- Email: [email protected]
Degradation of rice straw at low temperature using a novel microbial consortium LTF-27 with efficient ability
Bioresource Technology xxx (xxxx) xxxx
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Short Communication
Degradation of rice straw at low temperature using a novel microbial consortium LTF-27 with efficient ability ⁎
Guoxiang Zhenga,b,c, , Ting Yina,c, Zhaoxin Lua,c, Stopira yannick benz Bobouaa,c, Jiachen Lia,c, Wenlong Zhoua,b a
College of Engineering, Northeast Agriculture University, Harbin 150030, China Key Laboratory of Pig-breeding Facilities Engineering, Ministry of Agriculture, Harbin 150030, China c Heilongjiang Key Laboratory of Technology and Equipment for the Utilization of Agricultural Renewable Resources, Harbin 150030, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Psychrotrophic Anaerobic digestion Microbial diversity Multi-species enzyme system
In this study, a novel psychrotrophic lignocelluloses degrading microbial consortium LTF-27 was successfully obtained from cold perennial forest soil by successive enrichment culture under facultative anaerobic static conditions. The microbial consortium showed efficient degradation of rice straw, which cellulose, hemicelluloses and lignin lost 71.7%, 65.6% and 12.5% of its weigh, respectively, in 20 days at 15 °C. The predominant liquid products were acetic acid and butyric acid during degrading lignocellulose in anaerobic digestion (AD) process inoculated with the LTF-27. The consortium mainly composed of Parabacteroides, Alcaligenes, Lysinibacillus, Sphingobacterium, and Clostridium, along with some unclassified uncultured bacteria, indicating powerful synergistic interaction in AD process. A multi-species lignocellulolytic enzyme system working cooperatingly on lignocelluolse degradation was revealed by proteomics analysis of cellulose bound fraction of the crude extracellular enzyme, which provides key theoretical base for further exploration and application of LTF-27.
1. Introduction In China, crop straw is one of the most abundant agricultural wastes, the total annual production was estimated to be 700 million tons (Editorial Committee of China Agriculture Yearbook, 2018), among which approximately 121.56 million tons from the cold northeast regions of China was produced annually. It is well known that lignocellulosic biomass has been recognized as an essentially inexhaustible source of raw material for environmentally friendly and biocompatible bioenergy (Honeina and Kanekoa, 2012). However, the complex structure and composition of straw stalk reduce the accessibility of microorganisms to biodegradable components (i.e., hemicellulose and cellulose which are enclosed by lignin), especially in low temperature (Chen et al., 2017; Wang et al., 2019). Bioconversion of lignocelluloses residues is a favorable approach for value-added biogas production efficiently by means of microbial co-cultures or complex communities due to synergistic interaction, mutual coordination and antagonistic effect between different microbes, as compared to single bacteria (Wongwilaiwalin et al., 2010; Pap et al., 2015). Furthermore, Anaerobic digestion is considered to be a convenient and environmentally friendly approach in converting organic wastes to clean multi-purpose energy, which the better substrate hydrolysis is ⁎
positively correlated with subsequent methane production (Peces et al., 2016; Qing et al., 2017). Some lignocellulose-degrading microbial consortia screened from different environments have been proved their positive role in hydrolysis rate of substrates, as result of improvement of methane yield in straw-methane production engineering in succession. (Cui et al., 2016; Liu et al., 2018; Fang et al. 2018). However, majority of previous research have focused on the bioconversion of organic wastes by thermophilic or mesophilic microbial community, which microbial activity of indigenous microorganisms are severely depressed, leading to a poor biotransformation of contaminants in biogas production due to seasonal or regional low temperatures. Therefore, psychrotolerant microorganisms from different cold habitats had attracted increasing interest for their considerable biotechnological potential. (Xu et al., 2018; Huang et al., 2015; Margesin and Feller, 2010). In particular, screening and developing of cold-adapted lignocellulosedegrading complex community were of great significance in accelerating bioconversion of lignocellulosic wastes in straw-methane production engineering in northeast cold regions of China. In this study, a novel psychrotrophic lignocellulose-degrading consortium with better performance was screened from cold humus-rich soil by successive enrichment culture. The fermentative performance, structure and dynamics of the microbial community have been
Corresponding author at: NO. 600 Changjiang Road Xiangfang Dist, Haerbin 150030, China. E-mail address: [email protected] (G. Zheng).
https://doi.org/10.1016/j.biortech.2020.123064 Received 20 December 2019; Received in revised form 17 February 2020; Accepted 18 February 2020 0960-8524/ © 2020 Elsevier Ltd. All rights reserved.
