- Email: [email protected]
Decolorization of the metal textile dye Lanaset Grey G by immobilized white-rot fungi
Journal of Environmental Management 129 (2013) 324e332
Contents lists available at ScienceDirect
Journal of Environmental Management journal homepage: www.elsevier.com/locate/jenvman
Decolorization of the metal textile dye Lanaset Grey G by immobilized white-rot fungi Dalel Daâssi a, Tahar Mechichi a, Moncef Nasri a, Susana Rodriguez-Couto b, c, * a Université de Sfax, Ecole Nationale d’Ingénieurs de Sfax, Laboratoire de Génie Enzymatique et de Microbiologie, Route de Soukra Km 4.5, BP «1173», 3038 Sfax, Tunisia b CEIT, Unit of Environmental Engineering, Paseo Manuel de Lardizábal 15, 20018 San Sebastian, Spain c IKERBASQUE, Basque Foundation for Science, Alameda de Urquijo 36, 48011 Bilbao, Spain
a r t i c l e i n f o
a b s t r a c t
Article history: Received 9 May 2013 Received in revised form 24 July 2013 Accepted 27 July 2013 Available online 26 August 2013
In this paper we studied the ability of four Tunisian-isolated fungi (i.e. Coriolopsis gallica, Bjerkandera adusta, Trametes versicolor and Trametes trogii) immobilized into Ca-alginate beads to decolorize the metal textile dye Lanaset Grey G (LG). The effect of different operational conditions, such as initial dye concentration, temperature, pH, beads/medium ratio and agitation, on dye decolorization by the immobilized fungi was investigated. Maximal decolorization percentages of 88.7%, 89.3%, 82.1% and 81.3% for C. gallica, B. adusta, T. versicolor and T. trogii were attained, respectively, when operating at an initial LG concentration of 150 mg/L, pH values of 5.0e6.0, temperatures of 40e45 C and a beads/medium ratio of 20% (w/v) in static conditions after 72 h of incubation. Subsequently, the re-usability of the immobilized fungi was evaluated. After three decolorization cycles, the decolorization percentage of free cell cultures dropped to values below 36%, while decolorization percentages of about 75%, 70%, 60% and 68% were obtained by the immobilized cultures of C. gallica, B. adusta, T. versicolor and T. trogii, respectively. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: White-rot fungi Immobilization Metal textile dye Biodegradation Alginate
1. Introduction Wastewater from the textile industry is one of the most problematic to treat due to its color, high chemical oxygen demand (COD), biochemical oxygen demand (BOD), suspended solids, turbidity and toxic compounds (Kanu et al., 2011). Dye color interferes with penetration of sunlight into waters, retards photosynthesis, inhibits the growth of aquatic biota and affects gas solubility in water bodies (Banat et al., 1996). Furthermore, many dyes are believed to be carcinogenic or are synthesized from known carcinogens such as benzidine (Clarke and Anliker, 1980). In addition, effluents from the textile industry contain many toxic compounds such as heavy metals (Szalinska et al., 2010). Unlike other pollutants, heavy metals are difficult to remove from wastewater and may escape the capacities of the conventional systems for effluent treatment. Moreover, these metals can accumulate in the
* Corresponding author. CEIT, Unit of Environmental Engineering, Paseo Manuel de Lardizábal 15, 20018 San Sebastian, Spain. Tel.: þ34 943212800x2239; fax: þ34 943 213076. E-mail address: [email protected] (S. Rodriguez-Couto). 0301-4797/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.jenvman.2013.07.026
environment and organisms through the food chain, posing a threat to public health (Wang et al., 2005). Due to stricter government legislation concerning the release of contaminated effluents into the environment, the treatment of industrial textile wastewater is a field of increasing research. The existing physical and/or chemical techniques to treat textile industrial effluents present the following drawbacks: high cost, low efficiency, potential production of highly toxic by-products and inapplicability to a wide variety of dyes (Novotny et al., 2004). Also, textile effluents are usually recalcitrant to standard biological treatments. This has impelled the search for new approaches. By far white-rot fungi are the most efficient micro-organisms in breaking down synthetic dyes due to their ability to produce nonspecific extracellular lignin-degrading enzymes (Wesenberg et al., 2003). These enzymes are mainly lignin peroxidase (LiP, EC 1.11.1.14), manganese-dependent peroxidase (MnP, EC 1.11.1.13) and laccase (benzenediol/oxygen oxidoreductase, EC 1.10.3.2). Several studies have shown that immobilized fungi offer several advantages over free fungal cells (Rodríguez-Couto, 2009). Thus, immobilized cultures are more resilient to environmental perturbations, such as pH or exposure to toxic chemical concentrations, than free cultures (Shin et al., 2002). In addition, in industrial
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
operations, immobilized fungi could provide additional advantages over freely suspended ones such as easy separation of cells from liquid medium, protection from shear damage and reduction in protease activity. Furthermore, cell immobilization lowers the apparent broth viscosity and makes the rheological features more favorable for oxygen and mass transfer (Thongchul and Yang, 2003). Basically, there are two types of cell immobilization: entrapment and attachment (Rodríguez-Couto, 2009). A variety of matrices have been used for cell immobilization via the entrapment technique such as natural polymeric gels (agar, carrageenan, alginate, chitosan and cellulose derivatives) and synthetic polymers (polyacrylamide, polyurethane, polyvinyl) (Katzbauer et al., 1995). Among them, alginate is the most commonly used polymer for cell entrapment (Gerbsch and Buchholz, 1995) because it is not toxic and the immobilization is performed under mild conditions (Kourkoutas et al., 2004). Accordingly, immobilization into alginate beads was selected to perform the present study. This study uses a commercial mixture of metal-complex dyes such as Lanaset Grey G (LG) that contains chromium III (Cr III) and cobalt (Co) as organo-metal complexes (Gabarrell et al., 2012). Previous research has elucidated the biodegradation process of this dye by the fungus Trametes versicolor (Blánquez et al., 2004) but there are no studies with alginate-immobilized fungi. In the present work, the decolorization of this metal textile dye by different newly-isolated white-rot fungi immobilized into alginate beads was investigated. The reusability of the alginate-immobilized fungi was also assessed. 2. Materials and methods 2.1. Dye The dye Lanaset Grey G (LG), a commercial mixture of several metal complex dyes, was supplied by DyeStar (Portugal). Its chemical formula is not disclosed because it is a patented dye. This dye is known to contain chromium III (2.5%) and cobalt (0.79%) (Blánquez et al., 2004; Gabarrell et al., 2012). Stock solutions (0.1% w/v in distilled water) were stored in the dark at room temperature. 2.2. Fungal strains The fungal strains used in this study were isolated from decaying acacia wood in the Northwest of Tunisia. They were identified by the Spanish Type Culture Collection (CECT) as Coriolopsis gallica (BS54), Bjerkandera adusta (11B), T. versicolor (A3) and Trametes trogii (AD40) (Table 1). The strains were maintained on Petri plates containing 2% malt extract agar (MEA) at 4 C and subcultured every 2 months. 2.3. Medium and culture conditions Mycelial suspensions of the fungal strains were obtained by inoculating four plugs (1 cm2) excised from the growing zone of 4-day-old fungi on Petri plates to 1000-mL cotton-plugged Erlenmeyer flasks containing 100 mL of culture medium (M7) as described in Zouari-Mechichi et al. (2006). This basal medium contained (per liter): glucose, 10 g; peptone, 5 g; yeast extract, 1 g; ammonium tartrate, 2 g; KH2PO4, 1 g; MgSO4$7H2O, 0.5 g; KCl, 0.5 g; trace element solution, 1 ml. The composition of the trace element solution per liter was as follows: B4O7Na2$10H2O, 0.1 g; CuSO4$5H2O, 0.01 g; FeSO4$7H2O, 0.05 g; MnSO4$7H2O, 0.01 g; ZnSO4$7H2O, 0.07 g; (NH4)6Mo7O24 4H2O, 0.01 g. The pH of the culture medium was adjusted to 5.5. The flasks were incubated in static conditions at 30 C. After 4e5 days of cultivation, these fungal
325
pre-cultures were homogenized using an Ultra Turrax (IKA T18, Staufen, Germany) for 2 min at 20,000 rpm. The resulting mycelia suspensions were stored at 4 C until used. 2.4. Immobilization of fungi into alginate beads The fungal strains used in this work were entrapped into Caalginate beads using a method based on that described by Laca et al. (2000). 3 mL of each mycelium suspension was mixed with 100 mL of alginate solution (2.1% w/v) under shaking. The final concentration of alginate in the beads (apron. 4 mm in diameter) was 2% (w/v). The mixture was dropped by means of a syringe into a CaCl2 solution (3% w/v) under shaking. To minimize cellular leaking a method of gel re-coating was used for C. gallica and T. trogii, since in preliminary experiments cell leakage from the beads was found with these strains. Thus, after 30 min the beads were collected from the solution, washed with distilled water and placed into a solution of sodium alginate (0.5% w/v) for 5e10 min. This makes that the diffusion of the Caþ2 from the beads produces the gelification of a second alginate layer on the bead surface. After that, the beads were washed with distilled water and left to harden for 30 min into a solution of CaCl2 (3% w/v). Finally, the beads were washed with a solution of NaCl (0.7%. w/v) (Enayatzamir et al., 2010). Alginate beads were produced under sterile conditions and hence, all the solutions involved were autoclaved until used. 2.5. Decolorization studies The immobilized fungi were cultured in 250-mL cotton-plugged Erlenmeyer flasks containing 50 mL of culture medium. The beads/ medium ratio used was 10% (w/v) and the pH of the medium was adjusted to 5.5. The flasks were incubated at 30 C in static conditions for seven days. In order to boost laccase production, the cultures were supplemented with 300 mM of CuSO4 on the third cultivation day (Zouari-Mechichi et al., 2006). The dye solution was added by filtration (0.22 mm) into the culture flasks when laccase production started (500 U/L), which corresponded to the fourth cultivation day. Free-cell alginate beads and inactivated fungi were used as controls for immobilized and free cultivations, respectively. The inactivation of the fungi was performed by autoclaving them at 121 C for 20 min. The effect of the initial dye concentration (ranging from 20 to 300 mg/L), agitation (150 rpm) and static conditions, pH (ranging from 3 to 8), temperature (from 40 to 55 C) and beads/medium ratio (from 5 to 40% w/v) on LG removal by immobilized and free fungi in batch systems was assessed. Samples were withdrawn aseptically from the experimental flasks periodically, centrifuged at 8000 rpm for 10 min and analyzed for enzyme activity and decolorization percentage. The residual dye concentrations were spectrophotometrically measured from 450 to 700 nm and calculated measuring the area under the plot. Dye decolorization was expressed in terms of percentage. 2.5.1. Decolorization in successive batches In order to investigate the re-usability of the immobilized cultures, the decolorization experiments in optimal conditions were performed in three successive batches, each batch lasting 24 h. It is useful to determine the minimum medium components required for decolorization in order to minimize the cost of the treatment process. For this reason, the decolorizing ability of the immobilized and free fungi was also evaluated in a minimal medium consisting of buffer (25 mM succinic acid, pH 5.5) and glucose (2 g/L). The whole medium was used in the two first batches, whereas the minimal medium was used in the third batch.
