- Email: [email protected]
Decreased IL-35 levels in patients with immune thrombocytopenia
Human Immunology 75 (2014) 909–913
Contents lists available at ScienceDirect
www.ashi-hla.org
journal homepage: www.elsevier.com/locate/humimm
Decreased IL-35 levels in patients with immune thrombocytopenia Yanhui Yang a,b, Min Xuan a, Xian Zhang a, Donglei Zhang a, Rongfeng Fu a, Fangfang Zhou a, Li Ma a, Huiyuan Li a, Feng Xue a, Lei Zhang a, Renchi Yang a,⇑ a
Institute of Hematology and Hospital of Blood Diseases, Chinese Academy of Medical Sciences & Peking Union Medical College, 288 Nanjing Road, Tianjin 300020, China 2011 Collaborative Innovation Center of Tianjin for Medical Epigenetics, Key Laboratory of Hormones and Development (Ministry of Health), Metabolic Diseases Hospital & Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin 300070, China b
a r t i c l e
i n f o
Article history: Received 4 October 2013 Accepted 23 June 2014 Available online 30 June 2014 Keywords: ITP IL-35 p35 ELISA Real-time quantitative polymerase chain reaction
a b s t r a c t IL-35 is a novel heterodimeric anti-inflammatory cytokine consisting of Epstein–Barr virus-induced gene 3 (EBI3) and the p35 subunit of IL-12. IL-35 has been shown to possess the potency of inhibiting the CD4+ effector T cells and alleviating autoimmune diseases. In the study we investigated the levels of IL-35 as well as its prospective role in immune thrombocytopenia (ITP).ELISA was adopted to measure plasma IL-35, TGF-b and IL-10 levels. The mRNA expression levels of P35 and EBI3 in peripheral blood mononuclear cells (PBMCs) were studied based on real-time quantitative PCR. The correlation between plasma cytokine levels and clinical parameters was analyzed. Significantly lower plasma IL-35 levels were found in active ITP patients compared with those in remission (p = 0.017) and the healthy controls (p < 0.001). In active ITP patients, the plasma IL-35 levels displayed a significantly positive correlation with platelet counts (r = 0.5335, p < 0.0008). Further, P35 mRNA expression levels were lower in patients with active ITP than patients in remission (p = 0.033) and normal controls (p = 0.016).Thus, for the first time, this research reported a dramatically decreased IL-35 levels in ITP patients, suggesting that IL-35 may be involved in the pathogenesis of ITP. Ó 2014 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
1. Introduction Primary immune thrombocytopenia (ITP) is an autoimmune disease with complex dysregulation of the immune system. It was initially identified as a bleeding disorder mediated by the plasma antibodies targeting platelet autoantigens [1]. Typically, the premature platelets are destroyed through the antibody dependent cell-mediated cytotoxicity (ADCC) effect in the reticuloendothelial systems. In addition, cell-mediated autoimmunity is also involved in the pathogenesis of ITP. It was reported that cytotoxic T cells were involved in the platelet destruction in patients with no detectable antiplatelet antibodies [2]. Further studies with a mouse model of ITP confirmed that antibody and cell-mediated mechanism exist and only the antibody-mediated form responded effectively to intravenous gammaglobulin (IVIg) treatment [3]. In addition, Megakaryocyte destruction [4], Th1 cell and Tc1 cell polarization [5–7] and complement mediated platelet lysis [8] were also related to the pathogenesis of ITP.
⇑ Corresponding author. Fax: +86 22 27230108. E-mail address: [email protected] (R. Yang).
Recent evidences showed that active ITP patients had a peripheral deficiency of regulatory T cells (Tregs). Tregs are a special subset of CD4+ T cells and play crucial roles in maintaining selftolerance by inhibiting the activity of other cells. Our previous study showed that the percentage of Tregs was significantly decreased and the suppressive function of Tregs was impaired in active ITP patients [9], which was further confirmed by subsequent studies [10–12]. Based on derivation, Tregs are classified into naturally occurring Tregs (nTregs) and induced regulatory T cells (iTr cells) [13]. nTregs derive from thymus and are essential for immune homeostasis. Particularly, nTregs could convert non-Tregs into suppressive cells, a process named ‘infectious tolerance’ [14]. iTr cells are mainly generated in periphery from conventional CD4+Foxp3 T cells (Tconv cells) and traditionally include IL-10 induced Tregs and TGF-b induced Tregs [15–17]. Recently, a newly identified cytokine IL-35, has been confirmed to convert Tconv cells to iTr Cells (iTr35 cells) [18]. IL-35 is a heterodimeric cytokine including the p35 subunit of IL-12 and the Epstein-Barr virus (EBV)-induced gene 3 (EBI-3) subunit of IL-27 and classified as a new member of the IL-12 family [19]. In addition to human activated (anti-CD3/CD28 induced) Treg cells, placental trophoblast cells, activated dendritic cells and macrophages also produce
http://dx.doi.org/10.1016/j.humimm.2014.06.019 0198-8859/Ó 2014 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
910
Y. Yang et al. / Human Immunology 75 (2014) 909–913
IL-35 [18,20–22]. In contrast to the proinflammatory effect of other cytokines of the IL-12 family (IL-12, IL-23), IL-35 potently inhibits the CD4+ effector T cells (Teff cells, including Th1, Th2, Th17) and alleviates inflammatory and autoimmune diseases [23–25]. Up to now, the level of plasma IL-35 and its potential role in ITP are unclear. In this study, we sought to investigate the plasma levels of Tregs-related cytokines (IL-35, IL-10 and TGF-b) and its clinical relevance in patients with ITP. Furthermore, p35 and EBI-3 mRNA levels in peripheral blood mononuclear cells (PBMCs) were quantified.
2. Materials and methods 2.1. Patients Fifty-six adults primary ITP patients (42 females and 14 males, median age 40 years, range 16–78 years) diagnosed and treated in our hospital were enrolled into this study. The diagnosis was complied with the criteria reported previously [26] and patients with comorbidities such as diabetes, cardiovascular diseases, active infection or secondary to other diseases such as systemic lupus erythematosus were excluded. Active ITP was defined as platelet count below 100 109/L accompanying with or without bleeding episode. Complete remission (CR) was defined as platelet count over 100 109/L and having no bleeding episode [26,27]. Among all the ITP patients, 36 patients had active ITP and 20 patients were in CR. We further divided the active patients into two subgroups, treated and untreated, the latter was defined as without any glucocorticoid and/or other immunosuppressive therapy for at least 1 month before sampling. The clinical characteristics of all patients were shown in Tables 1 and 2. Thirty healthy age-matched volunteers were enrolled as control group (19 females and 11 males, median age 43 years). Informed consents were obtained from all the patients and controls. This study was approved by the hospital based ethic committee and in accordance with the Helsinki Declaration.
Table 2 Clinical characteristics of ITP patients in remission. Patient
Sex
Age (years)
Course of disease (months)
Platelet (109/L)
Major therapy
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Median (range)
F M F F F F M F F M F F M F M F F F F M
40 26 55 42 31 68 64 24 64 17 46 34 74 33 21 56 74 27 64 23 37 17–74
16 18 0.5 2 48 13 25 13 0 2.5 0 12 6 12 0 22 240 9 35 80 12.5 0–240
208 103 219 262 114 136 110 192 260 144 162 312 245 335 122 218 248 219 280 225 218.5 103–335
DNZ GC GC, IVIg DNZ GC GC GC,SP GC GC, IVIg GC, DNZ GC, IVIg N N N GC N DNZ N GC GC
ITP, immune thrombocytopenia; GC, glucocorticoid; IVIg, intravenous immunoglobulin; SP, splenectomy; DNZ, Danazol; N, none.