Please cite this article as: Guoxiang Zheng, et al., Bioresource Technology, https://doi.org/10.1016/j.biortech.2020.123064
Bioresource Technology xxx (xxxx) xxxx
G. Zheng, et al.
investigated, together with characteristics of its multi-species enzyme system. The microbial consortium provides a valuable platform for further research on potential follow-up wastes biodegradation and bioenergy applications.
Rice straw Cellulose Hemicellulose Lignin
Degradation rate (%)
75
2. Materials and methods 2.1. Materials Rice straw was obtained from the experimental farm of Northeast Agricultural University of China, pretreated using the NaOH method according to Cui et al (2016). The cellulosic substrates were autoclaved at 121 °C for 20 min before used. Chemicals and reagents were analytical or molecular biology grade from Shango Biotech, China.
60 45 30 15 0
2.2. Screen of lignocellulolytic microbial consortium
0
1 g soil sample from different cold perennial natural forest was inoculated into a 50 ml screw-cap tube containing 30 ml PCS medium (0.5% peptone, 0.1% yeast powder, 0.3% CaCO3, 0.5% NaCl, 0.2% rice straw) with a filter paper strip as an indicator for microbe activity. The microbial consortium, designated LTF-27, was obtained by successive subcultivation at 15 °C under static facultative anaerobic conditions. The efficacious inoculums for inoculation were stored at −80 °C with 80% glycerol. Unless otherwise specified, the data presented are the average of three replications.
5
10
15
20
Time (d) Fig. 1. Changes in concentration of cellulose, hemicellulose, and lignin of rice straw during cultivation.
of rice straw in initial 10 days. After 10 day, the consortium entered in a stable growth period, resulting in the increasing of rice straw degradation. The weight loss of rice straw amounted to 58.5% on day 20, of which hemicellulose and cellulose drastically lost 71.7% and 65.6% of its weight, respectively, while lignin only lost 12.5% of its weight. Liquid end products produced during the degradation process of rice straw were analyzed. The major compounds and their concentrations in the different phases during the fermentation of rice straw were shown in Fig. 2. It can be seen that the predominant VFAs were acetic acid and butyric acid, along with a few of ethanol and propionic acid in the rice straw degradation process. The acetic acid (1916 mg/L) and butyric acid (563 mg/L) peaked on day 8 and 11, respectively. Previous report showed that acetic acid and butyric acid are important organic acids, which are beneficial for subsequent methane fermentation in the AD process (Wang et al, 2013). The changes of pH value in the fermentation broth was consistent with the production and conversion of organic acids (Fig. 2), illustrating that the system inoculated with microbial consortium LTF-27 presented better auto-recover ability for pH during hydrolyzing rice straw.
The fermentation materials were centrifuged at 12000 rpm for 10 min and the residual cellulosic materials were sieved through 1 mm pore size. The weight loss of residual rice straw was determined as described in Cui et al (2016). Components of residual lignocellulosic materials were analyzed using a fiber analyser (Model ANKOM220, USA). The pH value was determined using a portable pH meter (PHSJ3F). The samples for volatile fatty acids (VFAs) and ethanol were analyzed by gas chromatography (GC-7890N, Agilent Inc. USA). 2.4. DNA extraction, PCR amplification, and microbial community analysis The genomic DNA was extracted using the Ezup Column Soil DNA Purification Kit (Sangon Biotech, China). The bacterial V3-V4 region of 16S rRNA genes was amplified using primers 850R (5′-GACTGGAGTT CCTTGGCACCCGAGAATTCCA −3′) and 341F(5′-CCCTACACGACGC TCT TCCGATCTG-3′). PCR reactions were performed according to Liu et al (2018). Purified PCR products were analyzed by high-throughput pyrosequencing, carried out by Majorbio Bio-Pharm Biotechnology Co., Ltd., Shanghai, China using Illumina Miseq PE250. The raw reads were deposited into the NCBI Sequence Read Archive (SRA) database. These data were analyzed by Shanghai Major bio Pharm Technology Co. Ltd. (Shanghai, China).
Butyric acid Propionic acid 8.0 Acetic acid Ethanol 7.2 pH
Liquid end products (g/L)
3.0
2.5. Proteomic analysis Digestion and extraction of total protein was performed according the method provided earlier (Shen et al., 2009). After digestion, the peptide mixture was acidified by formic acid for further LC-MS/MS analysis by Shanghai Shango Biotech.