326
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
Table 1 Molecular identification of fungal strains. Nucleotide sequence
Similarity (%)
Identification
>BS54 TGTAGCTGGCCTCTCCGGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGG GTATCGGAAGGCGTCGCGTCGTTNNNNGCGAGGCGTTAACCGTGCCTACGTCTTACTACAAACGCTTC AGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCG CATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCT TTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAAAC CCATAAGTCTTTGCGGGCTTACGGGCTTTGGACTTGGAGGCTTTGTCGGCGACCGCGAGGTCTGTCGA CTCCTCTCAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGTCTACGCCGTGA CCGTGAAGCGTTTTGGCGAGCTTCTAATCGTCTCTTACGAGACAGCTTACATTGACCTCTGACCTCAAAT CAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAG >11B CCTGNTTTGAGCTCNGAGTTCAGAAATTTGTCCGAAGACGGTTAGAAGCGNGAACACTAGAATACCCT CCACAGCAACGCAGATAATTATCACGCTGAAGCGGCTGGTAACGTTCGCACTAATGCATTTCAGAGGA GCCGACTACGAGAGCCGGCACGACCTCCAAGTCCAAGCCTTCATCAATAAAGCCNAAGGTTGAGAATT CCATGAGACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATG ATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAA GAGATCCGTTGCTGAAAGTTGTATATAAATTGCGTTATAGCAAAGTATGACATTCTAAAACTGAATCGTT TGTAATAAAGCATAAGCCCGACACCTACAAGTGCGCGAACGCACCCACAAGCCGGCCTATGAAAAGTG CACAGAAGTTGAGAGTGGATGAGACAGGCGTGCACATGCCCTTGCGAGCCAGCAGACAACCCGTTCAA AACTCGATAATGATCCTTCCGCAGG >AD40 GGGTTGTAGCTGGCCTCTCCGGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGNGCNCTTACT GTGGGTATCGGAAGGCGTCGCGTCGTTTGCGGCGAGGCGTTAACCGTGCCTACGTCTTACTACAAACG CTTCAGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCT CTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCG AATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCT CAAACCCATAAGTCTTTGCGGGCTTACGGGCTTTGGACTTGGAGGCTTTGTCGGCGACCGCGAGGCTG TCGACTCCTCTCAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGTCTACGCC GTGACCGTGAAGCGTTTTGGCGAGCTTCTAATCGTCTCTTACGAGACAGTTACATTGACCTCTGACCTC AAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAG
99
Coriolopsis gallica Sequence ID:gbjAY684172.1
99
Bjerkandera adusta Sequence ID: gbjJF439464.1j
98
Trametes trogii Sequence ID: gbjJN164998.1j
At the end of each batch, the beads were rinsed twice with sterile distilled water and transferred into fresh decolorization medium for the next decolorization batch. Ca-alginate beads with immobilized fungus from 4-day-old cultures were inactivated by autoclaving (121 C, 20 min) and used as control cultures to determine the amount of dye bound to the alginate beads. At the end of the third batch, the beads of each flask were pooled, washed with sterile distilled water and stored in sterile calcium chloride (2 g/L) at 4 C. After 3 storage weeks at 4 C, the beads were recovered by filtration and washed again with sterile distilled water and added to a fresh minimal medium containing 100 mg/L of LG to start the 3rd decolorization batch. 2.6. Analytical assays Laccase activity was determined by using 10 mM 2,6dimethoxyphenol (DMP) in 100 mM sodium tartrate buffer, pH 5.0 (molar extinction coefficient ¼ 27,500 M1 cm1, based on DMP concentration) (Yaropolov et al., 1994). Manganese-dependent peroxidase (MnP) activity was measured by monitoring the oxidation of guaiacol (molar extinction coefficient ¼ 12,000 M1 cm1) spectrophotometrically at 465 nm at ski et al., 1988). The reaction mixtures room temperature (Paszczyn (1 mL) contained 500 mL of culture broth, 200 mL of 0.5 M sodium tartrate buffer (pH 5.0), 100 mL of 1 mM MnSO4, 100 mL of 1 mM H2O2 and 100 mL of 1 mM guaiacol. The reaction was initiated by the addition of H2O2. Lignin peroxidase (LiP) activity was determined by the oxidation of veratryl alcohol at 310 nm (molar extinction coefficient ¼ 93,000 M1 cm1) to veratryl aldehyde (Tien and Kirk, 1984). The reaction was initiated by the addition of 0.15 mM H2O2. The enzymatic reactions were carried out at room temperature (22e25 C) and one unit of enzyme activity (U) was defined as the
amount of enzyme oxidizing 1 mmol of substrate per minute. The activities were expressed as U/L. The protein concentration was measured by the Bradford method (Bradford, 1976), using bovine serum albumin (BSA) (Sigma Chemical, St. Louis, USA) as a standard. 2.7. Kinetics study Substrate specificity towards the metal dye (LG) was analyzed kinetically at room temperature (22e25 C). The reaction mixtures consisted of dye solution (at varying concentrations ranging from 20 to 300 mg/L) and immobilized cells (from C. gallica; B. adusta; T. trogii and T. versicolor) in culture medium (pH 5.5). All the cultures were incubated at room temperature (22e25 C), without shaking. 2.8. Statistical analysis Duplicate experiments were performed to test the reproducibility of the data. All the analyses were performed in triplicate. Statistical analysis was carried out using Microsoft ExcelÒ software (Microsoft), standard deviation being 10%. Data among treatments were analyzed by one-way analysis of variance (ANOVA) using Microsoft ExcelÒ software (Microsoft). Readings were considered significant when p was 0.05. 3. Results and discussion The research for new strains able to degrade metal-containing dyes is still of great scientific and industrial interest. In the present study, four newly-isolated strains were immobilized into Ca-alginate beads in order to assess their suitability for the decolorization of the metal complex dye LG.
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
100
Decolorization (%)
80
heat-inactivated cells can be different to that of living cells (Arica et al., 2004). Also, adsorption and xenobiotic transformation in living fungal cultures cannot be clearly distinguished since they can degrade the adsorbed pollutants by intracellular mechanisms (Blánquez et al., 2004). On the other hand, Table 2 illustrated the production of ligninolytic enzymes (LiP, MnP and laccase) by the immobilized and free cultures. The results proved that different fungal strains influenced LG biodegradation efficiency due to their differences in enzymatic activities. For all the tested strains dye decolorization was correlated with ligninolytic enzyme production. Thus, the data represented in Table 2 show that laccase production was improved by fungal immobilization compared to MnP and LiP. High laccase activities of 6544 U/L on the 8th culture day, 13,552 U/L on the 12th culture day and 5147 U/L on the 9th culture day were detected in immobilized cultures of T. trogii, B. adusta and C. gallica, respectively. However, laccase activities were rather low in free cultures. In addition, LG decolorization was correlated with ligninolytic enzyme production. Thus, higher decolorization percentages were obtained by the cultures with higher laccase activities, save for T. versicolor cultures. In immobilized cultures of C. gallica, a maximum LG decolorization percentage of 95.2% was observed at the maximum laccase activity (5147 U/L) on the 9th culture day, while for a laccase activity of 1087 U/L, LG decolorization was about 70% on the 5th culture day. Baldrian and Snajdr (2006) reported that dye decolorization by white-rot and litter-decomposing fungi was mainly due to the extracellular ligninolytic enzymes secreted by such fungi and to a less extent to the biosorption of the dye onto fungal mycelium. Also Park et al. (2007) found that dye decolorization by Funalia trogii was due to biodegradation by extracellular enzymes and biosorption onto fungal mycelium, the former being more important. On the contrary, Baccar et al. (2011) showed that the dead cells of the white-rot fungus T. versicolor considerably removed a tannery dye, suggesting their use as an effective biosorbent. In addition, other mechanisms may be involved in dye decolorization by white-rot fungi such as cytochrome P450 (Cha et al., 2001) and reactive oxygen species (Hammel et al., 2002; Goodell et al., 2004). In the case of the immobilized cultures of T. versicolor, although LG was considerably decolorized (75%), no direct relationship between decolorization and laccase activity was found. In fact close decolorization rates of 70.8% and 75% were detected for 1975 U/L and 6645 U/L. So, high enzyme activities were not necessary to obtain high decolorization percentages. Similar
Immobilized fungus Ca-alginate free fungus inactivated fungus
60
40
20
0 B. adusta
T. versicolor
T. trogii
327
C. gallica
White-rot fungi Fig. 1. Ability of several free and immobilized white-rot fungi into Ca-alginate beads to decolorize 50 mg/L of the metal dye Lanaset Grey G in 24 h. The controls for free fungi were heat-inactivated fungi whereas the controls for immobilized fungi were Caalginate beads without fungi.
3.1. LG decolorization by free and immobilized fungi Ca-alginate immobilized and free fungi were tested to decolorize 50 mg/L of the metal complex dye LG. The results presented in Fig. 1 proved that fungal immobilization had a positive effect on LG decolorization by all the tested fungi. Although the free fungal cultures were able to decolorize the dye LG, removal yields were lower than those obtained by the immobilized cultures (Fig. 1). Indeed, the decolorization percentages obtained by the immobilized cultures were 2-fold higher than those attained by the free fungal cultures except for T. versicolor cultures, which resulted in similar decolorization percentages (about 72% in 24 h). In addition, among the immobilized cultures, C. gallica led to the highest decolorization percentage (about 85% within 24 h). The decolorization percentages achieved by the immobilized cultures of B. adusta, T. trogii and T. versicolor were 70.9%, 72.2% and 75.3%, respectively. The inactivated fungi removed 21e41% of the dye after 24 h of exposure, whereas the free-cells Ca-alginate beads removed 10e14% of LG in the same period. So, dye decolorization was due to two mechanisms: enzymatic action (biodegradation) and adsorption onto Ca-alginate beads and fungal biomass (biosorption). However, it is known that adsorption capacities of
Table 2 Ligninolytic enzymes detected in cultures of free and immobilized fungi: M7 medium (with their 95% confidence limits; Mean SD (n ¼ 3), 10% w/v (beads/M7); 50 mg/L; 30 C; 150 rpm, in the presence of 150 mM CuSO4). Strains
Culture time (days)
Enzymes produced (U/L)
Free T. trogii B. adusta T. versicolor C. gallica a b
6 8 4 12 4 8 5 9
Decolorization (%) MnPa
Laccase
938 3276 746 8358 1310 5133 830 3880
Immob.
MnP: manganese-dependent peroxidase. LiP: lignin peroxidase.
9.8 11.4 6.4 14.7 11.3 6.5 8.5 12.2
1432 6544 1871 13552 1975 6645 1087 5147
LiPb
Free 11.2 8.2 6.5 5.8 5.5 12.4 5.6 8.4
67.5 114 898 521 e e 80.5 214
10 9.3 8.4 12
11. 7.3
Immob.
Free
Immob.
85 5.7 182 8 e e e e e e
0.44 1.1 13.0.8 30.2 8 0.7 88 14.2 65 2.2 8.80.2 2.50.4
2.3 18 e e 101 55 5 e
8.1 1.2
0.5 0.2 0.4
Free 32 51.8 28.2 44.1 66.2 70.2 30.1 60.2
Immob.
1.09 2.0 1.2 0.4 0.4 0.3 0.8 1.0
63.8 70.2 67.5 87.2 70.8 75.2 70.3 95.2
0.9 0.7 1.8 0.5 1.4 1.4 0.8 0.9
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
results were reported by Blánquez et al. (2007) in the decolorization of the dye LG (150 mg/L) by T. versicolor and by Baccar et al. (2011) in the decolorization of a tannery dye (150 mg/L) by T. versicolor. 3.2. Effect of different operational conditions on LG decolorization by immobilized fungi The fungal growth and enzyme production, and consequently, decolorization and degradation are influenced by numerous factors, e.g. medium composition, pH, agitation, aeration, temperature and initial dye concentration. Their effects are briefly presented and discussed below.