2.3. IL-35, TGF-b and IL-10 enzyme-linked immunosorbent assay Plasma IL-35 levels were measured using enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturer’s instructions (USCNLIFE, Missouri City, TX), TGF-b1 and IL-10 were measured using ELISA kits according to the manufacturer’s instructions (NeoBioscience Technology, Shenzhen, PR China).The minimum detectable dose of IL-35, TGF-b1 and IL-10 were less than 5.6 pg/ml, 15 pg/ml and 1 pg/ml separately. The intra-assay and inter-assay precision of variation were <8%, <8% and <10% respectively.
2.2. Plasma and peripheral blood mononuclear cell preparation Plasma was obtained from all the study subjects by centrifugation of EDTA anticoagulant venous blood and stored at 80 °C until examination. PBMCs were isolated using Ficoll-Hypaque density gradient centrifugation at 2000 rpm for 20 min at 20 °C and stored at 80 °C in aliquots. Table 1 Clinical characteristics of active ITP patients. Total (n) Males (n) Females (n) Age (years (median, range)) Course of disease (months (median, range)) Newly diagnosis Persistent Chronic Platelet counts (109/L (median, range)) Untreated (n) Treated (n) Treatments GC GC, IVIG GC, DNZ GC, SP DNZ GC, VCR
36 8 28 36 (16–78) 6 (0–360) 9 7 20 22 (1–84) 19 17 5 3 4 1 3 1
n, number; ITP, immune thrombocytopenia; GC, glucocorticoid; IVIg, intravenous immunoglobulin; SP, splenectomy; DNZ, Danazol; VCR, Vincristine.
2.4. RNA isolation and real-time quantitative polymerase chain reaction Total RNAs were isolated from PBMCs using TRizol reagent (Invitrogen life technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. Two micrograms RNA was reverse transcribed to cDNA and amplified for IL-12a and EBI3. b-Actin was used as endogenous control. Real-time PCR was performed by an ABI-7900 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using SYBR Green (Applied Biosystems, Foster City, CA, USA) as a double-stand DNA-specific binding dye. The PCR reaction conditions were as follows: 40 cycles of three steps (95 °C for 15 s, 60 °C for 15 s, 72 °C for 35 s) after initial denaturation (95 °C for 15 min). The sequences of primers were shown in Table 3. The relative quantity of target mRNA expression was calculated by comparative Ct method using the equation: relative quantity = 2 DDCt.
Table 3 Primers for real-time PCR. Gene
Forward sequence
Reverse sequence
P35 EBI3 b-Actin
TCCTCCCTTGAAGAACCGGA TCCTTCATTGCCACGTACAG GGCACCCAGCACAATGAAG
TGACAACGGTTTGGAGGGAC GCTCTGTTATGAAAGGCACG CGTCATACTCCTGCTTGCTG
Y. Yang et al. / Human Immunology 75 (2014) 909–913
2.5. Statistical analysis The SPSS version 16.0 software (SPSS, Chicago, IL, USA) was used for statistical analysis. Results were described as median and range. The plasma cytokine levels and mRNA expression levels were analyzed by nonparametric statistic analysis Mann–Whitney U test. Correlation between plasma cytokine levels and clinical data was determined by Spearman’s correlation coefficient. p < 0.05 was considered statistically significant. 3. Results 3.1. Decreased plasma IL-35 levels in ITP patients Plasma IL-35 levels were determined in all enrolled patients and controls. As shown in Fig. 1A, active ITP patients had significantly lower plasma IL-35 levels (median: 8.14 pg/ml, range: 3.12– 88.24 pg/ml) than those of normal controls (median: 168.47 pg/ ml, range: 21.66–665.24 pg/ml, p < 0.001). Furthermore, plasma IL-35 levels in active ITP patients were lower than those of patients in remission (median: 20.31 pg/ml, range: 4.02–215.86 pg/ml, p = 0.017), but the patients in remission still had lower plasma IL-35 levels compare to normal controls (p < 0.001). Among the active ITP patients, no difference was found between untreated and treated patients (Fig. 1B).
911
Fig. 1C). In the remission group, no correlation was found between the plasma IL-35 levels and platelet counts (r = 0.07, p = 0.9761). Plasma IL-35 levels did not correlate with age, sex, and course of disease (data not shown). 3.3. Concentration of plasma TGF-b and IL-10 in ITP patients and controls We also determined other cytokines mainly produced by Treg cells, such as TGF-b and IL-10. As shown in Fig. 2 A, the active ITP patients had lower plasma TGF-b levels (median: 670.81 pg/ ml, range: 52.71–8853.82 pg/ml) than those of patients in remission (median: 7481.96 pg/ml, range: 488.59–23539.53 pg/ml, p < 0.001) and controls (median: 7833.92 pg/ml, range: 192.72– 23381.89 pg/ml, p < 0.001). Interestingly, the plasma TGF-b levels in untreated active ITP patients were much lower than the treated active ITP patients (p < 0.001, Fig. 2B). However, it had no correlation with platelet counts. The plasma levels of IL-10 in active ITP patients (median: 5.12 pg/ml, range: 1.18–25.67 pg/ml) and patients in remission (median: 3.95 pg/ml, range: 1.75–27.01 pg/ml) were higher than controls (median: 1.75 pg/ml, range: 1.23–15.11 pg/ml, p < 0.001) but there was no difference between patients with active ITP and ITP in remission (Fig. 2C). The plasma IL-10 levels also had no correlation with platelet counts (data not shown).
3.2. Correlation between plasma IL-35 levels and clinical data
3.4. mRNA expression levels of P35 and EBI3 in ITP patients and controls
The Spearman’s correlation coefficient was performed to assess the correlation between plasma IL-35 levels and clinical data. In active ITP patients, the plasma IL-35 levels showed significantly positive correlation with platelet counts (r = 0.5335, p = 0.0008,
P35 and EBI3 mRNA expression in PBMCs was assayed in 21 active ITP patients, 15 patients in remission and 21 normal controls. The results were described as the fold change of gene expression normalized to the endogenous reference gene. As shown in
Fig. 1. Plasma IL-35 levels in ITP patients and the correlation with platelet counts. (A) Active ITP patients had lower plasma IL-35 levels than patients in remission and healthy controls. (B) Plasma IL-35 levels had no difference between untreated and treated patients. (C) Plasma IL-35 levels in active ITP patients had positive correlation with platelet counts. r, Spearman’s correlation coefficient.
Fig. 2. Plasma levels of TGF-b and IL-10 in ITP patients. (A) Active ITP patients had lower plasma TGF-b levels than patients in remission and healthy controls. (B) Plasma levels of TGF-b in untreated ITP patients were lower than treated patients. (C) Active ITP patients and patients in remission had higher plasma IL-10 levels than healthy controls.
912
Y. Yang et al. / Human Immunology 75 (2014) 909–913
Fig. 3. p35 and EBI3 mRNA expression in PBMC. (A) P35 mRNA expression levels were lower in active ITP patients than patients in remission and normal controls. (B) No significant difference of EBI3 mRNA expression was found between ITP patients and controls.