2.5 2.0
6.4
1.5 1.0
pH
2.3. Analytical methods
5.6
0.5 4.8
3. Results and discussion 0.0
3.1. Degradation characteristics of microbial consortium LTF-27
0
2
4
6
8
10
12
14
16
18
20
Time (d) As shown in Fig. 1, the rice straw degradation, along with its composition showed similar change. The composite strains likely adapted to low temperature environment, leading a slight degradation
Fig. 2. Changes of concentration of acetic acid, butyric acid, propionic acid and ethanol in different phases. 2
Bioresource Technology xxx (xxxx) xxxx
G. Zheng, et al.
Fig. 3. Bacterial sequence distributions at genus level.
enzymes were simultaneously identified, which play important role in metabolism of organic matter, microbial biosynthesis and catalysis, modification of carbohydrates, proteins and nucleic acids, as well as the stimulus responses and 12 newly discovered proteins with unknown function. Previous report has showed that synergism of multi-enzymes secreted from microbial consortium favors for efficiently lignocellulose decomposition by removal of hydrolysis inhibitory products (Wongwilaiwalin, et al., 2010).
3.2. Microbial community structure and dynamics As shown in Fig. 3, the relative abundance of bacteria taxonomic groups of LTF-27 is analyzed based on independent 16S rDNA sequence. At the genera level, the dominant genera were Parabacteroides, Alcaligenes, Lysinibacillus, Sphingobacterium, Clostridium, which accounted for 85–90% of the total bacteria, and a few of bacilli as well as unidentified uncultured bacteria stably co-existed in the consortium. At the initial stage, Parabacteroides was determined to be predominant bacteria, which account for 83% of total bacteria. Organic acids gradually increased with the increase of reaction time, Alcaligenes and Parabacteroides became dominant bacteria by accumulating of volatile acids reproduction in the medium stage, of which the percentage of Sphingobacterium related to lignocelluloses degradation observably enhanced from 1.8% to 7.45%. Increasing of pH was beneficial for the growth of Lysinibacillus, Sphingobacterium and Clostridium after 8 days, which could utilize lignocellulosic material for growth and reproduction, resulting in the efficient straw degradation (Yan et al, 2012). Seen from Fig. 3, the composition of the microbial communities LTF-27 was more complex and diverse, compared to previous reporter (Cui et al., 2016; Yan et al., 2012), which was beneficial to better degradation for lignocellulosic biomass owing to cooperation and competition mutually of multi-microorganisms (Zeng et al. 2018).
4. Conclusions In this study, a novel active psychrotrophic lignocelluloses degrading microbial consortium LTF-27 has been obtained and showed efficient deconstruction of rice straw during the acidification phase of AD at low temperature (15 °C). The acetic acid and butyric acid produced by LTF-27 could conduce to biotransformatin directly or indirectly by microbes in subsequent methanogenic stage. The consortium, with multi-species enzyme mainly secreted from Alcaligenes, Parabacteroides, Lysinibacillus, Clostridium, and Sphingobacterium etc, possesses potential for further low temperature biotransformation application, especially the straw-methane fermentation of agriculture residue-based bioenergy feedstocks of the cold northeast regions in China. CRediT authorship contribution statement
3.3. Analysis of lignocellulose degrading enzyme system Guoxiang Zheng: Conceptualization, Methodology, Writing - review & editing, Supervision. Ting Yin: Writing - original draft, Formal analysis, Validation, Investigation, Visualization. Zhaoxin Lu: Conceptualization, Methodology, Project administration. Stopira yannick benz Boboua: Writing - review & editing, Visualization, Conceptualization, Methodology. Jiachen Li: Data curation. Wenlong Zhou: Conceptualization, Methodology.
Proteomic analysis revealed a multi-species synergistic enzyme system of complex community LTF-27. As shown in Table 1, it composed mainly of extracellular hydrolases and cellulosomal components, which were catalase related to lignin degradation; endoglucanase reported from model cellulolytic bacteria, including endo-glucanase precursor, endo-1,4-beta-glucanase and type IIS restrictive endo-enzyme protein); exo-1,3-beta-glucanase and glycosidases cleaving the cellobiose molecule cellulose degradation (Cavicchioli, 2016), as well as Larabinofuranosidase and xylanase related to hemicelluloses decomposition (Sukharnikov et al., 2011). Additionally, some non-cellulosic
Declaration of Competing Interest The authors declare that they have no known competing financial 3
Bioresource Technology xxx (xxxx) xxxx
G. Zheng, et al.
Table 1 Identification of polypeptides in cellulose bound fraction of crude enzyme from LTF-27. No.