A
20 mg/L 60 mg/L 100 mg/L 150 mg/L 200 mg/L 300 mg/L
100 Decolorization (%)
328
80 60 40 20 0 0
3.2.2. Kinetic study The kinetic parameters of LG decolorization using fungal cultures immobilized into Ca-alginate beads were estimated by the HanneseWoolf plot. The theoretical maximum decolorization rate (Vmax) and the MichaeliseMenten constant (Km) were presented in Table 3. The HanneseWoolf gave a Km of 113.37, 57.75, 126.63 and 159.27 mg/L and Vmax of 12.98, 12.04, 8.19 and 10.39 mg/L/h for LG decolorization by C. gallica, B. adusta, T. versicolor and T. trogii, respectively (Table 3). Therefore, the enzymatic complex produced by B. adusta has more affinity for the dye LG than the ones produced by the other fungi. Hence, higher LG decolorization percentages were found by B. adusta. 3.2.3. Effect of agitation The decolorization yields of LG using free fungal cells were compared with those carried out by fungi immobilized into Ca-alginate beads in both agitated and static conditions (Fig. 3AeD). Fig. 3A shows that in static conditions, LG removal by free cells of C. gallica was 51% at the beginning of the cultivation (12 h), which
B Decolorization (%)
20
40
60 80 Culture time (h)
100
120
40
60 80 Culture time (h)
100
120
40
60 80 Culture time (h)
100
120
40
60 80 Culture time (h)
100
120
20 mg/L 60 mg/L 100 mg/L 150 mg/L 200 mg/L 300 mg/L
100 80 60 40 20 0 0
C Decolorization (%)
20
20 mg/L 60 mg/L 100 mg/L 150 mg/L 200 mg/L 300 mg/L
100 80 60 40 20 0 0
D
20
20 mg/L 60 mg/L 100 mg/L 150 mg/L 200 mg/L 300 mg/L
100 Decolorization (%)
3.2.1. Effect of initial dye concentration The decolorization percentage of LG by immobilized fungi was studied at different initial dye concentrations ranging from 20 to 300 mg/L. Decolorization rate decreased with increasing initial dye concentrations, this effect being more acute for dye concentrations higher than 100 mg/L (Fig. 2AeD). Similar results were found by Balu and Radha (2009), who reported that the concentration of the dye Acid Orange had to be kept below 100 mg/L in batch experiments using Phanerochaete chrysosporium immobilized into alginate beads to avoid substrate inhibition possibly due to high osmotic pressure. At higher concentrations (up to 200 mg/L) the decrease of LG decolorization can be explained by the inhibition of fungal growth and cellular metabolic activities resulting from the toxicity of dyes as well as blockage of active sites of enzymes by dye molecules (Jadhav et al., 2008). As can be seen in Fig. 2A color removal was higher than 80% at 24 h of incubation for an initial dye concentration of 20 mg/L. However, longer incubation time was required for higher initial dye concentrations. Thus, 96 h of incubation was necessary to achieve a color removal of 90%, 70% and 34% for initial dye concentrations of 100 mg/L, 150 mg/L and 200 mg/L, respectively. An increase in the incubation time enhances the contact time, favoring the diffusion of the dye inside the beads and, thus, increasing the degradation rate. The results obtained showed that the time required for complete decolorization for 60, 100, 200 and 300 mg/L of initial dye concentration was 24, 48, 96 and 120 h, respectively. Swamy and Ramsay (1999) reported that complete decolorization of 60 mg/L of Reactive Black by Bjerkandera sp. BOS55, P. chrysosporium and T. versicolor was obtained in 4, 2 and 3 days, respectively.
80 60 40 20 0 0
20
Fig. 2. Effect of initial dye concentration on the decolorization percentage (static conditions; initial pH: 4.5; T: 30 C; initial dye concentrations (mg/L): 20 mg/l (); 60 mg/L (); 100 mg/L (); 150 mg/L (6); 200 mg/L (); 300 mg/L (B)) using different Ca-alginate immobilized fungi (A) C. gallica; (B) B. adusta; (C) T. versicolor and (D) T. trogii.
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
113.37 57.75 126.63 159.27
4.3 2.6 3.5 1.2
12.98 12.04 8.19 10.39
2.7 0.8 2.4 0.9
was higher than that obtained by immobilized cells (21.6%). However, dye removal by immobilized cells increased gradually with incubation time. From 72 h onwards both free and immobilized fungi showed the same dye removal percentages (64%). Likewise, immobilized cells of C. gallica in agitated cultures resulted in high decolorization efficiency (up to 92%). In addition, an increase in the cultivation time led to a remarkable improvement in the removal of LG. Residual LG concentrations after 120 h in agitated cultures were of 8.3% and 25.8% for immobilized and free C. gallica cultures, respectively. Aeration and agitation are necessary to satisfy the microbial oxygen requirements during the cultivation and to enhance the oxygen gaseliquid mass transfer. This might affect the morphology of filamentous fungi and lead to the decreased rate of enzyme synthesis (Znidarsic and Pavko, 2001). Fig. 3B shows that immobilized cells of B. adusta exhibited higher dye removal under static conditions (87.5%) than under shaken conditions (65.8%). Similar results were observed in Fig. 3C and D with T. versicolor and T. trogii strains. In fact, the decolorization percentage of immobilized T. versicolor under agitated and static conditions was found to be 51.4% and 77.7% respectively, which were higher than those found with free cells. Fig. 3D shows that the dye removal percentage was found to be 88% using immobilized T. trogii which was more efficient under static than agitated conditions. However, dye decolorization by T. trogii free cells was ameliorated with agitation. Indeed, 60.6% of residual dye concentration was detected in the culture medium under static conditions which was reduced to 36.8% under agitated conditions. A similar trend toward decolorization efficiency of F. trogii under static conditions was reported by Mazmanci and Unyayar (2010) for Reactive Black 5 (RB5). Data presented in Fig. 3AeD show that the immobilization of fungi into Ca-alginate beads enhanced LG decolorization. A great number of authors have indicated that immobilization of fungi via entrapment in Ca-alginate beads could enhance dye biodecolorization (Chen et al., 2009; Rodríguez-Couto, 2009; Moutaouakkil and Blaghen, 2011). Additionally, immobilized cells need more contact time in the culture medium to remove color. Indeed, the dye in the medium need time to be adsorbed onto the alginate matrix, gradually accumulated and then degraded. Several researches reported the adsorption efficiency of Ca-alginate beads in pollutants removal such as dyes (Dominguez et al., 2005; Rocher et al., 2010), nonylphenol (NP) (Gao et al., 2011), olive oil waste water (Ahmadi et al., 2006) and heavy metal ions (Arica et al., 2004; AbdelRazek, 2011).
Decolorization (%)
C. gallica B. adusta T. versicolor T. trogii
Vmax (mg/L/h)
shaken immobilized static free shaken free
80 60 40 20 0 0
20
40
60
80
100
120
Culture time (h)
B
static immobilized shaken immobilized
100 Decolorization (%)
Km (mg/L)
static immobilized
100
static free shaken free
80 60 40 20 0 0
20
40
60
80
100
80
100
80
100
Culture time (h)
C
static immobilized shaken immobilized
100 Decolorization (%)
Immobilized fungi
A
static free shaken free
80 60 40 20 0 0
20
40
60
Culture time (h)
D
static immobilized shaken immobilized
100 Decolorization (%)
Table 3 The kinetic parameters of LG decolorization using fungal cultures immobilized into Ca-alginate beads estimated by HaneseWoolf plot.
329
static free shaken free
80 60 40 20
3.2.4. Effect of pH and temperature on LG decolorization Decolorization of the metal complex dye LG by immobilized fungi was studied at different pH values (3e8) of the culture medium, keeping constant the initial dye concentration (150 mg/L), inoculum size (10% w/v) and under agitation conditions (30 C, 150 rpm). Data presented in Fig. 4A show that decolorization yield was slightly affected by the medium pH. A maximum color removal of around 77.6% and 72.5% was observed for immobilized cells of T. versicolor and T. trogii, respectively, at pH 5.0 after 48 h of
0 0
20
40
60
Culture time (h) Fig. 3. Comparison of shaken (150 rpm) and static conditions on Lanaset Grey G (150 mg/L) removal by Ca-alginate immobilized fungi and free fungi of different strains (d) shaken culture; (.) static culture; () Ca-alginate immobilized fungi; (6) free fungi.
330
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
A 100 Decolorization (%)
researchers suggest that the optimum pH values for dye decolorization by white-rot fungi are likely in the range 4e6 (Knapp et al., 2001). The effect of temperature on LG decolorization by different immobilized fungi was studied in the range of 40 Ce55 C at 150 mg/L initial dye concentration. Data presented in Fig. 4B show that increases in temperature lead to further increases in decolorization rates during the first 48 h of incubation. Maximum decolorization percentages depended on the immobilized fungi used. As seen in Fig. 4B, 45 C was found to be the maximum temperature for dye removal by the majority of the immobilized fungi. Decolorization percentages were 82.3%, 78.6% and 80.4% for C. gallica, T. versicolor and T. trogii, respectively. However, B. adusta achieved a maximum color removal of around 87% at 40 C. Then, decolorization rates increased as the temperature rose up to 50 C. At higher temperatures decolorization efficiency remarkably decreased, which normally is attributed to loss in cell viability (Dos Santos et al., 2004).
pH 3 pH 4 pH 5 pH 6 pH 7 pH 8
80 60 40 20 0 C. gallica
B. adusta
T. versicolor
T. trogii
White-rot fungi
B
Decolorization
100
3.2.5. Effect of the beads/medium ratio The relationship between inoculum size and dye biodegradation was also investigated. Dye decolorization percentages changed significantly among the four tested fungi for the different beads/ medium ratios investigated as well as with incubation time (Table 4). At 24 h, no apparent dye decolorization was detected in the cultures with the lowest beads/medium ratio (5% w/v), whereas the highest decolorization percentage was achieved with the beads/medium ratio of 20% (w/v) by all the tested fungi. An increase in the beads/medium ratio led to a remarkable improvement in the removal of LG over a short period of time, but no further changes in dye removal were observed after 72 h Vaithanomsat et al. (2010) reported the effect of fungal inoculum size on ligninolytic enzymes levels and on decolorization rates. Thus, they found that laccase activity was partially affected and dye decolorization slightly affected by the fungal inoculum size.
80 60 40 20 0 C. gallica
B. adusta
T. versicolor
T. trogii
White-rot fungi Fig. 4. Effect of temperature (A) and pH (B) on decolorization of Lanaset Grey G after 48 h of incubation (initial concentration of Lanaset Grey G: 150 mg/L; beads/medium ratio: 10% (w/v); temperature: 30 C; agitation: 150 rpm; pH: 5.5) by different Caalginate immobilized fungi.
3.2.6. Successive batch decolorization cycles Unlike free cells, immobilized biomass can be easily separated from the reaction solution and reused which greatly decreases the cost of the treatment. The re-usability of the fungi immobilized into alginate beads and free cells was evaluated by successive cycles of LG decolorization. After three cycles, the decolorization percentage of the free cells dropped below 36%, while the decolorization percentage remained about 75, 70, 60 and 68% for immobilized cells of C. gallica, B. adusta, T. versicolor and T. trogii, respectively (Fig. 5AeC). Thus, the immobilized fungi exhibited good re-usability. These results are in agreement with those reported in the study of Enayatzamir et al. (2010). They reported that P. chrysosporium immobilized into alginate beads was successfully re-used to decolorize different synthetic azo dyes.
cultivation. However, for immobilized cells of C. gallica and B. adusta, maximum decolorization was obtained at pH 6.0 (85% and 74%, respectively) for the same period of time (24 h). In addition, decolorization yields decreased below 50% at pH 7.0 and nearly 22% at pH 8.0 for all the tested strains after 24 h. This indicates that neutral and basic pH values are not favorable for decolorization of the dye LG by the tested strains. The trend of pH dependence on decolorization was similar to that observed in cultures of F. trogii immobilized into Ca-alginate beads for the dye RB5 (Mazmanci and Unyayar, 2010). Therefore, optimum pH for dye decolorization depends on the fungus and its enzymatic system, as well as on the nature of the dye under consideration. Most
Table 4 Effect of inoculum size (beads/medium) on dye removal using different immobilized cells into alginate beads (initial concentration: 150 mg/L; pH ¼ 5.5; Temperature: 40 C; agitation: 150 rpm) with their 95% confidence limits; (*): Mean SD (n ¼ 3). Beads/medium ratio (w/v)
Average value of color removal (%)
5% 10% 20% 30% 40%
22.5 46.4 59 52.2 39.6
C. gallica 24 h
B. adusta 48 h
0.7 1.8 2.4 0.9 1.1
38.6 71 75.6 57.7 46.8
2.4 3.2 0.4 0.7 2.3
72 h
24 h
48.2 1.5 80.6 0.9 88.72.1 62.3 3.4 58.7 1.4
19.6 38.1 42.4 49.4 30.02
T. versicolor 48 h
0.7 1.7 0.8 1.4 4.1
34.3 48.7 54.7 57.2 38.5
72 h
1.2 0.9 1.6 0.7 0.4
46.6 67.3 89.3 68.1 45.2
24 h
1. 3.4 0.8 0.5 2.2
28.3 35.5 38.7 41.2 52.3
T. trogii 48 h
1.2 4.1 2.6 0.7 0.9
48.2 65.2 69.3 55.3 59.3
72 h
0.8 0.4 0.9 3.5 2.4
55.9 76.4 82.1 66.2 63.8
24 h
2.4 0.4 0.4 1.1 0.9
18.3 53.6 64.5 42.3 43.1
48 h
2.6 0.7 1.6 0.9 0.4
51.6 71.2 75.5 70.2 64.2
72 h
0.8 1.8 0.5 3.5 2.4
58.2 77.3 81.3 75.7 66.5
1.5 2.1 0.5 0.8 1.5
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
A Decolorizaon (%)
81.3% were obtained for C. gallica, B. adusta, T. versicolor and T. trogii, respectively after 72 h of incubation operating at a beads/medium ratio of 20% (w/v), a medium pH value of 5.0 for T. versicolor and T. trogii and 6.0 for C. gallica and B. adusta, in agitated cultures (150 rpm) at 45 C for all the tested strains except for B. adusta which was at 40 C. The results also indicated that laccase was the main ligninolytic enzyme involved in the breakdown of the metal complex dye LG. This study suggests the possibility to decolorize a high concentration of LG (200 mg/L) and the immobilized cells can be re-utilized. This could be a great advance in the treatment of metal dye-containing wastewater and the method may have a potential application in continuous systems, especially to treat wastewater from the textile industry.