Fig. 3A, the mRNA expression levels of P35 were lower in active ITP patients than patients in remission (p = 0.033) and normal controls (p = 0.016). The P35 expression in remission group has no difference with normal controls. No difference on the EBI3 mRNA expression levels was found in three groups (Fig. 3B). 4. Discussion In this report, it was observed a dramatically decreased plasma IL-35 level in patients with ITP, compared with matched healthy controls. Meanwhile, active ITP patients proved to have lower IL-35 levels than those in remission. Particularly, plasma IL-35 concentrations were positively correlated with the platelet counts, implying that IL-35 may be a biomarker reflecting the activity of ITP and involved in the pathogenesis of this disease. Since first designated in 2007, IL-35 has drawn wide attention as an important immunosuppressive cytokines. Although IL-35 was secreted from Tregs and required of their suppressive function in mice, it played a complicated role in human. Two studies reported that human Tregs did not constitutively express IL-35 [20,22], but recent evidence supported that IL-35 was secreted by CD3/CD28 activated Tregs, converting Tconv cells into iTr cells [21]. These discrepancies might result from the timing of analysis, experimental techniques and the subjects enrolled. It should be noted that previous data on IL-35 were mainly derived from mouse models and the healthy population, so the role of IL-35 in autoimmune disease remains to be defined. Our present study indicates that in ITP, an autoimmune disease, the deficiency of IL-35 may have something to do with the dysfunction of self-tolerance that contributes to the platelet destruction. Our research and other studies revealed that peripheral Tregs were decreased and functionally defective in active ITP patients, but the reasons entailed more explorations. Semple et al. recently suggested that sequestration of functional Tregs in thymus may lead to the peripheral deficiency and IVIG treatment reversed the accumulation of Tregs in thymus, thus correcting peripheral deficiency of Tregs and increasing platelet count [10]. In some way, it is reasonable that low concentrations of IL-35 are due to the peripheral deficiency of Tregs, the major producer for this cytokine. As mentioned above, IL-35 can exert ‘infectious tolerance’ through converting Tconv cells into IL-35-secreted iTr cells. Thus, there might exist a positive feedback mechanism in the production of IL-35 and the distribution of IL-35 levels in a cohort should not be normalized. In accordance with this postulation, the concentrations of IL-35 were gathered in an extremely low level in ITP patients but in a high level in healthy controls, which hinted that the decreased Tregs in ITP patients could not trigger the cascade expanding secretion of IL-35. Some further detection was made on the plasma levels of the Tregs related cytokines, TGF-b and IL-10. TGF-b significantly
decreased in ITP patients and closely associated with the activities of disease and treatment. In contrast, IL-10 was elevated in ITP patients and didn’t bear a relation with platelet counts. Some studies have previously described the decreased levels of plasma IL-10 in ITP patients [7,28], while others revealed the increased plasma IL-10 levels in ITP patients [29,30]. Considering that IL-10 is extensively produced by sorts of cells, including B cells, Th2 cells, macrophages etc. and does not correlated with IL-2, the nonredundant cytokine for Tregs commitment [29], it holds water that Tregs may not be the major source for IL-10. Thus, it is postulated that the decreased TGF-b and IL-35 levels accounts for, at least in part, the anergy of Tregs in patients with ITP. IL-35 is a newly identified member of IL-12 cytokine family, which is constituted of 4 heterodimeric protein members including IL-12, IL-23, IL-27 and IL-35 [31]. IL-35 is composed of a P35 and an EBI-3 subunit. P35 binds with P40 to form IL-12 and EBI-3 binds with P28 to form IL-27. IL-12 is a classic pro-inflammatory cytokine with important effects on the Th1 and Th17 commitment and elevates in ITP patients [29,32,33]. Initially, IL-27 was identified as a pro-inflammatory factor but recent data supported it as an immunoregulatory cytokine that promotes Tregs commitment [34,35]. We recently identified that IL-27 was increased in active ITP patients, polarizing Th1 and Tc1 cells and stimulating the production of inflammatory cytokines [36]. Thus, the imbalance of IL-12 family member cytokines may be involved in the pathogenesis of ITP. The next step was to detect the mRNA expression of p35 and EBI-3 in PBMCs, which helped to uncover that only p35 mRNA was decreased in patients with ITP. Because IL-35 shares the P35 subunit with IL-12 and the EBI-3 subunit with IL-27, it was rarely possible to directly decide the relationship between mRNA expression and protein levels of IL-35. For quantifying mRNA levels, a better approach turns out to isolate Tregs, the major resource of IL-35. However, owing to the decrease of Tregs in ITP patients, there were not sufficient cell numbers available for real-time PCR. Thus, it could only be supposed that the decreased synthesis for p35 might result in the deficiency of IL-35. Great potential as it has, Tregs-based therapy for autoimmune diseases contains certain limitations. As to patients with ITP, antigen specific iTr can be generated in vitro [37] but the clinical application is restricted by its technical complexity. In addition, the stability and potency of the artificial Treg in vivo remains unclear. Given that IL-35 can generate potent iTr cells in vitro that maintains a stable and potent regulatory role in vivo [18], it makes sense to introduce IL-35 for the further treatment of ITP, especially for the refractory cases. Acknowledgments This work was supported in part by Grants of National Natural Science Foundation of China (81070397 and 81270581), Ministry
Y. Yang et al. / Human Immunology 75 (2014) 909–913
