darnell, Jr., J.E., Kerr, I.M. and Stark, G.R. (1994) Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science, 264, 1415-1421. Decker, T., Lew, D.J., Mirkovitch, J. and Darnell, Jr., J.E. (1991) Cytoplasmic activation of GAP, an IFN-y-regulated DNA-binding factor, EMBO J., 10, 927-932. Dinarello, CA. (1991) Interleukin 1 and interleukin 1 antagonism. Blood, 77, 1627-1652. Emilie, D., Maillot, M-C., Nicolas, J.-E, Fior, R. and Galanaud, P. (1992) Antagonistic effect of interferon-y on tatinduced transactivation of HIV long terminal repeat. J. Biol. Chem., 267,20565-20570. Garcia, J.A., Wu, F.K., Mitsuyasu, R. and Gaynor, R.B. (1987) Interactions of cellular proteins involved in the tmnscriptional regulation of the human immunodeficiency virus. EMBO J., 6.3761-3770. Heinrich, P.C., Duthues, G., Flohe, S., Horn, F., Krause, E., Kriittgen, A., Legres, L., Lenz, D., Liitticken, C., Schooltink, H., Stoyan, T., Conradt, H.S. and Rose-John, S. (1991) Interleukin-6, its hepatic receptor and the acute phase response in liver. In: Molecular Aspects of Inflammation, pp. 129-145. Editors: H. Sies, L. Flohe and G. Zimmer. Springer, Berlin. Hiscott, J., Marois, J., Garoufalis, J., D’Addario, M., Roulston, A., Kwan, I., Pepin, N., Lacoste, J., Nguyen, H., Bensi, G. and Fenton, M. (1993) Characterization of a functional NF-KB site in the human interleukin 18 promoter: evidence
Letters
94 (1995)
4148
47
for a positive autoregulatory loop. Mol. Cell. Biol., 13, 6231-6240. [16] Kanno, Y., Kozak, CA., Schindler, C., Driggers, P.H., Ennist, D.L., Gleason, S.L., Damell, Jr., J.E. and Ozato, K. (1993) The genomic structure of the murine ICSBP gene reveals the presence of the gamma interferon-responsive element, to which an ISGF3a subunit [or similar] molecule binds. Mol. Cell. Biol., 13, 3951-3963. [17] Lew, D.J., Decker, T. and Damell, Jr., J.E. 11989) Alpha interferon and gamma interferon stimulate transcription of a single gene through different signal transduction pathways. Mol. Cell. Biol., 9, 5404-5411, [18] Lew, D., Decker, T., Strehlow, I. and Darnell, Jr., J.E. (1991) Overlapping elements in the guanylate-bindin protein gene promoter mediate transcriptional induction by alpha and gamma interferons. Mol. Cell. Biol., 11, 182. [19] Lu, Y., Touzjian, N., Stenzel, M., Dorfman, T., Sodroski, J.G. and Haseltine, W.A. (1990) Identification of &-acting repressive sequences within the negative regulatory element of human immunodeticiency virus type 1. .I. Viral., 64, 5226-5229. [20] Ltltticken, C., Wegenka, U.M., Yuan, J., Buschmann, J., Schindler, C., Ziemicki, A., Harpur, A.G., Wilks, A.F., Yasukawa, K., Taga, T., Kishimoto, T., Barbieri, G., Pellegrini, S., Sendtner, M., Heimich, P.C. and Horn, E (1994) Association of the transcription factor APRF and protein kinase Jakl with the IL-6 signal transducer gp130. Science, 263,89-92. [21] Neumann, J.R., Motency, CA. and Russian, K.O. (1987) A novel rapid assay for chloramphenicol acetyltransferase gene expression. Biotechniques, 5,444-447. [22] Pearse, R.N., Feinman, R., Shuai, K., Darnell. Jr., J.E. and Ravetch, J.V. (1993) Interferon y-induced transcription of the high-affinity Fc receptor for IgG requires assembly of a complex that includes the 91-kDa subunit of transcription factor ISGF3. Proc. Natl. Acad. Sci. USA, 90,4314-4318. [23] Poli, V and Cortese, R. (1989) Interleukin 6 induces a liverspecific nuclear protein that binds to the promoter of acutephase genes. Proc. Natl. Acad. Sci. USA, 86,8202-X06. [24] Poli, V, Mancini, F.P. and Cortese, R. (1990) ILdDBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to CiEBP. Cell, 63,643-653. [25] Rosen, C.A., Sodroski, J.G. and Haseltine, WA. (1985) The location of &s-acting regulatory sequences in the human T cell lymphotropic virus type III (HTLV-IIYLAV) long terminal repeat. Cell, 41, 813-823. [26] Ruff-Jamison, S., Chen, K. and Cohen, S. (1993) Induction by EGF and interferon-y of tyrosine phosphorylated DNA binding proteins in mouse liver nuclei. Science, 261, 17331736. [27] Sen, R. and Baltimore, D. (1986) Inducibility of K immunoglobulin enhancer-binding protein NF-KB by a posttranslational mechanism. Cell, 47, 921-928. 1281 Trautwein, C., Caelles, C., van der Geer, P., Hunter, T., Karin, M. and Chojkier, M. (1993) Transactivation by NFIL6/LAP is enhanced by phosphorylation of its activation domain. Nature, 364, 544-547.
!ZGl
Wegrnka. U.M., Buschmann. J., Liitticken, C.. Heimich. P.C and Horn. E ( 1991) Acute-phase response factor, a nu clear factor binding to acute-phase response elements. is rnpidly activated by interleukin-6 at the posttranslational level. Mol. Cell. Biol., 13. 276288.
Ii01
Yuan,
J
Wegenkn.
U.M..
Liitticken.
C
Ruschmnnn.
I..
Decker. T., Schindler, C.. Heinrich, P.C. and Horn, F. I 1994) The signaling pathways of interleukin-6 and gamma interferon converge by the activation of different transcription factors which bind to common responsive DNA elements. Mol. Cell. Biol . 14. 1657-1668