immobilized fungus
100
free fungus
80 60 40 20 0 C. gallica
B. adusta
T. versicolor
T. trogii
White-rot fungi
B
immobilized fungus
Decolorizaon (%)
100
free fungus
80 60 40 20 0 C. gallica
B. adusta
T. versicolor
T. trogii
White-rot fungi
C
immobilized fungus
100
free fungus
80 60 40 20 0 C. gallica
331
B. adusta
T. versicolor
T. trogii
White-rot fungi Fig. 5. Successive decolorization batches by different Ca-alginate immobilized fungi and free fungi (initial concentration of Lanaset Grey G: 150 mg/L; beads/medium ratio: 20% (w/v), agitation: 150 rpm; pH: 5.5; temperature: 40 C). Each batch lasted 24 h.
4. Conclusions Results obtained from this work showed that the immobilization of fungi into Ca-alginate beads enhanced the decolorization of the metal textile dye LG as compared to free fungal cultures. Maximum decolorization percentages of 88.7%, 89.3%, 82.1% and
References Abdel-Razek, A.S., 2011. Removal of chromium ions from liquid waste solutions using immobilized Cunninghamella elegans. Nat. Sci. 9, 211e219. Ahmadi, M., Vahabzadeh, F., Bonakdarpour, B., Mehranian, M., 2006. Empirical modeling of olive oil mill wastewater treatment using loofa-immobilized Phanerochaete chrysosporium. Process. Biochem. 41, 1148e1154. Arica, M.Y., Bayramoglu, G., Yilmaz, M., Bektas, S., Genç, O., 2004. Biosorption of Hg2þ, Cd2þ, and Zn2þ by Ca-alginate and immobilized wood-rotting fungus Funalia trogii. J. Hazard. Mater. B109, 191e199. Baccar, R., Blánquez, P., Bouzid, J., Feki, M., Attiya, H., Sarrà, M., 2011. Decolorization of a tannery dye: from fungal screening to bioreactor application. Biochem. Eng. J. 56, 184e189. Baldrian, P., Snajdr, J., 2006. Production of ligninolytic enzymes by litterdecomposing fungi and their ability to decolorize synthetic dyes. Enzym. Microb. Technol. 39, 1023e1029. Balu, B., Radha, K.V., 2009. Kinetic study on decolourization of the dye Acid Orange using the fungus Phanerochate chrysosporium. Mod. Appl. Sci. 3, 38e47. Banat, I.M., Nigam, P., Singh, D., Marchant, R., 1996. Microbial decolourization of textile dyes containing effluents: a review. Bioresour. Technol. 58, 217e227. Blánquez, P., Caminal, G., Sarrà, M., Vicent, T., 2007. The effect of HRT on the decolourisation of the Grey Lanaset G textile dye by Trametes versicolor. Chem. Eng. J. 126, 163e169. Blánquez, P., Casas, N., Font, X., Gabarrell, X., Sarra, M., Caminal, G., Vicent, T., 2004. Mechanism of textile metal dye biotransformation by Trametes versicolor. Water Res. 38, 2166e2172. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteinedye binding. Anal. Biochem. 72, 248e254. Cha, C.J., Doerge, R.D., Cerniglia, C.E., 2001. Biotransformation of malachite green by the fungus Cunninghamella elegans. Appl. Environ. Microbiol. 67, 4358e4360. Chen, B.Y., Yen, C.Y., Chen, W.M., Chang, C.T., Wang, C.T., Hu, Y.C., 2009. Exploring threshold operation criteria of biostimulation for azo dye decolourization using immobilized cell systems. Bioresour. Technol. 100, 5763e5770. Clarke, E.A., Anliker, R., 1980. Organic dyes and pigments. In: Hutzinger, O. (Ed.), Anthropogenic Compounds, The Handbook of Environmental Chemistry, vol. 3, Part A. Springer-Verlag, New York, pp. 181e215. Dominguez, A., Rodriguez-Couto, S., Sanroman, M.A., 2005. Dye decolorization by Trametes hirsuta immobilized into alginate beads. World J. Microbiol. Biotechnol. 21, 405e409. Dos Santos, A.B., Bisschops, I.A.E., Cervantes, F.J., Van Lier, J.B., 2004. Effect of different redox mediators during thermophilic azo dye reduction by anaerobic granular sludge and comparative study between mesophilic (30 C) and thermophilic (55 C) treatments for decolourisation of textile wastewaters. Chemosphere 55, 1149e1157. Enayatzamir, K., Alikhani, H.A., Yakhchali, B., Tabandeh, F., Rodríguez-Couto, S., 2010. Decolouration of azo dyes by Phanerochaete chrysosporium immobilised into alginate beads. Environ. Sci. Pollut. Res. 17, 145e153. Gabarrell, X., Font, M., Vicent, T., Caminal, G., Sarrà, M., Blánquez, P., 2012. A comparative life cycle assessment of two treatment technologies for the Grey Lanaset G textile dye: biodegradation by Trametes versicolor and granular activated carbon adsorption. Int. J. Life Cycle Assess. 17, 613e624. Gao, Q.T., Wong, Y.S., Tam, N.F.Y., 2011. Removal and biodegradation of nonylphenol by immobilized Chlorella vulgaris. Bioresour. Technol. 102, 30e38. Gerbsch, N., Buchholz, R., 1995. New processes and actual trends in biotechnology. FEMS Microbiol. Rev. 16, 259e269. Goodell, B., Qian, Y., Jellison, J., Richard, M., 2004. Decolorization and degradation of dyes with mediated Fenton reaction. Water Environ. Res. 76, 2703e2707. Hammel, K.E., Kapich, A.N., Jensen, K.A., Ryan, Z.C., 2002. Reactive oxygen species as agents of wood decay by fungi. Enzym. Microb. Technol. 30, 445e453. Jadhav, S.U., Kalme, S.D., Govindwar, S.P., 2008. Biodegradation of methyl red by Galactomyces geotrichum MTCC 1360. Int. Biodeterior. Biodegrad. 62, 135e142. Kanu, O.K., Ijeoma, O.K., Achi, O.K., 2011. Industrial effluents and their impact on water quality of receiving rivers in Nigeria. J. Appl. Technol. Environ. Sanit. 1, 75e86. Katzbauer, B., Narodoslawsky, B., Moser, A., 1995. Classification system for immobilization techniques. Bioprocess Eng. 12, 173e179.
332
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
Knapp, J.S., Vantoch-Wood, E.J., Zhang, F., 2001. Use of Wood-rotting fungi for the decolourization of dyes and industrial effluents. In: Gadd, G.M. (Ed.), Fungi in Bioremediation. Cambridge University Press, Cambridge, pp. 253e261. Kourkoutas, Y., Bekatorou, A., Banat, I.M., Marchant, R., Koutinas, A.A., 2004. Immobilization technologies and support materials suitable in alcohol beverages production: a review. Food Microbiol. 21, 377e397. Laca, A., García, L.A., Díaz, M., 2000. Analysis and description of the evolution of alginate immobilised cells systems. J. Biotechnol. 80, 203e215. Mazmanci, M.A., Unyayar, A., 2010. Decolourization efficiency of Funalia trogii under static condition: effect of C: N ratios. Afr. J. Biotechnol. 9, 6539e6544. Moutaouakkil, A., Blaghen, M., 2011. Decolourization of the anthraquinone dye Cibacron Blue 3G-A with immobilized Coprinus cinereus in fluidized bed bioreactor. Prikl. Biokhim. Mikrobiol. 47, 66e72. Novotny, C., Svobodova, K., Erbanova, P., Cajthaml, T., Kasinath, A., Lang, E., Sasek, V., 2004. Ligninolytic fungi in bioremediation: extracellular enzyme production and degradation rate. Soil Biol. Biochem. 36, 1545e1551. Park, C., Lee, M., Lee, B., Kim, S.W., Chase, H.A., Lee, J., Kim, S., 2007. Biodegradation and biosorption for decolorization of synthetic dyes by Funalia trogii. Biochem. Eng. J. 36, 59e65. ski, A., Crawford, R.L., Huynh, V.B., 1988. Manganese peroxidase of PhaPaszczyn nerochaete chrysosporium: purification. Meth. Enzymol. 161, 264e270. Rocher, V., Bee, A., Siaugue, J.M., Cabuil, V., 2010. Dye removal from aqueous solution by magnetic alginate beads crosslinked with epichlorohydrin. J. Hazard. Mater. 178, 434e439. Rodríguez-Couto, S., 2009. Dye removal by immobilised fungi. Biotechnol. Adv. 27, 227e235. Shin, M., Nguyen, T., Ramsay, J., 2002. Evaluation of support materials for the surface immobilization and decoloration of amaranth by Trametes versicolor. Appl. Microbiol. Biotechnol. 60, 218e223.
Swamy, J., Ramsay, J.A., 1999. The evaluation of white rot fungi in the decolouration of textile dyes. Enzym. Microb. Technol. 24, 130e137. Szalinska, E., Dominik, J., Vignati, D.A.L., Bobrowski, A., Bas, B., 2010. Seasonal transport pattern of chromium (III and VI) in a stream receiving wastewater from tanneries. Appl. Geochem. 25, 116e122. Thongchul, N., Yang, S.T., 2003. Controlling filamentous fungal morphology by immobilization on a rotating fibrous matrix to enhance oxygen transfer and L(þ)-lactic acid production by Rhizopus oryzae. Ferment. Biotechnol. ACS SYM SER 862, 36e51. Tien, M., Kirk, T.K., 1984. Lignin-degrading enzyme from Phanerochaete chrysosporium: purification, characterization, and catalytic properties of a unique H2O2-requiring oxygenase. Proc. Natl. Acad. Sci. U.S.A. 81, 2280e2284. Vaithanomsat, P., Apiwatanapiwat, W., Petchoy, O., Chedchant, J., 2010. Decolorization of reactive dye by white-rot fungus Datronia sp. KAPI0039. Kasetsart J. (Nat. Sci.) 44, 879e890. Wang, X., Sato, T., Xing, B., Tao, S., 2005. Health risks of heavy metals to the general public in Tianjin, China via consumption of vegetables and fish. Sci. Total. Environ. 350, 28e37. Wesenberg, D., Kyriakides, I., Agathos, S.N., 2003. White-rot fungi and their enzymes for the treatment of industrial dye effluents. Biotechnol. Adv. 22, 161e187. Yaropolov, A.I., Skorobogatko, O.V., Vartanov, S.S., Varfolomeyev, S.D., 1994. Laccaseproperties, catalytic mechanism, and applicability. Appl. Biochem. Biotechnol. 49, 257e280. Znidarsi c, P., Pavko, A., 2001. The morphology of filamentous fungi in submerged cultivations as a bioprocess parameter. Food Technol. Biotechnol. 39, 237e252. Zouari-Mechichi, H., Mechichi, T., Dhouib, A., Sayadi, S., Martínez, A.T., Martínez, M.J., 2006. Laccase purification and characterization from Trametes trogii isolated in Tunisia: decolourization of textile dyes by the purified enzyme. Enzym. Microb. Technol. 39, 141e148.