of Science and Technology of China (2011ZX09302-007-04), Ministry of Health of China (201202017), Tianjin Municipal Science and Technology Commission (10JCZDJC19700 and 12JCQNJC08000), PUMC Youth Fund (3332013068) and the Fundamental Research Funds for the Central Universities of China (3332013068). References [1] Semple JW. Immune pathophysiology of autoimmune thrombocytopenic purpura. Blood Rev 2002;16(1):9–12. [2] Olsson B, Andersson PO, Jernas M, Jacobsson S, Carlsson B, Carlsson LM, et al. Tcell-mediated cytotoxicity toward platelets in chronic idiopathic thrombocytopenic purpura. Nat Med 2003;9(9):1123–4. [3] Chow L, Aslam R, Speck ER, Kim M, Cridland N, Webster ML, et al. A murine model of severe immune thrombocytopenia is induced by antibody- and CD8+ T cell-mediated responses that are differentially sensitive to therapy. Blood 2010;115(6):1247–53. [4] Chang M, Nakagawa PA, Williams SA, Schwartz MR, Imfeld KL, Buzby JS, et al. Immune thrombocytopenic purpura (ITP) plasma and purified ITP monoclonal autoantibodies inhibit megakaryocytopoiesis in vitro. Blood 2003; 102(3):887–95. [5] Wang T, Zhao H, Ren H, Guo J, Xu M, Yang R, et al. Type 1 and type 2 T-cell profiles in idiopathic thrombocytopenic purpura. Haematologica 2005; 90(7):914–23. [6] Ogawara H, Handa H, Morita K, Hayakawa M, Kojima J, Amagai H, et al. High Th1/Th2 ratio in patients with chronic idiopathic thrombocytopenic purpura. Eur J Haematol 2003;71(4):283–8. [7] Panitsas FP, Theodoropoulou M, Kouraklis A, Karakantza M, Theodorou GL, Zoumbos NC, et al. Adult chronic idiopathic thrombocytopenic purpura (ITP) is the manifestation of a type-1 polarized immune response. Blood 2004; 103(7):2645–7. [8] Horstman LL, Jy W, Schultz DR, Mao WW, Ahn YS. Complement-mediated fragmentation and lysis of opsonized platelets: ender differences in sensitivity. J Lab Clin Med 1994;123(4):515–25. [9] Liu B, Zhao H, Poon MC, Han Z, Gu D, Xu M, et al. Abnormality of CD4(+)CD25(+) regulatory T cells in idiopathic thrombocytopenic purpura. Eur J Haematol 2007;78(2):139–43. [10] Aslam R, Hu Y, Gebremeskel S, Segel GB, Speck ER, Guo L, et al. Thymic retention of CD4+ CD25+ FoxP3+ T regulatory cells is associated with their peripheral deficiency and thrombocytopenia in a murine model of immune thrombocytopenia. Blood 2012;120(10):2127–32. [11] Yu J, Heck S, Patel V, Levan J, Yu Y, Bussel JB, et al. Defective circulating CD25 regulatory T cells in patients with chronic immune thrombocytopenic purpura. Blood 2008;112(4):1325–8. [12] Sakakura M, Wada H, Tawara I, Nobori T, Sugiyama T, Sagawa N, et al. Reduced Cd4+Cd25+ T cells in patients with idiopathic thrombocytopenic purpura. Thromb Res 2007;120(2):187–93. [13] Piccirillo CA, Shevach EM. Naturally-occurring CD4+CD25+ immunoregulatory T cells: central players in the arena of peripheral tolerance. Semin Immunol 2004;16(2):81–8. [14] Jonuleit H, Schmitt E, Kakirman H, Stassen M, Knop J, Enk AH. Infectious tolerance: human CD25(+) regulatory T cells convey suppressor activity to conventional CD4(+) T helper cells. J Exp Med 2002;196(2):255–60. [15] Park HB, Paik DJ, Jang E, Hong S, Youn J. Acquisition of anergic and suppressive activities in transforming growth factor-beta-costimulated CD4+ CD25 T cells. Int Immunol 2004;16(8):1203–13. [16] Yamagiwa S, Gray JD, Hashimoto S, Horwitz DA. A role for TGF-beta in the generation and expansion of CD4+CD25+ regulatory T cells from human peripheral blood. J Immunol 2001;166(12):7282–9. [17] Zheng SG, Gray JD, Ohtsuka K, Yamagiwa S, Horwitz DA. Generation ex vivo of TGF-beta-producing regulatory T cells from CD4+CD25- precursors. J Immunol 2002;169(8):4183–9. [18] Collison LW, Chaturvedi V, Henderson AL, Giacomin PR, Guy C, Bankoti J, et al. IL-35-mediated induction of a potent regulatory T cell population. Nat Immunol 2010;11(12):1093–101.
913
[19] Collison LW, Workman CJ, Kuo TT, Boyd K, Wang Y, Vignali KM, et al. The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature 2007;450(7169):566–9. [20] Bardel E, Larousserie F, Charlot-Rabiega P, Coulomb-L’Hermine A, Devergne O. Human CD4+ CD25+ Foxp3+ regulatory T cells do not constitutively express IL35. J Immunol 2008;181(10):6898–905. [21] Chaturvedi V, Collison LW, Guy CS, Workman CJ, Vignali DA. Cutting edge: human regulatory T cells require IL-35 to mediate suppression and infectious tolerance. J Immunol 2011;186(12):6661–6. [22] Allan SE, Song-Zhao GX, Abraham T, McMurchy AN, Levings MK. Inducible reprogramming of human T cells into Treg cells by a conditionally active form of FOXP3. Eur J Immunol 2008;38(12):3282–9. [23] Kochetkova I, Golden S, Holderness K, Callis G, Pascual DW. IL-35 stimulation of CD39+ regulatory T cells confers protection against collagen II-induced arthritis via the production of IL-10. J Immunol 2010;184(12):7144–53. [24] Bettini M, Castellaw AH, Lennon GP, Burton AR, Vignali DA. Prevention of autoimmune diabetes by ectopic pancreatic beta-cell expression of interleukin-35. Diabetes 2012;61(6):1519–26. [25] Niedbala W, Wei XQ, Cai B, Hueber AJ, Leung BP, McInnes IB, et al. IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol 2007;37(11):3021–9. [26] Provan D, Stasi R, Newland AC, Blanchette VS, Bolton-Maggs P, Bussel JB, et al. International consensus report on the investigation and management of primary immune thrombocytopenia. Blood 2010;115(2):168–86. [27] Rodeghiero F, Stasi R, Gernsheimer T, Michel M, Provan D, Arnold DM, et al. Standardization of terminology, definitions and outcome criteria in immune thrombocytopenic purpura of adults and children: report from an international working group. Blood 2009;113(11):2386–93. [28] Guo C, Chu X, Shi Y, He W, Li L, Wang L, et al. Correction of Th1-dominant cytokine profiles by high-dose dexamethasone in patients with chronic idiopathic thrombocytopenic purpura. J Clin Immunol 2007;27(6):557–62. [29] Rocha AM, Souza C, Rocha GA, de Melo FF, Clementino NC, Marino MC, Martins Filho OA, Queiroz DM, et al. The levels of IL-17A and of the cytokines involved in Th17 cell commitment are increased in patients with chronic immune thrombocytopenia. Haematologica 2011;96(10):1560–4. [30] Del Vecchio GC, Giordano P, Tesse R, Piacente L, Altomare M, De Mattia D. Clinical significance of serum cytokine levels and thrombopoietic markers in childhood idiopathic thrombocytopenic purpura. Blood Transfus 2012; 10(2):194–9. [31] Vignali DA, Kuchroo VK. IL-12 family cytokines: immunological playmakers. Nat Immunol 2012;13(8):722–8. [32] Germann T, Gately MK, Schoenhaut DS, Lohoff M, Mattner F, Fischer S, et al. Interleukin-12/T cell stimulating factor, a cytokine with multiple effects on T helper type 1 (Th1) but not on Th2 cells. Eur J Immunol 1993;23(8):1762–70. [33] Manetti R, Parronchi P, Giudizi MG, Piccinni MP, Maggi E, Trinchieri G, et al. Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4producing Th cells. J Exp Med 1993;177(4):1199–204. [34] Pot C, Jin H, Awasthi A, Liu SM, Lai CY, Madan R, et al. Cutting edge: IL-27 induces the transcription factor c-Maf, cytokine IL-21, and the costimulatory receptor ICOS that coordinately act together to promote differentiation of IL10-producing Tr1 cells. J Immunol 2009;183(2):797–801. [35] Wang H, Meng R, Li Z, Yang B, Liu Y, Huang F, et al. IL-27 induces the differentiation of Tr1-like cells from human naive CD4+ T cells via the phosphorylation of STAT1 and STAT3. Immunol Lett 2011;136(1):21–8. [36] Li HY, Zhang DL, Ge J, Zhou H, Qi A, Ma L, et al. Elevated interleukin-27 enhances the polarization of Th1/Tc1 cells and the production of proinflammatory cytokines in primary immune thrombocytopenia. Hum Immunol 2012;73(3):240–7. [37] Zhang XL, Peng J, Sun JZ, Liu JJ, Guo CS, Wang ZG, et al. De novo induction of platelet-specific CD4(+)CD25(+) regulatory T cells from CD4(+)CD25( ) cells in patients with idiopathic thrombocytopenic purpura. Blood 2009; 113(11):2568–77.