GI number
Score
Mass
Search result
Microorganisms
1 2 3 4 5 6 7 8 9 10 11 12
gi|525311389 gi|674648109 gi|674647876 gi|589398755 gi|1130323190 gi|511009524 gi|406606969 gi|119495034 gi|169159203 gi|3915310 gi|1130324026 gi|17071098
38 45 132 61 59 57 66 43 57 70 77 63
80,126 71,276 56,716 57,548 84,164 90,765 41,691 64,312 12,101 59,859 63,398 40,678
Beta-glucosidase-related glycosidases Endo glucanase precursor Catalase Alpha-L-arabinofuranosidase Alpha-glucosidase Endo −1,4-beta-glucanase Endo-1,4-beta-glucanase Exo-1,3-beta-glucanase Endo-1,3-beta-xylananse Xylanase 2,6-beta-D-fructofuranosidase Type IIS restriction enzyme protein
Clostridium sp. CAG:510 Lysinibacillus saudimassiliensis Lysinibacillus saudimassiliensis Clostridium sp. ASBs410 Parabacteroides sp. ASF519 Parabacteroides sp. ASF519 Wickerhamomyces ciferrii Aspergillus fischeri NRRL 181 Penicillium citrinum Clostridium sp. ASBs410 Parabacteroides sp. Marseille-P3136 Clostridiumperfringens B str. ATCC 3626
interests or personal relationships that could have appeared to influence the work reported in this paper.
properties during anaerobic digestion of corn stover at difffferent temperatures. Bioresour. Technol. 261, 93–103. Margesin, R., Feller, G., 2010. Biotechnological applications of psychrophiles. Environ. Technol. 31, 835–844. Pap, B., Gyoerkei, A., Boboescu, I.Z., Nagy, I.K., Biro, T., Kondorosi, E., Maroti, G., 2015. Temperature-dependent transformation of biogas-producing microbial communities points to the increased importance of hydrogenotrophic methanogenesis under thermophilic operation. Bioresour. Technol. 177, 375–380. Peces, M., Astals, S., Clarke, W.P., 2016. Semi-aerobic fermentation as a novel pretreatment to obtain VFA and increase methane yield from primary sludge. Bioresour. Technol. 200, 631–638. Qing, H.S., Di, W., Zhe, C.Z., Yue, Z., 2017. Effect of cold-adapted microbial agent inoculation on enzyme activities during composting start-up at low temperature. Bioresour. Technol. 244, 635–640. Shen, Z., Li, P., Ni, R.J., Ritchie, M., Yang, C.P., 2009. Label-free quantitative proteomics analysis of etiolated maize seedling leaves during greening. Mol. Cell. Proteomics 11, 2443–2460. Sukharnikov, L.O., Cantwell, B.J., Podar, M., Zhulin, I.B., 2011. Cellulases: ambiguous non-homologous enzymes in a genomic perspective. Trends Biotechnol. 29 (10), 473–479. Wang, H., Li, J.J., Lu, Y.C., Guo, P., Wang, X.F., 2013. Bioconversion of un-pretreated lignocellulosic materials by a microbial consortium XDC-2. Bioresour. Technol. 136, 481–487. Wang, Z., Cheng, Q.S., Liu, Z.Y., Qu, J.B., 2019. Evaluation of methane production and energy conversion from corn stalk using furfural wastewater pretreatment for whole slurry anaerobic co-digestion. Bioresour. Technol. 239, 121–962. Wongwilaiwalin, S., Rattanachomsri, U., Laothanachareon, T., 2010. Analysis of a thermophilic lignocelluloses degrading microbial consortium and muti-species lignocellulolytic enzyme system. Enzyme Microb. Technol. 47, 283–290. Xu, Z.Z., Ben, Y., Chen, Z.L., 2018. Application and microbial ecology of psychrotrophs in domestic wastewater treatment at low temperature. Chemosphere 191, 946–953. Yan, L., Gao, Y., Wang, Y.J., Liu, Q., Sun, Z.Y., Fu, B.R., 2012. Diversity of a mesophilic lignocellulolytic microbial consortium which is useful for enhancement of biogas production. Bioresour. Technol. 111, 49–52. Zeng, Z.T., Xue, Y.G., Piao, X., 2018. Responses of microbial carbon metabolism and function diversity induced by complex fungal enzymes in lignocellulosic waste composting. Sci. Total Environ. 643, 539–547.