Contents lists available at ScienceDirect
Journal of Environmental Management journal homepage: www.elsevier.com/locate/jenvman
Decolorization of the metal textile dye Lanaset Grey G by immobilized white-rot fungi Dalel Daâssi a, Tahar Mechichi a, Moncef Nasri a, Susana Rodriguez-Couto b, c, * a Université de Sfax, Ecole Nationale d’Ingénieurs de Sfax, Laboratoire de Génie Enzymatique et de Microbiologie, Route de Soukra Km 4.5, BP «1173», 3038 Sfax, Tunisia b CEIT, Unit of Environmental Engineering, Paseo Manuel de Lardizábal 15, 20018 San Sebastian, Spain c IKERBASQUE, Basque Foundation for Science, Alameda de Urquijo 36, 48011 Bilbao, Spain
a r t i c l e i n f o
a b s t r a c t
Article history: Received 9 May 2013 Received in revised form 24 July 2013 Accepted 27 July 2013 Available online 26 August 2013
In this paper we studied the ability of four Tunisian-isolated fungi (i.e. Coriolopsis gallica, Bjerkandera adusta, Trametes versicolor and Trametes trogii) immobilized into Ca-alginate beads to decolorize the metal textile dye Lanaset Grey G (LG). The effect of different operational conditions, such as initial dye concentration, temperature, pH, beads/medium ratio and agitation, on dye decolorization by the immobilized fungi was investigated. Maximal decolorization percentages of 88.7%, 89.3%, 82.1% and 81.3% for C. gallica, B. adusta, T. versicolor and T. trogii were attained, respectively, when operating at an initial LG concentration of 150 mg/L, pH values of 5.0e6.0, temperatures of 40e45 C and a beads/medium ratio of 20% (w/v) in static conditions after 72 h of incubation. Subsequently, the re-usability of the immobilized fungi was evaluated. After three decolorization cycles, the decolorization percentage of free cell cultures dropped to values below 36%, while decolorization percentages of about 75%, 70%, 60% and 68% were obtained by the immobilized cultures of C. gallica, B. adusta, T. versicolor and T. trogii, respectively. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: White-rot fungi Immobilization Metal textile dye Biodegradation Alginate
1. Introduction Wastewater from the textile industry is one of the most problematic to treat due to its color, high chemical oxygen demand (COD), biochemical oxygen demand (BOD), suspended solids, turbidity and toxic compounds (Kanu et al., 2011). Dye color interferes with penetration of sunlight into waters, retards photosynthesis, inhibits the growth of aquatic biota and affects gas solubility in water bodies (Banat et al., 1996). Furthermore, many dyes are believed to be carcinogenic or are synthesized from known carcinogens such as benzidine (Clarke and Anliker, 1980). In addition, effluents from the textile industry contain many toxic compounds such as heavy metals (Szalinska et al., 2010). Unlike other pollutants, heavy metals are difficult to remove from wastewater and may escape the capacities of the conventional systems for effluent treatment. Moreover, these metals can accumulate in the
* Corresponding author. CEIT, Unit of Environmental Engineering, Paseo Manuel de Lardizábal 15, 20018 San Sebastian, Spain. Tel.: þ34 943212800x2239; fax: þ34 943 213076. E-mail address: [email protected] (S. Rodriguez-Couto). 0301-4797/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.jenvman.2013.07.026
environment and organisms through the food chain, posing a threat to public health (Wang et al., 2005). Due to stricter government legislation concerning the release of contaminated effluents into the environment, the treatment of industrial textile wastewater is a field of increasing research. The existing physical and/or chemical techniques to treat textile industrial effluents present the following drawbacks: high cost, low efficiency, potential production of highly toxic by-products and inapplicability to a wide variety of dyes (Novotny et al., 2004). Also, textile effluents are usually recalcitrant to standard biological treatments. This has impelled the search for new approaches. By far white-rot fungi are the most efficient micro-organisms in breaking down synthetic dyes due to their ability to produce nonspecific extracellular lignin-degrading enzymes (Wesenberg et al., 2003). These enzymes are mainly lignin peroxidase (LiP, EC 1.11.1.14), manganese-dependent peroxidase (MnP, EC 1.11.1.13) and laccase (benzenediol/oxygen oxidoreductase, EC 1.10.3.2). Several studies have shown that immobilized fungi offer several advantages over free fungal cells (Rodríguez-Couto, 2009). Thus, immobilized cultures are more resilient to environmental perturbations, such as pH or exposure to toxic chemical concentrations, than free cultures (Shin et al., 2002). In addition, in industrial
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
operations, immobilized fungi could provide additional advantages over freely suspended ones such as easy separation of cells from liquid medium, protection from shear damage and reduction in protease activity. Furthermore, cell immobilization lowers the apparent broth viscosity and makes the rheological features more favorable for oxygen and mass transfer (Thongchul and Yang, 2003). Basically, there are two types of cell immobilization: entrapment and attachment (Rodríguez-Couto, 2009). A variety of matrices have been used for cell immobilization via the entrapment technique such as natural polymeric gels (agar, carrageenan, alginate, chitosan and cellulose derivatives) and synthetic polymers (polyacrylamide, polyurethane, polyvinyl) (Katzbauer et al., 1995). Among them, alginate is the most commonly used polymer for cell entrapment (Gerbsch and Buchholz, 1995) because it is not toxic and the immobilization is performed under mild conditions (Kourkoutas et al., 2004). Accordingly, immobilization into alginate beads was selected to perform the present study. This study uses a commercial mixture of metal-complex dyes such as Lanaset Grey G (LG) that contains chromium III (Cr III) and cobalt (Co) as organo-metal complexes (Gabarrell et al., 2012). Previous research has elucidated the biodegradation process of this dye by the fungus Trametes versicolor (Blánquez et al., 2004) but there are no studies with alginate-immobilized fungi. In the present work, the decolorization of this metal textile dye by different newly-isolated white-rot fungi immobilized into alginate beads was investigated. The reusability of the alginate-immobilized fungi was also assessed. 2. Materials and methods 2.1. Dye The dye Lanaset Grey G (LG), a commercial mixture of several metal complex dyes, was supplied by DyeStar (Portugal). Its chemical formula is not disclosed because it is a patented dye. This dye is known to contain chromium III (2.5%) and cobalt (0.79%) (Blánquez et al., 2004; Gabarrell et al., 2012). Stock solutions (0.1% w/v in distilled water) were stored in the dark at room temperature. 2.2. Fungal strains The fungal strains used in this study were isolated from decaying acacia wood in the Northwest of Tunisia. They were identified by the Spanish Type Culture Collection (CECT) as Coriolopsis gallica (BS54), Bjerkandera adusta (11B), T. versicolor (A3) and Trametes trogii (AD40) (Table 1). The strains were maintained on Petri plates containing 2% malt extract agar (MEA) at 4 C and subcultured every 2 months. 2.3. Medium and culture conditions Mycelial suspensions of the fungal strains were obtained by inoculating four plugs (1 cm2) excised from the growing zone of 4-day-old fungi on Petri plates to 1000-mL cotton-plugged Erlenmeyer flasks containing 100 mL of culture medium (M7) as described in Zouari-Mechichi et al. (2006). This basal medium contained (per liter): glucose, 10 g; peptone, 5 g; yeast extract, 1 g; ammonium tartrate, 2 g; KH2PO4, 1 g; MgSO4$7H2O, 0.5 g; KCl, 0.5 g; trace element solution, 1 ml. The composition of the trace element solution per liter was as follows: B4O7Na2$10H2O, 0.1 g; CuSO4$5H2O, 0.01 g; FeSO4$7H2O, 0.05 g; MnSO4$7H2O, 0.01 g; ZnSO4$7H2O, 0.07 g; (NH4)6Mo7O24 4H2O, 0.01 g. The pH of the culture medium was adjusted to 5.5. The flasks were incubated in static conditions at 30 C. After 4e5 days of cultivation, these fungal
325
pre-cultures were homogenized using an Ultra Turrax (IKA T18, Staufen, Germany) for 2 min at 20,000 rpm. The resulting mycelia suspensions were stored at 4 C until used. 2.4. Immobilization of fungi into alginate beads The fungal strains used in this work were entrapped into Caalginate beads using a method based on that described by Laca et al. (2000). 3 mL of each mycelium suspension was mixed with 100 mL of alginate solution (2.1% w/v) under shaking. The final concentration of alginate in the beads (apron. 4 mm in diameter) was 2% (w/v). The mixture was dropped by means of a syringe into a CaCl2 solution (3% w/v) under shaking. To minimize cellular leaking a method of gel re-coating was used for C. gallica and T. trogii, since in preliminary experiments cell leakage from the beads was found with these strains. Thus, after 30 min the beads were collected from the solution, washed with distilled water and placed into a solution of sodium alginate (0.5% w/v) for 5e10 min. This makes that the diffusion of the Caþ2 from the beads produces the gelification of a second alginate layer on the bead surface. After that, the beads were washed with distilled water and left to harden for 30 min into a solution of CaCl2 (3% w/v). Finally, the beads were washed with a solution of NaCl (0.7%. w/v) (Enayatzamir et al., 2010). Alginate beads were produced under sterile conditions and hence, all the solutions involved were autoclaved until used. 2.5. Decolorization studies The immobilized fungi were cultured in 250-mL cotton-plugged Erlenmeyer flasks containing 50 mL of culture medium. The beads/ medium ratio used was 10% (w/v) and the pH of the medium was adjusted to 5.5. The flasks were incubated at 30 C in static conditions for seven days. In order to boost laccase production, the cultures were supplemented with 300 mM of CuSO4 on the third cultivation day (Zouari-Mechichi et al., 2006). The dye solution was added by filtration (0.22 mm) into the culture flasks when laccase production started (500 U/L), which corresponded to the fourth cultivation day. Free-cell alginate beads and inactivated fungi were used as controls for immobilized and free cultivations, respectively. The inactivation of the fungi was performed by autoclaving them at 121 C for 20 min. The effect of the initial dye concentration (ranging from 20 to 300 mg/L), agitation (150 rpm) and static conditions, pH (ranging from 3 to 8), temperature (from 40 to 55 C) and beads/medium ratio (from 5 to 40% w/v) on LG removal by immobilized and free fungi in batch systems was assessed. Samples were withdrawn aseptically from the experimental flasks periodically, centrifuged at 8000 rpm for 10 min and analyzed for enzyme activity and decolorization percentage. The residual dye concentrations were spectrophotometrically measured from 450 to 700 nm and calculated measuring the area under the plot. Dye decolorization was expressed in terms of percentage. 2.5.1. Decolorization in successive batches In order to investigate the re-usability of the immobilized cultures, the decolorization experiments in optimal conditions were performed in three successive batches, each batch lasting 24 h. It is useful to determine the minimum medium components required for decolorization in order to minimize the cost of the treatment process. For this reason, the decolorizing ability of the immobilized and free fungi was also evaluated in a minimal medium consisting of buffer (25 mM succinic acid, pH 5.5) and glucose (2 g/L). The whole medium was used in the two first batches, whereas the minimal medium was used in the third batch.