Contents lists available at ScienceDirect
www.ashi-hla.org
journal homepage: www.elsevier.com/locate/humimm
Decreased IL-35 levels in patients with immune thrombocytopenia Yanhui Yang a,b, Min Xuan a, Xian Zhang a, Donglei Zhang a, Rongfeng Fu a, Fangfang Zhou a, Li Ma a, Huiyuan Li a, Feng Xue a, Lei Zhang a, Renchi Yang a,⇑ a
Institute of Hematology and Hospital of Blood Diseases, Chinese Academy of Medical Sciences & Peking Union Medical College, 288 Nanjing Road, Tianjin 300020, China 2011 Collaborative Innovation Center of Tianjin for Medical Epigenetics, Key Laboratory of Hormones and Development (Ministry of Health), Metabolic Diseases Hospital & Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin 300070, China b
a r t i c l e
i n f o
Article history: Received 4 October 2013 Accepted 23 June 2014 Available online 30 June 2014 Keywords: ITP IL-35 p35 ELISA Real-time quantitative polymerase chain reaction
a b s t r a c t IL-35 is a novel heterodimeric anti-inflammatory cytokine consisting of Epstein–Barr virus-induced gene 3 (EBI3) and the p35 subunit of IL-12. IL-35 has been shown to possess the potency of inhibiting the CD4+ effector T cells and alleviating autoimmune diseases. In the study we investigated the levels of IL-35 as well as its prospective role in immune thrombocytopenia (ITP).ELISA was adopted to measure plasma IL-35, TGF-b and IL-10 levels. The mRNA expression levels of P35 and EBI3 in peripheral blood mononuclear cells (PBMCs) were studied based on real-time quantitative PCR. The correlation between plasma cytokine levels and clinical parameters was analyzed. Significantly lower plasma IL-35 levels were found in active ITP patients compared with those in remission (p = 0.017) and the healthy controls (p < 0.001). In active ITP patients, the plasma IL-35 levels displayed a significantly positive correlation with platelet counts (r = 0.5335, p < 0.0008). Further, P35 mRNA expression levels were lower in patients with active ITP than patients in remission (p = 0.033) and normal controls (p = 0.016).Thus, for the first time, this research reported a dramatically decreased IL-35 levels in ITP patients, suggesting that IL-35 may be involved in the pathogenesis of ITP. Ó 2014 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
1. Introduction Primary immune thrombocytopenia (ITP) is an autoimmune disease with complex dysregulation of the immune system. It was initially identified as a bleeding disorder mediated by the plasma antibodies targeting platelet autoantigens [1]. Typically, the premature platelets are destroyed through the antibody dependent cell-mediated cytotoxicity (ADCC) effect in the reticuloendothelial systems. In addition, cell-mediated autoimmunity is also involved in the pathogenesis of ITP. It was reported that cytotoxic T cells were involved in the platelet destruction in patients with no detectable antiplatelet antibodies [2]. Further studies with a mouse model of ITP confirmed that antibody and cell-mediated mechanism exist and only the antibody-mediated form responded effectively to intravenous gammaglobulin (IVIg) treatment [3]. In addition, Megakaryocyte destruction [4], Th1 cell and Tc1 cell polarization [5–7] and complement mediated platelet lysis [8] were also related to the pathogenesis of ITP.
⇑ Corresponding author. Fax: +86 22 27230108. E-mail address: [email protected] (R. Yang).
Recent evidences showed that active ITP patients had a peripheral deficiency of regulatory T cells (Tregs). Tregs are a special subset of CD4+ T cells and play crucial roles in maintaining selftolerance by inhibiting the activity of other cells. Our previous study showed that the percentage of Tregs was significantly decreased and the suppressive function of Tregs was impaired in active ITP patients [9], which was further confirmed by subsequent studies [10–12]. Based on derivation, Tregs are classified into naturally occurring Tregs (nTregs) and induced regulatory T cells (iTr cells) [13]. nTregs derive from thymus and are essential for immune homeostasis. Particularly, nTregs could convert non-Tregs into suppressive cells, a process named ‘infectious tolerance’ [14]. iTr cells are mainly generated in periphery from conventional CD4+Foxp3 T cells (Tconv cells) and traditionally include IL-10 induced Tregs and TGF-b induced Tregs [15–17]. Recently, a newly identified cytokine IL-35, has been confirmed to convert Tconv cells to iTr Cells (iTr35 cells) [18]. IL-35 is a heterodimeric cytokine including the p35 subunit of IL-12 and the Epstein-Barr virus (EBV)-induced gene 3 (EBI-3) subunit of IL-27 and classified as a new member of the IL-12 family [19]. In addition to human activated (anti-CD3/CD28 induced) Treg cells, placental trophoblast cells, activated dendritic cells and macrophages also produce
http://dx.doi.org/10.1016/j.humimm.2014.06.019 0198-8859/Ó 2014 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
910
Y. Yang et al. / Human Immunology 75 (2014) 909–913
IL-35 [18,20–22]. In contrast to the proinflammatory effect of other cytokines of the IL-12 family (IL-12, IL-23), IL-35 potently inhibits the CD4+ effector T cells (Teff cells, including Th1, Th2, Th17) and alleviates inflammatory and autoimmune diseases [23–25]. Up to now, the level of plasma IL-35 and its potential role in ITP are unclear. In this study, we sought to investigate the plasma levels of Tregs-related cytokines (IL-35, IL-10 and TGF-b) and its clinical relevance in patients with ITP. Furthermore, p35 and EBI-3 mRNA levels in peripheral blood mononuclear cells (PBMCs) were quantified.
2. Materials and methods 2.1. Patients Fifty-six adults primary ITP patients (42 females and 14 males, median age 40 years, range 16–78 years) diagnosed and treated in our hospital were enrolled into this study. The diagnosis was complied with the criteria reported previously [26] and patients with comorbidities such as diabetes, cardiovascular diseases, active infection or secondary to other diseases such as systemic lupus erythematosus were excluded. Active ITP was defined as platelet count below 100 109/L accompanying with or without bleeding episode. Complete remission (CR) was defined as platelet count over 100 109/L and having no bleeding episode [26,27]. Among all the ITP patients, 36 patients had active ITP and 20 patients were in CR. We further divided the active patients into two subgroups, treated and untreated, the latter was defined as without any glucocorticoid and/or other immunosuppressive therapy for at least 1 month before sampling. The clinical characteristics of all patients were shown in Tables 1 and 2. Thirty healthy age-matched volunteers were enrolled as control group (19 females and 11 males, median age 43 years). Informed consents were obtained from all the patients and controls. This study was approved by the hospital based ethic committee and in accordance with the Helsinki Declaration.
Table 2 Clinical characteristics of ITP patients in remission. Patient
Sex
Age (years)
Course of disease (months)
Platelet (109/L)
Major therapy
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Median (range)
F M F F F F M F F M F F M F M F F F F M
40 26 55 42 31 68 64 24 64 17 46 34 74 33 21 56 74 27 64 23 37 17–74
16 18 0.5 2 48 13 25 13 0 2.5 0 12 6 12 0 22 240 9 35 80 12.5 0–240
208 103 219 262 114 136 110 192 260 144 162 312 245 335 122 218 248 219 280 225 218.5 103–335
DNZ GC GC, IVIg DNZ GC GC GC,SP GC GC, IVIg GC, DNZ GC, IVIg N N N GC N DNZ N GC GC
ITP, immune thrombocytopenia; GC, glucocorticoid; IVIg, intravenous immunoglobulin; SP, splenectomy; DNZ, Danazol; N, none.