Acknowledgements This work was supported by National Key R&D Program of China (2019YFD1100603) and National Key Research and Development Plan Project of China (2017YFD0700705). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.biortech.2020.123064. References Cavicchioli, R., 2016. On the concept of a psychrophile. ISME J 10, 793–795. Chen, H., Liu, J., Chang, X., Chen, D., Xue, Y., 2017. A review on the pretreatment of lignocellulose for high-value chemicals. Fuel Process. Technol. 160, 196–206. Cui, Z.J., Yuan, X.F., Ma, L., Wen, B.T., 2016. Enhancing anaerobic digestion of cotton stalk by pretreatment with a microbial consortium (MC1). Bioresour. Technol. 207, 293–301. Editorial Committee of China Agriculture Yearbook, 2018. China Agriculture Yearbook. China Agriculture Press, Beijing, pp. 177. Fang, X.X., Li, Q.M., Lin, Y.Q., Lin, X.L., Dai, Y.Q., 2018. A screening of a microbial consortium for selective degradation of lignin from tree trimmings. Bioresour. Technol. 254, 247–255. Huang, Z., Qie, Y., Wang, Z., Zhang, Y., Zhou, W., 2015. Application of deep-sea treatment of psychrotolerant bacteria in wastewater treatment by aerobic dynamic membrane bioreactors at low temperature. J. Membr. Sci. 475, 47–56. Honeina, K., Kanekoa, G., 2012. Studies on the cellulose-degrading system in a shipworm and its potential applications. Energy Procedia 18, 1271–1274. Liu, C.M., Akiber, C.F., Wachemo.,, 2018. Biogas production and microbial community
4
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Short Communication
Degradation of rice straw at low temperature using a novel microbial consortium LTF-27 with efficient ability ⁎
Guoxiang Zhenga,b,c, , Ting Yina,c, Zhaoxin Lua,c, Stopira yannick benz Bobouaa,c, Jiachen Lia,c, Wenlong Zhoua,b a
College of Engineering, Northeast Agriculture University, Harbin 150030, China Key Laboratory of Pig-breeding Facilities Engineering, Ministry of Agriculture, Harbin 150030, China c Heilongjiang Key Laboratory of Technology and Equipment for the Utilization of Agricultural Renewable Resources, Harbin 150030, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Psychrotrophic Anaerobic digestion Microbial diversity Multi-species enzyme system
In this study, a novel psychrotrophic lignocelluloses degrading microbial consortium LTF-27 was successfully obtained from cold perennial forest soil by successive enrichment culture under facultative anaerobic static conditions. The microbial consortium showed efficient degradation of rice straw, which cellulose, hemicelluloses and lignin lost 71.7%, 65.6% and 12.5% of its weigh, respectively, in 20 days at 15 °C. The predominant liquid products were acetic acid and butyric acid during degrading lignocellulose in anaerobic digestion (AD) process inoculated with the LTF-27. The consortium mainly composed of Parabacteroides, Alcaligenes, Lysinibacillus, Sphingobacterium, and Clostridium, along with some unclassified uncultured bacteria, indicating powerful synergistic interaction in AD process. A multi-species lignocellulolytic enzyme system working cooperatingly on lignocelluolse degradation was revealed by proteomics analysis of cellulose bound fraction of the crude extracellular enzyme, which provides key theoretical base for further exploration and application of LTF-27.
1. Introduction In China, crop straw is one of the most abundant agricultural wastes, the total annual production was estimated to be 700 million tons (Editorial Committee of China Agriculture Yearbook, 2018), among which approximately 121.56 million tons from the cold northeast regions of China was produced annually. It is well known that lignocellulosic biomass has been recognized as an essentially inexhaustible source of raw material for environmentally friendly and biocompatible bioenergy (Honeina and Kanekoa, 2012). However, the complex structure and composition of straw stalk reduce the accessibility of microorganisms to biodegradable components (i.e., hemicellulose and cellulose which are enclosed by lignin), especially in low temperature (Chen et al., 2017; Wang et al., 2019). Bioconversion of lignocelluloses residues is a favorable approach for value-added biogas production efficiently by means of microbial co-cultures or complex communities due to synergistic interaction, mutual coordination and antagonistic effect between different microbes, as compared to single bacteria (Wongwilaiwalin et al., 2010; Pap et al., 2015). Furthermore, Anaerobic digestion is considered to be a convenient and environmentally friendly approach in converting organic wastes to clean multi-purpose energy, which the better substrate hydrolysis is ⁎
positively correlated with subsequent methane production (Peces et al., 2016; Qing et al., 2017). Some lignocellulose-degrading microbial consortia screened from different environments have been proved their positive role in hydrolysis rate of substrates, as result of improvement of methane yield in straw-methane production engineering in succession. (Cui et al., 2016; Liu et al., 2018; Fang et al. 2018). However, majority of previous research have focused on the bioconversion of organic wastes by thermophilic or mesophilic microbial community, which microbial activity of indigenous microorganisms are severely depressed, leading to a poor biotransformation of contaminants in biogas production due to seasonal or regional low temperatures. Therefore, psychrotolerant microorganisms from different cold habitats had attracted increasing interest for their considerable biotechnological potential. (Xu et al., 2018; Huang et al., 2015; Margesin and Feller, 2010). In particular, screening and developing of cold-adapted lignocellulosedegrading complex community were of great significance in accelerating bioconversion of lignocellulosic wastes in straw-methane production engineering in northeast cold regions of China. In this study, a novel psychrotrophic lignocellulose-degrading consortium with better performance was screened from cold humus-rich soil by successive enrichment culture. The fermentative performance, structure and dynamics of the microbial community have been
Corresponding author at: NO. 600 Changjiang Road Xiangfang Dist, Haerbin 150030, China. E-mail address: [email protected] (G. Zheng).