326
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
Table 1 Molecular identification of fungal strains. Nucleotide sequence
Similarity (%)
Identification
>BS54 TGTAGCTGGCCTCTCCGGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGG GTATCGGAAGGCGTCGCGTCGTTNNNNGCGAGGCGTTAACCGTGCCTACGTCTTACTACAAACGCTTC AGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCG CATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCT TTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAAAC CCATAAGTCTTTGCGGGCTTACGGGCTTTGGACTTGGAGGCTTTGTCGGCGACCGCGAGGTCTGTCGA CTCCTCTCAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGTCTACGCCGTGA CCGTGAAGCGTTTTGGCGAGCTTCTAATCGTCTCTTACGAGACAGCTTACATTGACCTCTGACCTCAAAT CAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAG >11B CCTGNTTTGAGCTCNGAGTTCAGAAATTTGTCCGAAGACGGTTAGAAGCGNGAACACTAGAATACCCT CCACAGCAACGCAGATAATTATCACGCTGAAGCGGCTGGTAACGTTCGCACTAATGCATTTCAGAGGA GCCGACTACGAGAGCCGGCACGACCTCCAAGTCCAAGCCTTCATCAATAAAGCCNAAGGTTGAGAATT CCATGAGACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATG ATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAA GAGATCCGTTGCTGAAAGTTGTATATAAATTGCGTTATAGCAAAGTATGACATTCTAAAACTGAATCGTT TGTAATAAAGCATAAGCCCGACACCTACAAGTGCGCGAACGCACCCACAAGCCGGCCTATGAAAAGTG CACAGAAGTTGAGAGTGGATGAGACAGGCGTGCACATGCCCTTGCGAGCCAGCAGACAACCCGTTCAA AACTCGATAATGATCCTTCCGCAGG >AD40 GGGTTGTAGCTGGCCTCTCCGGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGNGCNCTTACT GTGGGTATCGGAAGGCGTCGCGTCGTTTGCGGCGAGGCGTTAACCGTGCCTACGTCTTACTACAAACG CTTCAGTATCAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCT CTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCG AATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCT CAAACCCATAAGTCTTTGCGGGCTTACGGGCTTTGGACTTGGAGGCTTTGTCGGCGACCGCGAGGCTG TCGACTCCTCTCAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGTCTACGCC GTGACCGTGAAGCGTTTTGGCGAGCTTCTAATCGTCTCTTACGAGACAGTTACATTGACCTCTGACCTC AAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAG
99
Coriolopsis gallica Sequence ID:gbjAY684172.1
99
Bjerkandera adusta Sequence ID: gbjJF439464.1j
98
Trametes trogii Sequence ID: gbjJN164998.1j
At the end of each batch, the beads were rinsed twice with sterile distilled water and transferred into fresh decolorization medium for the next decolorization batch. Ca-alginate beads with immobilized fungus from 4-day-old cultures were inactivated by autoclaving (121 C, 20 min) and used as control cultures to determine the amount of dye bound to the alginate beads. At the end of the third batch, the beads of each flask were pooled, washed with sterile distilled water and stored in sterile calcium chloride (2 g/L) at 4 C. After 3 storage weeks at 4 C, the beads were recovered by filtration and washed again with sterile distilled water and added to a fresh minimal medium containing 100 mg/L of LG to start the 3rd decolorization batch. 2.6. Analytical assays Laccase activity was determined by using 10 mM 2,6dimethoxyphenol (DMP) in 100 mM sodium tartrate buffer, pH 5.0 (molar extinction coefficient ¼ 27,500 M1 cm1, based on DMP concentration) (Yaropolov et al., 1994). Manganese-dependent peroxidase (MnP) activity was measured by monitoring the oxidation of guaiacol (molar extinction coefficient ¼ 12,000 M1 cm1) spectrophotometrically at 465 nm at ski et al., 1988). The reaction mixtures room temperature (Paszczyn (1 mL) contained 500 mL of culture broth, 200 mL of 0.5 M sodium tartrate buffer (pH 5.0), 100 mL of 1 mM MnSO4, 100 mL of 1 mM H2O2 and 100 mL of 1 mM guaiacol. The reaction was initiated by the addition of H2O2. Lignin peroxidase (LiP) activity was determined by the oxidation of veratryl alcohol at 310 nm (molar extinction coefficient ¼ 93,000 M1 cm1) to veratryl aldehyde (Tien and Kirk, 1984). The reaction was initiated by the addition of 0.15 mM H2O2. The enzymatic reactions were carried out at room temperature (22e25 C) and one unit of enzyme activity (U) was defined as the
amount of enzyme oxidizing 1 mmol of substrate per minute. The activities were expressed as U/L. The protein concentration was measured by the Bradford method (Bradford, 1976), using bovine serum albumin (BSA) (Sigma Chemical, St. Louis, USA) as a standard. 2.7. Kinetics study Substrate specificity towards the metal dye (LG) was analyzed kinetically at room temperature (22e25 C). The reaction mixtures consisted of dye solution (at varying concentrations ranging from 20 to 300 mg/L) and immobilized cells (from C. gallica; B. adusta; T. trogii and T. versicolor) in culture medium (pH 5.5). All the cultures were incubated at room temperature (22e25 C), without shaking. 2.8. Statistical analysis Duplicate experiments were performed to test the reproducibility of the data. All the analyses were performed in triplicate. Statistical analysis was carried out using Microsoft ExcelÒ software (Microsoft), standard deviation being 10%. Data among treatments were analyzed by one-way analysis of variance (ANOVA) using Microsoft ExcelÒ software (Microsoft). Readings were considered significant when p was 0.05. 3. Results and discussion The research for new strains able to degrade metal-containing dyes is still of great scientific and industrial interest. In the present study, four newly-isolated strains were immobilized into Ca-alginate beads in order to assess their suitability for the decolorization of the metal complex dye LG.
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
100
Decolorization (%)
80
heat-inactivated cells can be different to that of living cells (Arica et al., 2004). Also, adsorption and xenobiotic transformation in living fungal cultures cannot be clearly distinguished since they can degrade the adsorbed pollutants by intracellular mechanisms (Blánquez et al., 2004). On the other hand, Table 2 illustrated the production of ligninolytic enzymes (LiP, MnP and laccase) by the immobilized and free cultures. The results proved that different fungal strains influenced LG biodegradation efficiency due to their differences in enzymatic activities. For all the tested strains dye decolorization was correlated with ligninolytic enzyme production. Thus, the data represented in Table 2 show that laccase production was improved by fungal immobilization compared to MnP and LiP. High laccase activities of 6544 U/L on the 8th culture day, 13,552 U/L on the 12th culture day and 5147 U/L on the 9th culture day were detected in immobilized cultures of T. trogii, B. adusta and C. gallica, respectively. However, laccase activities were rather low in free cultures. In addition, LG decolorization was correlated with ligninolytic enzyme production. Thus, higher decolorization percentages were obtained by the cultures with higher laccase activities, save for T. versicolor cultures. In immobilized cultures of C. gallica, a maximum LG decolorization percentage of 95.2% was observed at the maximum laccase activity (5147 U/L) on the 9th culture day, while for a laccase activity of 1087 U/L, LG decolorization was about 70% on the 5th culture day. Baldrian and Snajdr (2006) reported that dye decolorization by white-rot and litter-decomposing fungi was mainly due to the extracellular ligninolytic enzymes secreted by such fungi and to a less extent to the biosorption of the dye onto fungal mycelium. Also Park et al. (2007) found that dye decolorization by Funalia trogii was due to biodegradation by extracellular enzymes and biosorption onto fungal mycelium, the former being more important. On the contrary, Baccar et al. (2011) showed that the dead cells of the white-rot fungus T. versicolor considerably removed a tannery dye, suggesting their use as an effective biosorbent. In addition, other mechanisms may be involved in dye decolorization by white-rot fungi such as cytochrome P450 (Cha et al., 2001) and reactive oxygen species (Hammel et al., 2002; Goodell et al., 2004). In the case of the immobilized cultures of T. versicolor, although LG was considerably decolorized (75%), no direct relationship between decolorization and laccase activity was found. In fact close decolorization rates of 70.8% and 75% were detected for 1975 U/L and 6645 U/L. So, high enzyme activities were not necessary to obtain high decolorization percentages. Similar
Immobilized fungus Ca-alginate free fungus inactivated fungus
60
40
20
0 B. adusta
T. versicolor
T. trogii
327
C. gallica
White-rot fungi Fig. 1. Ability of several free and immobilized white-rot fungi into Ca-alginate beads to decolorize 50 mg/L of the metal dye Lanaset Grey G in 24 h. The controls for free fungi were heat-inactivated fungi whereas the controls for immobilized fungi were Caalginate beads without fungi.
3.1. LG decolorization by free and immobilized fungi Ca-alginate immobilized and free fungi were tested to decolorize 50 mg/L of the metal complex dye LG. The results presented in Fig. 1 proved that fungal immobilization had a positive effect on LG decolorization by all the tested fungi. Although the free fungal cultures were able to decolorize the dye LG, removal yields were lower than those obtained by the immobilized cultures (Fig. 1). Indeed, the decolorization percentages obtained by the immobilized cultures were 2-fold higher than those attained by the free fungal cultures except for T. versicolor cultures, which resulted in similar decolorization percentages (about 72% in 24 h). In addition, among the immobilized cultures, C. gallica led to the highest decolorization percentage (about 85% within 24 h). The decolorization percentages achieved by the immobilized cultures of B. adusta, T. trogii and T. versicolor were 70.9%, 72.2% and 75.3%, respectively. The inactivated fungi removed 21e41% of the dye after 24 h of exposure, whereas the free-cells Ca-alginate beads removed 10e14% of LG in the same period. So, dye decolorization was due to two mechanisms: enzymatic action (biodegradation) and adsorption onto Ca-alginate beads and fungal biomass (biosorption). However, it is known that adsorption capacities of
Table 2 Ligninolytic enzymes detected in cultures of free and immobilized fungi: M7 medium (with their 95% confidence limits; Mean SD (n ¼ 3), 10% w/v (beads/M7); 50 mg/L; 30 C; 150 rpm, in the presence of 150 mM CuSO4). Strains
Culture time (days)
Enzymes produced (U/L)
Free T. trogii B. adusta T. versicolor C. gallica a b
6 8 4 12 4 8 5 9
Decolorization (%) MnPa
Laccase
938 3276 746 8358 1310 5133 830 3880
Immob.
MnP: manganese-dependent peroxidase. LiP: lignin peroxidase.
9.8 11.4 6.4 14.7 11.3 6.5 8.5 12.2
1432 6544 1871 13552 1975 6645 1087 5147
LiPb
Free 11.2 8.2 6.5 5.8 5.5 12.4 5.6 8.4
67.5 114 898 521 e e 80.5 214
10 9.3 8.4 12
11. 7.3
Immob.
Free
Immob.
85 5.7 182 8 e e e e e e
0.44 1.1 13.0.8 30.2 8 0.7 88 14.2 65 2.2 8.80.2 2.50.4
2.3 18 e e 101 55 5 e
8.1 1.2
0.5 0.2 0.4
Free 32 51.8 28.2 44.1 66.2 70.2 30.1 60.2
Immob.
1.09 2.0 1.2 0.4 0.4 0.3 0.8 1.0
63.8 70.2 67.5 87.2 70.8 75.2 70.3 95.2
0.9 0.7 1.8 0.5 1.4 1.4 0.8 0.9
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
results were reported by Blánquez et al. (2007) in the decolorization of the dye LG (150 mg/L) by T. versicolor and by Baccar et al. (2011) in the decolorization of a tannery dye (150 mg/L) by T. versicolor. 3.2. Effect of different operational conditions on LG decolorization by immobilized fungi The fungal growth and enzyme production, and consequently, decolorization and degradation are influenced by numerous factors, e.g. medium composition, pH, agitation, aeration, temperature and initial dye concentration. Their effects are briefly presented and discussed below.