2.3. IL-35, TGF-b and IL-10 enzyme-linked immunosorbent assay Plasma IL-35 levels were measured using enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturer’s instructions (USCNLIFE, Missouri City, TX), TGF-b1 and IL-10 were measured using ELISA kits according to the manufacturer’s instructions (NeoBioscience Technology, Shenzhen, PR China).The minimum detectable dose of IL-35, TGF-b1 and IL-10 were less than 5.6 pg/ml, 15 pg/ml and 1 pg/ml separately. The intra-assay and inter-assay precision of variation were <8%, <8% and <10% respectively.
2.2. Plasma and peripheral blood mononuclear cell preparation Plasma was obtained from all the study subjects by centrifugation of EDTA anticoagulant venous blood and stored at 80 °C until examination. PBMCs were isolated using Ficoll-Hypaque density gradient centrifugation at 2000 rpm for 20 min at 20 °C and stored at 80 °C in aliquots. Table 1 Clinical characteristics of active ITP patients. Total (n) Males (n) Females (n) Age (years (median, range)) Course of disease (months (median, range)) Newly diagnosis Persistent Chronic Platelet counts (109/L (median, range)) Untreated (n) Treated (n) Treatments GC GC, IVIG GC, DNZ GC, SP DNZ GC, VCR
36 8 28 36 (16–78) 6 (0–360) 9 7 20 22 (1–84) 19 17 5 3 4 1 3 1
n, number; ITP, immune thrombocytopenia; GC, glucocorticoid; IVIg, intravenous immunoglobulin; SP, splenectomy; DNZ, Danazol; VCR, Vincristine.
2.4. RNA isolation and real-time quantitative polymerase chain reaction Total RNAs were isolated from PBMCs using TRizol reagent (Invitrogen life technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. Two micrograms RNA was reverse transcribed to cDNA and amplified for IL-12a and EBI3. b-Actin was used as endogenous control. Real-time PCR was performed by an ABI-7900 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using SYBR Green (Applied Biosystems, Foster City, CA, USA) as a double-stand DNA-specific binding dye. The PCR reaction conditions were as follows: 40 cycles of three steps (95 °C for 15 s, 60 °C for 15 s, 72 °C for 35 s) after initial denaturation (95 °C for 15 min). The sequences of primers were shown in Table 3. The relative quantity of target mRNA expression was calculated by comparative Ct method using the equation: relative quantity = 2 DDCt.
Table 3 Primers for real-time PCR. Gene
Forward sequence
Reverse sequence
P35 EBI3 b-Actin
TCCTCCCTTGAAGAACCGGA TCCTTCATTGCCACGTACAG GGCACCCAGCACAATGAAG
TGACAACGGTTTGGAGGGAC GCTCTGTTATGAAAGGCACG CGTCATACTCCTGCTTGCTG
Y. Yang et al. / Human Immunology 75 (2014) 909–913
2.5. Statistical analysis The SPSS version 16.0 software (SPSS, Chicago, IL, USA) was used for statistical analysis. Results were described as median and range. The plasma cytokine levels and mRNA expression levels were analyzed by nonparametric statistic analysis Mann–Whitney U test. Correlation between plasma cytokine levels and clinical data was determined by Spearman’s correlation coefficient. p < 0.05 was considered statistically significant. 3. Results 3.1. Decreased plasma IL-35 levels in ITP patients Plasma IL-35 levels were determined in all enrolled patients and controls. As shown in Fig. 1A, active ITP patients had significantly lower plasma IL-35 levels (median: 8.14 pg/ml, range: 3.12– 88.24 pg/ml) than those of normal controls (median: 168.47 pg/ ml, range: 21.66–665.24 pg/ml, p < 0.001). Furthermore, plasma IL-35 levels in active ITP patients were lower than those of patients in remission (median: 20.31 pg/ml, range: 4.02–215.86 pg/ml, p = 0.017), but the patients in remission still had lower plasma IL-35 levels compare to normal controls (p < 0.001). Among the active ITP patients, no difference was found between untreated and treated patients (Fig. 1B).
911
Fig. 1C). In the remission group, no correlation was found between the plasma IL-35 levels and platelet counts (r = 0.07, p = 0.9761). Plasma IL-35 levels did not correlate with age, sex, and course of disease (data not shown). 3.3. Concentration of plasma TGF-b and IL-10 in ITP patients and controls We also determined other cytokines mainly produced by Treg cells, such as TGF-b and IL-10. As shown in Fig. 2 A, the active ITP patients had lower plasma TGF-b levels (median: 670.81 pg/ ml, range: 52.71–8853.82 pg/ml) than those of patients in remission (median: 7481.96 pg/ml, range: 488.59–23539.53 pg/ml, p < 0.001) and controls (median: 7833.92 pg/ml, range: 192.72– 23381.89 pg/ml, p < 0.001). Interestingly, the plasma TGF-b levels in untreated active ITP patients were much lower than the treated active ITP patients (p < 0.001, Fig. 2B). However, it had no correlation with platelet counts. The plasma levels of IL-10 in active ITP patients (median: 5.12 pg/ml, range: 1.18–25.67 pg/ml) and patients in remission (median: 3.95 pg/ml, range: 1.75–27.01 pg/ml) were higher than controls (median: 1.75 pg/ml, range: 1.23–15.11 pg/ml, p < 0.001) but there was no difference between patients with active ITP and ITP in remission (Fig. 2C). The plasma IL-10 levels also had no correlation with platelet counts (data not shown).
3.2. Correlation between plasma IL-35 levels and clinical data
3.4. mRNA expression levels of P35 and EBI3 in ITP patients and controls
The Spearman’s correlation coefficient was performed to assess the correlation between plasma IL-35 levels and clinical data. In active ITP patients, the plasma IL-35 levels showed significantly positive correlation with platelet counts (r = 0.5335, p = 0.0008,
P35 and EBI3 mRNA expression in PBMCs was assayed in 21 active ITP patients, 15 patients in remission and 21 normal controls. The results were described as the fold change of gene expression normalized to the endogenous reference gene. As shown in
Fig. 1. Plasma IL-35 levels in ITP patients and the correlation with platelet counts. (A) Active ITP patients had lower plasma IL-35 levels than patients in remission and healthy controls. (B) Plasma IL-35 levels had no difference between untreated and treated patients. (C) Plasma IL-35 levels in active ITP patients had positive correlation with platelet counts. r, Spearman’s correlation coefficient.
Fig. 2. Plasma levels of TGF-b and IL-10 in ITP patients. (A) Active ITP patients had lower plasma TGF-b levels than patients in remission and healthy controls. (B) Plasma levels of TGF-b in untreated ITP patients were lower than treated patients. (C) Active ITP patients and patients in remission had higher plasma IL-10 levels than healthy controls.
912
Y. Yang et al. / Human Immunology 75 (2014) 909–913
Fig. 3. p35 and EBI3 mRNA expression in PBMC. (A) P35 mRNA expression levels were lower in active ITP patients than patients in remission and normal controls. (B) No significant difference of EBI3 mRNA expression was found between ITP patients and controls.