https://doi.org/10.1016/j.biortech.2020.123064 Received 20 December 2019; Received in revised form 17 February 2020; Accepted 18 February 2020 0960-8524/ © 2020 Elsevier Ltd. All rights reserved.
Please cite this article as: Guoxiang Zheng, et al., Bioresource Technology, https://doi.org/10.1016/j.biortech.2020.123064
Bioresource Technology xxx (xxxx) xxxx
G. Zheng, et al.
investigated, together with characteristics of its multi-species enzyme system. The microbial consortium provides a valuable platform for further research on potential follow-up wastes biodegradation and bioenergy applications.
Rice straw Cellulose Hemicellulose Lignin
Degradation rate (%)
75
2. Materials and methods 2.1. Materials Rice straw was obtained from the experimental farm of Northeast Agricultural University of China, pretreated using the NaOH method according to Cui et al (2016). The cellulosic substrates were autoclaved at 121 °C for 20 min before used. Chemicals and reagents were analytical or molecular biology grade from Shango Biotech, China.
60 45 30 15 0
2.2. Screen of lignocellulolytic microbial consortium
0
1 g soil sample from different cold perennial natural forest was inoculated into a 50 ml screw-cap tube containing 30 ml PCS medium (0.5% peptone, 0.1% yeast powder, 0.3% CaCO3, 0.5% NaCl, 0.2% rice straw) with a filter paper strip as an indicator for microbe activity. The microbial consortium, designated LTF-27, was obtained by successive subcultivation at 15 °C under static facultative anaerobic conditions. The efficacious inoculums for inoculation were stored at −80 °C with 80% glycerol. Unless otherwise specified, the data presented are the average of three replications.
5
10
15
20
Time (d) Fig. 1. Changes in concentration of cellulose, hemicellulose, and lignin of rice straw during cultivation.
of rice straw in initial 10 days. After 10 day, the consortium entered in a stable growth period, resulting in the increasing of rice straw degradation. The weight loss of rice straw amounted to 58.5% on day 20, of which hemicellulose and cellulose drastically lost 71.7% and 65.6% of its weight, respectively, while lignin only lost 12.5% of its weight. Liquid end products produced during the degradation process of rice straw were analyzed. The major compounds and their concentrations in the different phases during the fermentation of rice straw were shown in Fig. 2. It can be seen that the predominant VFAs were acetic acid and butyric acid, along with a few of ethanol and propionic acid in the rice straw degradation process. The acetic acid (1916 mg/L) and butyric acid (563 mg/L) peaked on day 8 and 11, respectively. Previous report showed that acetic acid and butyric acid are important organic acids, which are beneficial for subsequent methane fermentation in the AD process (Wang et al, 2013). The changes of pH value in the fermentation broth was consistent with the production and conversion of organic acids (Fig. 2), illustrating that the system inoculated with microbial consortium LTF-27 presented better auto-recover ability for pH during hydrolyzing rice straw.
The fermentation materials were centrifuged at 12000 rpm for 10 min and the residual cellulosic materials were sieved through 1 mm pore size. The weight loss of residual rice straw was determined as described in Cui et al (2016). Components of residual lignocellulosic materials were analyzed using a fiber analyser (Model ANKOM220, USA). The pH value was determined using a portable pH meter (PHSJ3F). The samples for volatile fatty acids (VFAs) and ethanol were analyzed by gas chromatography (GC-7890N, Agilent Inc. USA). 2.4. DNA extraction, PCR amplification, and microbial community analysis The genomic DNA was extracted using the Ezup Column Soil DNA Purification Kit (Sangon Biotech, China). The bacterial V3-V4 region of 16S rRNA genes was amplified using primers 850R (5′-GACTGGAGTT CCTTGGCACCCGAGAATTCCA −3′) and 341F(5′-CCCTACACGACGC TCT TCCGATCTG-3′). PCR reactions were performed according to Liu et al (2018). Purified PCR products were analyzed by high-throughput pyrosequencing, carried out by Majorbio Bio-Pharm Biotechnology Co., Ltd., Shanghai, China using Illumina Miseq PE250. The raw reads were deposited into the NCBI Sequence Read Archive (SRA) database. These data were analyzed by Shanghai Major bio Pharm Technology Co. Ltd. (Shanghai, China).