A
20 mg/L 60 mg/L 100 mg/L 150 mg/L 200 mg/L 300 mg/L
100 Decolorization (%)
328
80 60 40 20 0 0
3.2.2. Kinetic study The kinetic parameters of LG decolorization using fungal cultures immobilized into Ca-alginate beads were estimated by the HanneseWoolf plot. The theoretical maximum decolorization rate (Vmax) and the MichaeliseMenten constant (Km) were presented in Table 3. The HanneseWoolf gave a Km of 113.37, 57.75, 126.63 and 159.27 mg/L and Vmax of 12.98, 12.04, 8.19 and 10.39 mg/L/h for LG decolorization by C. gallica, B. adusta, T. versicolor and T. trogii, respectively (Table 3). Therefore, the enzymatic complex produced by B. adusta has more affinity for the dye LG than the ones produced by the other fungi. Hence, higher LG decolorization percentages were found by B. adusta. 3.2.3. Effect of agitation The decolorization yields of LG using free fungal cells were compared with those carried out by fungi immobilized into Ca-alginate beads in both agitated and static conditions (Fig. 3AeD). Fig. 3A shows that in static conditions, LG removal by free cells of C. gallica was 51% at the beginning of the cultivation (12 h), which
B Decolorization (%)
20
40
60 80 Culture time (h)
100
120
40
60 80 Culture time (h)
100
120
40
60 80 Culture time (h)
100
120
40
60 80 Culture time (h)
100
120
20 mg/L 60 mg/L 100 mg/L 150 mg/L 200 mg/L 300 mg/L
100 80 60 40 20 0 0
C Decolorization (%)
20
20 mg/L 60 mg/L 100 mg/L 150 mg/L 200 mg/L 300 mg/L
100 80 60 40 20 0 0
D
20
20 mg/L 60 mg/L 100 mg/L 150 mg/L 200 mg/L 300 mg/L
100 Decolorization (%)
3.2.1. Effect of initial dye concentration The decolorization percentage of LG by immobilized fungi was studied at different initial dye concentrations ranging from 20 to 300 mg/L. Decolorization rate decreased with increasing initial dye concentrations, this effect being more acute for dye concentrations higher than 100 mg/L (Fig. 2AeD). Similar results were found by Balu and Radha (2009), who reported that the concentration of the dye Acid Orange had to be kept below 100 mg/L in batch experiments using Phanerochaete chrysosporium immobilized into alginate beads to avoid substrate inhibition possibly due to high osmotic pressure. At higher concentrations (up to 200 mg/L) the decrease of LG decolorization can be explained by the inhibition of fungal growth and cellular metabolic activities resulting from the toxicity of dyes as well as blockage of active sites of enzymes by dye molecules (Jadhav et al., 2008). As can be seen in Fig. 2A color removal was higher than 80% at 24 h of incubation for an initial dye concentration of 20 mg/L. However, longer incubation time was required for higher initial dye concentrations. Thus, 96 h of incubation was necessary to achieve a color removal of 90%, 70% and 34% for initial dye concentrations of 100 mg/L, 150 mg/L and 200 mg/L, respectively. An increase in the incubation time enhances the contact time, favoring the diffusion of the dye inside the beads and, thus, increasing the degradation rate. The results obtained showed that the time required for complete decolorization for 60, 100, 200 and 300 mg/L of initial dye concentration was 24, 48, 96 and 120 h, respectively. Swamy and Ramsay (1999) reported that complete decolorization of 60 mg/L of Reactive Black by Bjerkandera sp. BOS55, P. chrysosporium and T. versicolor was obtained in 4, 2 and 3 days, respectively.
80 60 40 20 0 0
20
Fig. 2. Effect of initial dye concentration on the decolorization percentage (static conditions; initial pH: 4.5; T: 30 C; initial dye concentrations (mg/L): 20 mg/l (); 60 mg/L (); 100 mg/L (); 150 mg/L (6); 200 mg/L (); 300 mg/L (B)) using different Ca-alginate immobilized fungi (A) C. gallica; (B) B. adusta; (C) T. versicolor and (D) T. trogii.
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
113.37 57.75 126.63 159.27
4.3 2.6 3.5 1.2
12.98 12.04 8.19 10.39
2.7 0.8 2.4 0.9
was higher than that obtained by immobilized cells (21.6%). However, dye removal by immobilized cells increased gradually with incubation time. From 72 h onwards both free and immobilized fungi showed the same dye removal percentages (64%). Likewise, immobilized cells of C. gallica in agitated cultures resulted in high decolorization efficiency (up to 92%). In addition, an increase in the cultivation time led to a remarkable improvement in the removal of LG. Residual LG concentrations after 120 h in agitated cultures were of 8.3% and 25.8% for immobilized and free C. gallica cultures, respectively. Aeration and agitation are necessary to satisfy the microbial oxygen requirements during the cultivation and to enhance the oxygen gaseliquid mass transfer. This might affect the morphology of filamentous fungi and lead to the decreased rate of enzyme synthesis (Znidarsic and Pavko, 2001). Fig. 3B shows that immobilized cells of B. adusta exhibited higher dye removal under static conditions (87.5%) than under shaken conditions (65.8%). Similar results were observed in Fig. 3C and D with T. versicolor and T. trogii strains. In fact, the decolorization percentage of immobilized T. versicolor under agitated and static conditions was found to be 51.4% and 77.7% respectively, which were higher than those found with free cells. Fig. 3D shows that the dye removal percentage was found to be 88% using immobilized T. trogii which was more efficient under static than agitated conditions. However, dye decolorization by T. trogii free cells was ameliorated with agitation. Indeed, 60.6% of residual dye concentration was detected in the culture medium under static conditions which was reduced to 36.8% under agitated conditions. A similar trend toward decolorization efficiency of F. trogii under static conditions was reported by Mazmanci and Unyayar (2010) for Reactive Black 5 (RB5). Data presented in Fig. 3AeD show that the immobilization of fungi into Ca-alginate beads enhanced LG decolorization. A great number of authors have indicated that immobilization of fungi via entrapment in Ca-alginate beads could enhance dye biodecolorization (Chen et al., 2009; Rodríguez-Couto, 2009; Moutaouakkil and Blaghen, 2011). Additionally, immobilized cells need more contact time in the culture medium to remove color. Indeed, the dye in the medium need time to be adsorbed onto the alginate matrix, gradually accumulated and then degraded. Several researches reported the adsorption efficiency of Ca-alginate beads in pollutants removal such as dyes (Dominguez et al., 2005; Rocher et al., 2010), nonylphenol (NP) (Gao et al., 2011), olive oil waste water (Ahmadi et al., 2006) and heavy metal ions (Arica et al., 2004; AbdelRazek, 2011).
Decolorization (%)
C. gallica B. adusta T. versicolor T. trogii
Vmax (mg/L/h)
shaken immobilized static free shaken free
80 60 40 20 0 0
20
40
60
80
100
120
Culture time (h)
B
static immobilized shaken immobilized
100 Decolorization (%)
Km (mg/L)
static immobilized
100
static free shaken free
80 60 40 20 0 0
20
40
60
80
100
80
100
80
100
Culture time (h)
C
static immobilized shaken immobilized
100 Decolorization (%)
Immobilized fungi
A
static free shaken free
80 60 40 20 0 0
20
40
60
Culture time (h)
D
static immobilized shaken immobilized
100 Decolorization (%)
Table 3 The kinetic parameters of LG decolorization using fungal cultures immobilized into Ca-alginate beads estimated by HaneseWoolf plot.
329
static free shaken free
80 60 40 20
3.2.4. Effect of pH and temperature on LG decolorization Decolorization of the metal complex dye LG by immobilized fungi was studied at different pH values (3e8) of the culture medium, keeping constant the initial dye concentration (150 mg/L), inoculum size (10% w/v) and under agitation conditions (30 C, 150 rpm). Data presented in Fig. 4A show that decolorization yield was slightly affected by the medium pH. A maximum color removal of around 77.6% and 72.5% was observed for immobilized cells of T. versicolor and T. trogii, respectively, at pH 5.0 after 48 h of
0 0
20
40
60
Culture time (h) Fig. 3. Comparison of shaken (150 rpm) and static conditions on Lanaset Grey G (150 mg/L) removal by Ca-alginate immobilized fungi and free fungi of different strains (d) shaken culture; (.) static culture; () Ca-alginate immobilized fungi; (6) free fungi.
330
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
A 100 Decolorization (%)
researchers suggest that the optimum pH values for dye decolorization by white-rot fungi are likely in the range 4e6 (Knapp et al., 2001). The effect of temperature on LG decolorization by different immobilized fungi was studied in the range of 40 Ce55 C at 150 mg/L initial dye concentration. Data presented in Fig. 4B show that increases in temperature lead to further increases in decolorization rates during the first 48 h of incubation. Maximum decolorization percentages depended on the immobilized fungi used. As seen in Fig. 4B, 45 C was found to be the maximum temperature for dye removal by the majority of the immobilized fungi. Decolorization percentages were 82.3%, 78.6% and 80.4% for C. gallica, T. versicolor and T. trogii, respectively. However, B. adusta achieved a maximum color removal of around 87% at 40 C. Then, decolorization rates increased as the temperature rose up to 50 C. At higher temperatures decolorization efficiency remarkably decreased, which normally is attributed to loss in cell viability (Dos Santos et al., 2004).
pH 3 pH 4 pH 5 pH 6 pH 7 pH 8
80 60 40 20 0 C. gallica
B. adusta
T. versicolor
T. trogii
White-rot fungi
B
Decolorization
100
3.2.5. Effect of the beads/medium ratio The relationship between inoculum size and dye biodegradation was also investigated. Dye decolorization percentages changed significantly among the four tested fungi for the different beads/ medium ratios investigated as well as with incubation time (Table 4). At 24 h, no apparent dye decolorization was detected in the cultures with the lowest beads/medium ratio (5% w/v), whereas the highest decolorization percentage was achieved with the beads/medium ratio of 20% (w/v) by all the tested fungi. An increase in the beads/medium ratio led to a remarkable improvement in the removal of LG over a short period of time, but no further changes in dye removal were observed after 72 h Vaithanomsat et al. (2010) reported the effect of fungal inoculum size on ligninolytic enzymes levels and on decolorization rates. Thus, they found that laccase activity was partially affected and dye decolorization slightly affected by the fungal inoculum size.
80 60 40 20 0 C. gallica
B. adusta
T. versicolor
T. trogii
White-rot fungi Fig. 4. Effect of temperature (A) and pH (B) on decolorization of Lanaset Grey G after 48 h of incubation (initial concentration of Lanaset Grey G: 150 mg/L; beads/medium ratio: 10% (w/v); temperature: 30 C; agitation: 150 rpm; pH: 5.5) by different Caalginate immobilized fungi.
3.2.6. Successive batch decolorization cycles Unlike free cells, immobilized biomass can be easily separated from the reaction solution and reused which greatly decreases the cost of the treatment. The re-usability of the fungi immobilized into alginate beads and free cells was evaluated by successive cycles of LG decolorization. After three cycles, the decolorization percentage of the free cells dropped below 36%, while the decolorization percentage remained about 75, 70, 60 and 68% for immobilized cells of C. gallica, B. adusta, T. versicolor and T. trogii, respectively (Fig. 5AeC). Thus, the immobilized fungi exhibited good re-usability. These results are in agreement with those reported in the study of Enayatzamir et al. (2010). They reported that P. chrysosporium immobilized into alginate beads was successfully re-used to decolorize different synthetic azo dyes.
cultivation. However, for immobilized cells of C. gallica and B. adusta, maximum decolorization was obtained at pH 6.0 (85% and 74%, respectively) for the same period of time (24 h). In addition, decolorization yields decreased below 50% at pH 7.0 and nearly 22% at pH 8.0 for all the tested strains after 24 h. This indicates that neutral and basic pH values are not favorable for decolorization of the dye LG by the tested strains. The trend of pH dependence on decolorization was similar to that observed in cultures of F. trogii immobilized into Ca-alginate beads for the dye RB5 (Mazmanci and Unyayar, 2010). Therefore, optimum pH for dye decolorization depends on the fungus and its enzymatic system, as well as on the nature of the dye under consideration. Most
Table 4 Effect of inoculum size (beads/medium) on dye removal using different immobilized cells into alginate beads (initial concentration: 150 mg/L; pH ¼ 5.5; Temperature: 40 C; agitation: 150 rpm) with their 95% confidence limits; (*): Mean SD (n ¼ 3). Beads/medium ratio (w/v)
Average value of color removal (%)
5% 10% 20% 30% 40%
22.5 46.4 59 52.2 39.6
C. gallica 24 h
B. adusta 48 h
0.7 1.8 2.4 0.9 1.1
38.6 71 75.6 57.7 46.8
2.4 3.2 0.4 0.7 2.3
72 h
24 h
48.2 1.5 80.6 0.9 88.72.1 62.3 3.4 58.7 1.4
19.6 38.1 42.4 49.4 30.02
T. versicolor 48 h
0.7 1.7 0.8 1.4 4.1
34.3 48.7 54.7 57.2 38.5
72 h
1.2 0.9 1.6 0.7 0.4
46.6 67.3 89.3 68.1 45.2
24 h
1. 3.4 0.8 0.5 2.2
28.3 35.5 38.7 41.2 52.3
T. trogii 48 h
1.2 4.1 2.6 0.7 0.9
48.2 65.2 69.3 55.3 59.3
72 h
0.8 0.4 0.9 3.5 2.4
55.9 76.4 82.1 66.2 63.8
24 h
2.4 0.4 0.4 1.1 0.9
18.3 53.6 64.5 42.3 43.1
48 h
2.6 0.7 1.6 0.9 0.4
51.6 71.2 75.5 70.2 64.2
72 h
0.8 1.8 0.5 3.5 2.4
58.2 77.3 81.3 75.7 66.5
1.5 2.1 0.5 0.8 1.5
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
A Decolorizaon (%)
81.3% were obtained for C. gallica, B. adusta, T. versicolor and T. trogii, respectively after 72 h of incubation operating at a beads/medium ratio of 20% (w/v), a medium pH value of 5.0 for T. versicolor and T. trogii and 6.0 for C. gallica and B. adusta, in agitated cultures (150 rpm) at 45 C for all the tested strains except for B. adusta which was at 40 C. The results also indicated that laccase was the main ligninolytic enzyme involved in the breakdown of the metal complex dye LG. This study suggests the possibility to decolorize a high concentration of LG (200 mg/L) and the immobilized cells can be re-utilized. This could be a great advance in the treatment of metal dye-containing wastewater and the method may have a potential application in continuous systems, especially to treat wastewater from the textile industry.