Fig. 3A, the mRNA expression levels of P35 were lower in active ITP patients than patients in remission (p = 0.033) and normal controls (p = 0.016). The P35 expression in remission group has no difference with normal controls. No difference on the EBI3 mRNA expression levels was found in three groups (Fig. 3B). 4. Discussion In this report, it was observed a dramatically decreased plasma IL-35 level in patients with ITP, compared with matched healthy controls. Meanwhile, active ITP patients proved to have lower IL-35 levels than those in remission. Particularly, plasma IL-35 concentrations were positively correlated with the platelet counts, implying that IL-35 may be a biomarker reflecting the activity of ITP and involved in the pathogenesis of this disease. Since first designated in 2007, IL-35 has drawn wide attention as an important immunosuppressive cytokines. Although IL-35 was secreted from Tregs and required of their suppressive function in mice, it played a complicated role in human. Two studies reported that human Tregs did not constitutively express IL-35 [20,22], but recent evidence supported that IL-35 was secreted by CD3/CD28 activated Tregs, converting Tconv cells into iTr cells [21]. These discrepancies might result from the timing of analysis, experimental techniques and the subjects enrolled. It should be noted that previous data on IL-35 were mainly derived from mouse models and the healthy population, so the role of IL-35 in autoimmune disease remains to be defined. Our present study indicates that in ITP, an autoimmune disease, the deficiency of IL-35 may have something to do with the dysfunction of self-tolerance that contributes to the platelet destruction. Our research and other studies revealed that peripheral Tregs were decreased and functionally defective in active ITP patients, but the reasons entailed more explorations. Semple et al. recently suggested that sequestration of functional Tregs in thymus may lead to the peripheral deficiency and IVIG treatment reversed the accumulation of Tregs in thymus, thus correcting peripheral deficiency of Tregs and increasing platelet count [10]. In some way, it is reasonable that low concentrations of IL-35 are due to the peripheral deficiency of Tregs, the major producer for this cytokine. As mentioned above, IL-35 can exert ‘infectious tolerance’ through converting Tconv cells into IL-35-secreted iTr cells. Thus, there might exist a positive feedback mechanism in the production of IL-35 and the distribution of IL-35 levels in a cohort should not be normalized. In accordance with this postulation, the concentrations of IL-35 were gathered in an extremely low level in ITP patients but in a high level in healthy controls, which hinted that the decreased Tregs in ITP patients could not trigger the cascade expanding secretion of IL-35. Some further detection was made on the plasma levels of the Tregs related cytokines, TGF-b and IL-10. TGF-b significantly
decreased in ITP patients and closely associated with the activities of disease and treatment. In contrast, IL-10 was elevated in ITP patients and didn’t bear a relation with platelet counts. Some studies have previously described the decreased levels of plasma IL-10 in ITP patients [7,28], while others revealed the increased plasma IL-10 levels in ITP patients [29,30]. Considering that IL-10 is extensively produced by sorts of cells, including B cells, Th2 cells, macrophages etc. and does not correlated with IL-2, the nonredundant cytokine for Tregs commitment [29], it holds water that Tregs may not be the major source for IL-10. Thus, it is postulated that the decreased TGF-b and IL-35 levels accounts for, at least in part, the anergy of Tregs in patients with ITP. IL-35 is a newly identified member of IL-12 cytokine family, which is constituted of 4 heterodimeric protein members including IL-12, IL-23, IL-27 and IL-35 [31]. IL-35 is composed of a P35 and an EBI-3 subunit. P35 binds with P40 to form IL-12 and EBI-3 binds with P28 to form IL-27. IL-12 is a classic pro-inflammatory cytokine with important effects on the Th1 and Th17 commitment and elevates in ITP patients [29,32,33]. Initially, IL-27 was identified as a pro-inflammatory factor but recent data supported it as an immunoregulatory cytokine that promotes Tregs commitment [34,35]. We recently identified that IL-27 was increased in active ITP patients, polarizing Th1 and Tc1 cells and stimulating the production of inflammatory cytokines [36]. Thus, the imbalance of IL-12 family member cytokines may be involved in the pathogenesis of ITP. The next step was to detect the mRNA expression of p35 and EBI-3 in PBMCs, which helped to uncover that only p35 mRNA was decreased in patients with ITP. Because IL-35 shares the P35 subunit with IL-12 and the EBI-3 subunit with IL-27, it was rarely possible to directly decide the relationship between mRNA expression and protein levels of IL-35. For quantifying mRNA levels, a better approach turns out to isolate Tregs, the major resource of IL-35. However, owing to the decrease of Tregs in ITP patients, there were not sufficient cell numbers available for real-time PCR. Thus, it could only be supposed that the decreased synthesis for p35 might result in the deficiency of IL-35. Great potential as it has, Tregs-based therapy for autoimmune diseases contains certain limitations. As to patients with ITP, antigen specific iTr can be generated in vitro [37] but the clinical application is restricted by its technical complexity. In addition, the stability and potency of the artificial Treg in vivo remains unclear. Given that IL-35 can generate potent iTr cells in vitro that maintains a stable and potent regulatory role in vivo [18], it makes sense to introduce IL-35 for the further treatment of ITP, especially for the refractory cases. Acknowledgments This work was supported in part by Grants of National Natural Science Foundation of China (81070397 and 81270581), Ministry
Y. Yang et al. / Human Immunology 75 (2014) 909–913