Butyric acid Propionic acid 8.0 Acetic acid Ethanol 7.2 pH
Liquid end products (g/L)
3.0
2.5. Proteomic analysis Digestion and extraction of total protein was performed according the method provided earlier (Shen et al., 2009). After digestion, the peptide mixture was acidified by formic acid for further LC-MS/MS analysis by Shanghai Shango Biotech.
2.5 2.0
6.4
1.5 1.0
pH
2.3. Analytical methods
5.6
0.5 4.8
3. Results and discussion 0.0
3.1. Degradation characteristics of microbial consortium LTF-27
0
2
4
6
8
10
12
14
16
18
20
Time (d) As shown in Fig. 1, the rice straw degradation, along with its composition showed similar change. The composite strains likely adapted to low temperature environment, leading a slight degradation
Fig. 2. Changes of concentration of acetic acid, butyric acid, propionic acid and ethanol in different phases. 2
Bioresource Technology xxx (xxxx) xxxx
G. Zheng, et al.
Fig. 3. Bacterial sequence distributions at genus level.
enzymes were simultaneously identified, which play important role in metabolism of organic matter, microbial biosynthesis and catalysis, modification of carbohydrates, proteins and nucleic acids, as well as the stimulus responses and 12 newly discovered proteins with unknown function. Previous report has showed that synergism of multi-enzymes secreted from microbial consortium favors for efficiently lignocellulose decomposition by removal of hydrolysis inhibitory products (Wongwilaiwalin, et al., 2010).
3.2. Microbial community structure and dynamics As shown in Fig. 3, the relative abundance of bacteria taxonomic groups of LTF-27 is analyzed based on independent 16S rDNA sequence. At the genera level, the dominant genera were Parabacteroides, Alcaligenes, Lysinibacillus, Sphingobacterium, Clostridium, which accounted for 85–90% of the total bacteria, and a few of bacilli as well as unidentified uncultured bacteria stably co-existed in the consortium. At the initial stage, Parabacteroides was determined to be predominant bacteria, which account for 83% of total bacteria. Organic acids gradually increased with the increase of reaction time, Alcaligenes and Parabacteroides became dominant bacteria by accumulating of volatile acids reproduction in the medium stage, of which the percentage of Sphingobacterium related to lignocelluloses degradation observably enhanced from 1.8% to 7.45%. Increasing of pH was beneficial for the growth of Lysinibacillus, Sphingobacterium and Clostridium after 8 days, which could utilize lignocellulosic material for growth and reproduction, resulting in the efficient straw degradation (Yan et al, 2012). Seen from Fig. 3, the composition of the microbial communities LTF-27 was more complex and diverse, compared to previous reporter (Cui et al., 2016; Yan et al., 2012), which was beneficial to better degradation for lignocellulosic biomass owing to cooperation and competition mutually of multi-microorganisms (Zeng et al. 2018).
4. Conclusions In this study, a novel active psychrotrophic lignocelluloses degrading microbial consortium LTF-27 has been obtained and showed efficient deconstruction of rice straw during the acidification phase of AD at low temperature (15 °C). The acetic acid and butyric acid produced by LTF-27 could conduce to biotransformatin directly or indirectly by microbes in subsequent methanogenic stage. The consortium, with multi-species enzyme mainly secreted from Alcaligenes, Parabacteroides, Lysinibacillus, Clostridium, and Sphingobacterium etc, possesses potential for further low temperature biotransformation application, especially the straw-methane fermentation of agriculture residue-based bioenergy feedstocks of the cold northeast regions in China. CRediT authorship contribution statement
3.3. Analysis of lignocellulose degrading enzyme system Guoxiang Zheng: Conceptualization, Methodology, Writing - review & editing, Supervision. Ting Yin: Writing - original draft, Formal analysis, Validation, Investigation, Visualization. Zhaoxin Lu: Conceptualization, Methodology, Project administration. Stopira yannick benz Boboua: Writing - review & editing, Visualization, Conceptualization, Methodology. Jiachen Li: Data curation. Wenlong Zhou: Conceptualization, Methodology.