immobilized fungus
100
free fungus
80 60 40 20 0 C. gallica
B. adusta
T. versicolor
T. trogii
White-rot fungi
B
immobilized fungus
Decolorizaon (%)
100
free fungus
80 60 40 20 0 C. gallica
B. adusta
T. versicolor
T. trogii
White-rot fungi
C
immobilized fungus
100
free fungus
80 60 40 20 0 C. gallica
331
B. adusta
T. versicolor
T. trogii
White-rot fungi Fig. 5. Successive decolorization batches by different Ca-alginate immobilized fungi and free fungi (initial concentration of Lanaset Grey G: 150 mg/L; beads/medium ratio: 20% (w/v), agitation: 150 rpm; pH: 5.5; temperature: 40 C). Each batch lasted 24 h.
4. Conclusions Results obtained from this work showed that the immobilization of fungi into Ca-alginate beads enhanced the decolorization of the metal textile dye LG as compared to free fungal cultures. Maximum decolorization percentages of 88.7%, 89.3%, 82.1% and
References Abdel-Razek, A.S., 2011. Removal of chromium ions from liquid waste solutions using immobilized Cunninghamella elegans. Nat. Sci. 9, 211e219. Ahmadi, M., Vahabzadeh, F., Bonakdarpour, B., Mehranian, M., 2006. Empirical modeling of olive oil mill wastewater treatment using loofa-immobilized Phanerochaete chrysosporium. Process. Biochem. 41, 1148e1154. Arica, M.Y., Bayramoglu, G., Yilmaz, M., Bektas, S., Genç, O., 2004. Biosorption of Hg2þ, Cd2þ, and Zn2þ by Ca-alginate and immobilized wood-rotting fungus Funalia trogii. J. Hazard. Mater. B109, 191e199. Baccar, R., Blánquez, P., Bouzid, J., Feki, M., Attiya, H., Sarrà, M., 2011. Decolorization of a tannery dye: from fungal screening to bioreactor application. Biochem. Eng. J. 56, 184e189. Baldrian, P., Snajdr, J., 2006. Production of ligninolytic enzymes by litterdecomposing fungi and their ability to decolorize synthetic dyes. Enzym. Microb. Technol. 39, 1023e1029. Balu, B., Radha, K.V., 2009. Kinetic study on decolourization of the dye Acid Orange using the fungus Phanerochate chrysosporium. Mod. Appl. Sci. 3, 38e47. Banat, I.M., Nigam, P., Singh, D., Marchant, R., 1996. Microbial decolourization of textile dyes containing effluents: a review. Bioresour. Technol. 58, 217e227. Blánquez, P., Caminal, G., Sarrà, M., Vicent, T., 2007. The effect of HRT on the decolourisation of the Grey Lanaset G textile dye by Trametes versicolor. Chem. Eng. J. 126, 163e169. Blánquez, P., Casas, N., Font, X., Gabarrell, X., Sarra, M., Caminal, G., Vicent, T., 2004. Mechanism of textile metal dye biotransformation by Trametes versicolor. Water Res. 38, 2166e2172. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteinedye binding. Anal. Biochem. 72, 248e254. Cha, C.J., Doerge, R.D., Cerniglia, C.E., 2001. Biotransformation of malachite green by the fungus Cunninghamella elegans. Appl. Environ. Microbiol. 67, 4358e4360. Chen, B.Y., Yen, C.Y., Chen, W.M., Chang, C.T., Wang, C.T., Hu, Y.C., 2009. Exploring threshold operation criteria of biostimulation for azo dye decolourization using immobilized cell systems. Bioresour. Technol. 100, 5763e5770. Clarke, E.A., Anliker, R., 1980. Organic dyes and pigments. In: Hutzinger, O. (Ed.), Anthropogenic Compounds, The Handbook of Environmental Chemistry, vol. 3, Part A. Springer-Verlag, New York, pp. 181e215. Dominguez, A., Rodriguez-Couto, S., Sanroman, M.A., 2005. Dye decolorization by Trametes hirsuta immobilized into alginate beads. World J. Microbiol. Biotechnol. 21, 405e409. Dos Santos, A.B., Bisschops, I.A.E., Cervantes, F.J., Van Lier, J.B., 2004. Effect of different redox mediators during thermophilic azo dye reduction by anaerobic granular sludge and comparative study between mesophilic (30 C) and thermophilic (55 C) treatments for decolourisation of textile wastewaters. Chemosphere 55, 1149e1157. Enayatzamir, K., Alikhani, H.A., Yakhchali, B., Tabandeh, F., Rodríguez-Couto, S., 2010. Decolouration of azo dyes by Phanerochaete chrysosporium immobilised into alginate beads. Environ. Sci. Pollut. Res. 17, 145e153. Gabarrell, X., Font, M., Vicent, T., Caminal, G., Sarrà, M., Blánquez, P., 2012. A comparative life cycle assessment of two treatment technologies for the Grey Lanaset G textile dye: biodegradation by Trametes versicolor and granular activated carbon adsorption. Int. J. Life Cycle Assess. 17, 613e624. Gao, Q.T., Wong, Y.S., Tam, N.F.Y., 2011. Removal and biodegradation of nonylphenol by immobilized Chlorella vulgaris. Bioresour. Technol. 102, 30e38. Gerbsch, N., Buchholz, R., 1995. New processes and actual trends in biotechnology. FEMS Microbiol. Rev. 16, 259e269. Goodell, B., Qian, Y., Jellison, J., Richard, M., 2004. Decolorization and degradation of dyes with mediated Fenton reaction. Water Environ. Res. 76, 2703e2707. Hammel, K.E., Kapich, A.N., Jensen, K.A., Ryan, Z.C., 2002. Reactive oxygen species as agents of wood decay by fungi. Enzym. Microb. Technol. 30, 445e453. Jadhav, S.U., Kalme, S.D., Govindwar, S.P., 2008. Biodegradation of methyl red by Galactomyces geotrichum MTCC 1360. Int. Biodeterior. Biodegrad. 62, 135e142. Kanu, O.K., Ijeoma, O.K., Achi, O.K., 2011. Industrial effluents and their impact on water quality of receiving rivers in Nigeria. J. Appl. Technol. Environ. Sanit. 1, 75e86. Katzbauer, B., Narodoslawsky, B., Moser, A., 1995. Classification system for immobilization techniques. Bioprocess Eng. 12, 173e179.
332
D. Daâssi et al. / Journal of Environmental Management 129 (2013) 324e332
Knapp, J.S., Vantoch-Wood, E.J., Zhang, F., 2001. Use of Wood-rotting fungi for the decolourization of dyes and industrial effluents. In: Gadd, G.M. (Ed.), Fungi in Bioremediation. Cambridge University Press, Cambridge, pp. 253e261. Kourkoutas, Y., Bekatorou, A., Banat, I.M., Marchant, R., Koutinas, A.A., 2004. Immobilization technologies and support materials suitable in alcohol beverages production: a review. Food Microbiol. 21, 377e397. Laca, A., García, L.A., Díaz, M., 2000. Analysis and description of the evolution of alginate immobilised cells systems. J. Biotechnol. 80, 203e215. Mazmanci, M.A., Unyayar, A., 2010. Decolourization efficiency of Funalia trogii under static condition: effect of C: N ratios. Afr. J. Biotechnol. 9, 6539e6544. Moutaouakkil, A., Blaghen, M., 2011. Decolourization of the anthraquinone dye Cibacron Blue 3G-A with immobilized Coprinus cinereus in fluidized bed bioreactor. Prikl. Biokhim. Mikrobiol. 47, 66e72. Novotny, C., Svobodova, K., Erbanova, P., Cajthaml, T., Kasinath, A., Lang, E., Sasek, V., 2004. Ligninolytic fungi in bioremediation: extracellular enzyme production and degradation rate. Soil Biol. Biochem. 36, 1545e1551. Park, C., Lee, M., Lee, B., Kim, S.W., Chase, H.A., Lee, J., Kim, S., 2007. Biodegradation and biosorption for decolorization of synthetic dyes by Funalia trogii. Biochem. Eng. J. 36, 59e65. ski, A., Crawford, R.L., Huynh, V.B., 1988. Manganese peroxidase of PhaPaszczyn nerochaete chrysosporium: purification. Meth. Enzymol. 161, 264e270. Rocher, V., Bee, A., Siaugue, J.M., Cabuil, V., 2010. Dye removal from aqueous solution by magnetic alginate beads crosslinked with epichlorohydrin. J. Hazard. Mater. 178, 434e439. Rodríguez-Couto, S., 2009. Dye removal by immobilised fungi. Biotechnol. Adv. 27, 227e235. Shin, M., Nguyen, T., Ramsay, J., 2002. Evaluation of support materials for the surface immobilization and decoloration of amaranth by Trametes versicolor. Appl. Microbiol. Biotechnol. 60, 218e223.
Swamy, J., Ramsay, J.A., 1999. The evaluation of white rot fungi in the decolouration of textile dyes. Enzym. Microb. Technol. 24, 130e137. Szalinska, E., Dominik, J., Vignati, D.A.L., Bobrowski, A., Bas, B., 2010. Seasonal transport pattern of chromium (III and VI) in a stream receiving wastewater from tanneries. Appl. Geochem. 25, 116e122. Thongchul, N., Yang, S.T., 2003. Controlling filamentous fungal morphology by immobilization on a rotating fibrous matrix to enhance oxygen transfer and L(þ)-lactic acid production by Rhizopus oryzae. Ferment. Biotechnol. ACS SYM SER 862, 36e51. Tien, M., Kirk, T.K., 1984. Lignin-degrading enzyme from Phanerochaete chrysosporium: purification, characterization, and catalytic properties of a unique H2O2-requiring oxygenase. Proc. Natl. Acad. Sci. U.S.A. 81, 2280e2284. Vaithanomsat, P., Apiwatanapiwat, W., Petchoy, O., Chedchant, J., 2010. Decolorization of reactive dye by white-rot fungus Datronia sp. KAPI0039. Kasetsart J. (Nat. Sci.) 44, 879e890. Wang, X., Sato, T., Xing, B., Tao, S., 2005. Health risks of heavy metals to the general public in Tianjin, China via consumption of vegetables and fish. Sci. Total. Environ. 350, 28e37. Wesenberg, D., Kyriakides, I., Agathos, S.N., 2003. White-rot fungi and their enzymes for the treatment of industrial dye effluents. Biotechnol. Adv. 22, 161e187. Yaropolov, A.I., Skorobogatko, O.V., Vartanov, S.S., Varfolomeyev, S.D., 1994. Laccaseproperties, catalytic mechanism, and applicability. Appl. Biochem. Biotechnol. 49, 257e280. Znidarsi c, P., Pavko, A., 2001. The morphology of filamentous fungi in submerged cultivations as a bioprocess parameter. Food Technol. Biotechnol. 39, 237e252. Zouari-Mechichi, H., Mechichi, T., Dhouib, A., Sayadi, S., Martínez, A.T., Martínez, M.J., 2006. Laccase purification and characterization from Trametes trogii isolated in Tunisia: decolourization of textile dyes by the purified enzyme. Enzym. Microb. Technol. 39, 141e148.