of Science and Technology of China (2011ZX09302-007-04), Ministry of Health of China (201202017), Tianjin Municipal Science and Technology Commission (10JCZDJC19700 and 12JCQNJC08000), PUMC Youth Fund (3332013068) and the Fundamental Research Funds for the Central Universities of China (3332013068). References [1] Semple JW. Immune pathophysiology of autoimmune thrombocytopenic purpura. Blood Rev 2002;16(1):9–12. [2] Olsson B, Andersson PO, Jernas M, Jacobsson S, Carlsson B, Carlsson LM, et al. Tcell-mediated cytotoxicity toward platelets in chronic idiopathic thrombocytopenic purpura. Nat Med 2003;9(9):1123–4. [3] Chow L, Aslam R, Speck ER, Kim M, Cridland N, Webster ML, et al. A murine model of severe immune thrombocytopenia is induced by antibody- and CD8+ T cell-mediated responses that are differentially sensitive to therapy. Blood 2010;115(6):1247–53. [4] Chang M, Nakagawa PA, Williams SA, Schwartz MR, Imfeld KL, Buzby JS, et al. Immune thrombocytopenic purpura (ITP) plasma and purified ITP monoclonal autoantibodies inhibit megakaryocytopoiesis in vitro. Blood 2003; 102(3):887–95. [5] Wang T, Zhao H, Ren H, Guo J, Xu M, Yang R, et al. Type 1 and type 2 T-cell profiles in idiopathic thrombocytopenic purpura. Haematologica 2005; 90(7):914–23. [6] Ogawara H, Handa H, Morita K, Hayakawa M, Kojima J, Amagai H, et al. High Th1/Th2 ratio in patients with chronic idiopathic thrombocytopenic purpura. Eur J Haematol 2003;71(4):283–8. [7] Panitsas FP, Theodoropoulou M, Kouraklis A, Karakantza M, Theodorou GL, Zoumbos NC, et al. Adult chronic idiopathic thrombocytopenic purpura (ITP) is the manifestation of a type-1 polarized immune response. Blood 2004; 103(7):2645–7. [8] Horstman LL, Jy W, Schultz DR, Mao WW, Ahn YS. Complement-mediated fragmentation and lysis of opsonized platelets: ender differences in sensitivity. J Lab Clin Med 1994;123(4):515–25. [9] Liu B, Zhao H, Poon MC, Han Z, Gu D, Xu M, et al. Abnormality of CD4(+)CD25(+) regulatory T cells in idiopathic thrombocytopenic purpura. Eur J Haematol 2007;78(2):139–43. [10] Aslam R, Hu Y, Gebremeskel S, Segel GB, Speck ER, Guo L, et al. Thymic retention of CD4+ CD25+ FoxP3+ T regulatory cells is associated with their peripheral deficiency and thrombocytopenia in a murine model of immune thrombocytopenia. Blood 2012;120(10):2127–32. [11] Yu J, Heck S, Patel V, Levan J, Yu Y, Bussel JB, et al. Defective circulating CD25 regulatory T cells in patients with chronic immune thrombocytopenic purpura. Blood 2008;112(4):1325–8. [12] Sakakura M, Wada H, Tawara I, Nobori T, Sugiyama T, Sagawa N, et al. Reduced Cd4+Cd25+ T cells in patients with idiopathic thrombocytopenic purpura. Thromb Res 2007;120(2):187–93. [13] Piccirillo CA, Shevach EM. Naturally-occurring CD4+CD25+ immunoregulatory T cells: central players in the arena of peripheral tolerance. Semin Immunol 2004;16(2):81–8. [14] Jonuleit H, Schmitt E, Kakirman H, Stassen M, Knop J, Enk AH. Infectious tolerance: human CD25(+) regulatory T cells convey suppressor activity to conventional CD4(+) T helper cells. J Exp Med 2002;196(2):255–60. [15] Park HB, Paik DJ, Jang E, Hong S, Youn J. Acquisition of anergic and suppressive activities in transforming growth factor-beta-costimulated CD4+ CD25 T cells. Int Immunol 2004;16(8):1203–13. [16] Yamagiwa S, Gray JD, Hashimoto S, Horwitz DA. A role for TGF-beta in the generation and expansion of CD4+CD25+ regulatory T cells from human peripheral blood. J Immunol 2001;166(12):7282–9. [17] Zheng SG, Gray JD, Ohtsuka K, Yamagiwa S, Horwitz DA. Generation ex vivo of TGF-beta-producing regulatory T cells from CD4+CD25- precursors. J Immunol 2002;169(8):4183–9. [18] Collison LW, Chaturvedi V, Henderson AL, Giacomin PR, Guy C, Bankoti J, et al. IL-35-mediated induction of a potent regulatory T cell population. Nat Immunol 2010;11(12):1093–101.
913
[19] Collison LW, Workman CJ, Kuo TT, Boyd K, Wang Y, Vignali KM, et al. The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature 2007;450(7169):566–9. [20] Bardel E, Larousserie F, Charlot-Rabiega P, Coulomb-L’Hermine A, Devergne O. Human CD4+ CD25+ Foxp3+ regulatory T cells do not constitutively express IL35. J Immunol 2008;181(10):6898–905. [21] Chaturvedi V, Collison LW, Guy CS, Workman CJ, Vignali DA. Cutting edge: human regulatory T cells require IL-35 to mediate suppression and infectious tolerance. J Immunol 2011;186(12):6661–6. [22] Allan SE, Song-Zhao GX, Abraham T, McMurchy AN, Levings MK. Inducible reprogramming of human T cells into Treg cells by a conditionally active form of FOXP3. Eur J Immunol 2008;38(12):3282–9. [23] Kochetkova I, Golden S, Holderness K, Callis G, Pascual DW. IL-35 stimulation of CD39+ regulatory T cells confers protection against collagen II-induced arthritis via the production of IL-10. J Immunol 2010;184(12):7144–53. [24] Bettini M, Castellaw AH, Lennon GP, Burton AR, Vignali DA. Prevention of autoimmune diabetes by ectopic pancreatic beta-cell expression of interleukin-35. Diabetes 2012;61(6):1519–26. [25] Niedbala W, Wei XQ, Cai B, Hueber AJ, Leung BP, McInnes IB, et al. IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol 2007;37(11):3021–9. [26] Provan D, Stasi R, Newland AC, Blanchette VS, Bolton-Maggs P, Bussel JB, et al. International consensus report on the investigation and management of primary immune thrombocytopenia. Blood 2010;115(2):168–86. [27] Rodeghiero F, Stasi R, Gernsheimer T, Michel M, Provan D, Arnold DM, et al. Standardization of terminology, definitions and outcome criteria in immune thrombocytopenic purpura of adults and children: report from an international working group. Blood 2009;113(11):2386–93. [28] Guo C, Chu X, Shi Y, He W, Li L, Wang L, et al. Correction of Th1-dominant cytokine profiles by high-dose dexamethasone in patients with chronic idiopathic thrombocytopenic purpura. J Clin Immunol 2007;27(6):557–62. [29] Rocha AM, Souza C, Rocha GA, de Melo FF, Clementino NC, Marino MC, Martins Filho OA, Queiroz DM, et al. The levels of IL-17A and of the cytokines involved in Th17 cell commitment are increased in patients with chronic immune thrombocytopenia. Haematologica 2011;96(10):1560–4. [30] Del Vecchio GC, Giordano P, Tesse R, Piacente L, Altomare M, De Mattia D. Clinical significance of serum cytokine levels and thrombopoietic markers in childhood idiopathic thrombocytopenic purpura. Blood Transfus 2012; 10(2):194–9. [31] Vignali DA, Kuchroo VK. IL-12 family cytokines: immunological playmakers. Nat Immunol 2012;13(8):722–8. [32] Germann T, Gately MK, Schoenhaut DS, Lohoff M, Mattner F, Fischer S, et al. Interleukin-12/T cell stimulating factor, a cytokine with multiple effects on T helper type 1 (Th1) but not on Th2 cells. Eur J Immunol 1993;23(8):1762–70. [33] Manetti R, Parronchi P, Giudizi MG, Piccinni MP, Maggi E, Trinchieri G, et al. Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4producing Th cells. J Exp Med 1993;177(4):1199–204. [34] Pot C, Jin H, Awasthi A, Liu SM, Lai CY, Madan R, et al. Cutting edge: IL-27 induces the transcription factor c-Maf, cytokine IL-21, and the costimulatory receptor ICOS that coordinately act together to promote differentiation of IL10-producing Tr1 cells. J Immunol 2009;183(2):797–801. [35] Wang H, Meng R, Li Z, Yang B, Liu Y, Huang F, et al. IL-27 induces the differentiation of Tr1-like cells from human naive CD4+ T cells via the phosphorylation of STAT1 and STAT3. Immunol Lett 2011;136(1):21–8. [36] Li HY, Zhang DL, Ge J, Zhou H, Qi A, Ma L, et al. Elevated interleukin-27 enhances the polarization of Th1/Tc1 cells and the production of proinflammatory cytokines in primary immune thrombocytopenia. Hum Immunol 2012;73(3):240–7. [37] Zhang XL, Peng J, Sun JZ, Liu JJ, Guo CS, Wang ZG, et al. De novo induction of platelet-specific CD4(+)CD25(+) regulatory T cells from CD4(+)CD25( ) cells in patients with idiopathic thrombocytopenic purpura. Blood 2009; 113(11):2568–77.