Proteomic analysis revealed a multi-species synergistic enzyme system of complex community LTF-27. As shown in Table 1, it composed mainly of extracellular hydrolases and cellulosomal components, which were catalase related to lignin degradation; endoglucanase reported from model cellulolytic bacteria, including endo-glucanase precursor, endo-1,4-beta-glucanase and type IIS restrictive endo-enzyme protein); exo-1,3-beta-glucanase and glycosidases cleaving the cellobiose molecule cellulose degradation (Cavicchioli, 2016), as well as Larabinofuranosidase and xylanase related to hemicelluloses decomposition (Sukharnikov et al., 2011). Additionally, some non-cellulosic
Declaration of Competing Interest The authors declare that they have no known competing financial 3
Bioresource Technology xxx (xxxx) xxxx
G. Zheng, et al.
Table 1 Identification of polypeptides in cellulose bound fraction of crude enzyme from LTF-27. No.
GI number
Score
Mass
Search result
Microorganisms
1 2 3 4 5 6 7 8 9 10 11 12
gi|525311389 gi|674648109 gi|674647876 gi|589398755 gi|1130323190 gi|511009524 gi|406606969 gi|119495034 gi|169159203 gi|3915310 gi|1130324026 gi|17071098
38 45 132 61 59 57 66 43 57 70 77 63
80,126 71,276 56,716 57,548 84,164 90,765 41,691 64,312 12,101 59,859 63,398 40,678
Beta-glucosidase-related glycosidases Endo glucanase precursor Catalase Alpha-L-arabinofuranosidase Alpha-glucosidase Endo −1,4-beta-glucanase Endo-1,4-beta-glucanase Exo-1,3-beta-glucanase Endo-1,3-beta-xylananse Xylanase 2,6-beta-D-fructofuranosidase Type IIS restriction enzyme protein
Clostridium sp. CAG:510 Lysinibacillus saudimassiliensis Lysinibacillus saudimassiliensis Clostridium sp. ASBs410 Parabacteroides sp. ASF519 Parabacteroides sp. ASF519 Wickerhamomyces ciferrii Aspergillus fischeri NRRL 181 Penicillium citrinum Clostridium sp. ASBs410 Parabacteroides sp. Marseille-P3136 Clostridiumperfringens B str. ATCC 3626
interests or personal relationships that could have appeared to influence the work reported in this paper.
properties during anaerobic digestion of corn stover at difffferent temperatures. Bioresour. Technol. 261, 93–103. Margesin, R., Feller, G., 2010. Biotechnological applications of psychrophiles. Environ. Technol. 31, 835–844. Pap, B., Gyoerkei, A., Boboescu, I.Z., Nagy, I.K., Biro, T., Kondorosi, E., Maroti, G., 2015. Temperature-dependent transformation of biogas-producing microbial communities points to the increased importance of hydrogenotrophic methanogenesis under thermophilic operation. Bioresour. Technol. 177, 375–380. Peces, M., Astals, S., Clarke, W.P., 2016. Semi-aerobic fermentation as a novel pretreatment to obtain VFA and increase methane yield from primary sludge. Bioresour. Technol. 200, 631–638. Qing, H.S., Di, W., Zhe, C.Z., Yue, Z., 2017. Effect of cold-adapted microbial agent inoculation on enzyme activities during composting start-up at low temperature. Bioresour. Technol. 244, 635–640. Shen, Z., Li, P., Ni, R.J., Ritchie, M., Yang, C.P., 2009. Label-free quantitative proteomics analysis of etiolated maize seedling leaves during greening. Mol. Cell. Proteomics 11, 2443–2460. Sukharnikov, L.O., Cantwell, B.J., Podar, M., Zhulin, I.B., 2011. Cellulases: ambiguous non-homologous enzymes in a genomic perspective. Trends Biotechnol. 29 (10), 473–479. Wang, H., Li, J.J., Lu, Y.C., Guo, P., Wang, X.F., 2013. Bioconversion of un-pretreated lignocellulosic materials by a microbial consortium XDC-2. Bioresour. Technol. 136, 481–487. Wang, Z., Cheng, Q.S., Liu, Z.Y., Qu, J.B., 2019. Evaluation of methane production and energy conversion from corn stalk using furfural wastewater pretreatment for whole slurry anaerobic co-digestion. Bioresour. Technol. 239, 121–962. Wongwilaiwalin, S., Rattanachomsri, U., Laothanachareon, T., 2010. Analysis of a thermophilic lignocelluloses degrading microbial consortium and muti-species lignocellulolytic enzyme system. Enzyme Microb. Technol. 47, 283–290. Xu, Z.Z., Ben, Y., Chen, Z.L., 2018. Application and microbial ecology of psychrotrophs in domestic wastewater treatment at low temperature. Chemosphere 191, 946–953. Yan, L., Gao, Y., Wang, Y.J., Liu, Q., Sun, Z.Y., Fu, B.R., 2012. Diversity of a mesophilic lignocellulolytic microbial consortium which is useful for enhancement of biogas production. Bioresour. Technol. 111, 49–52. Zeng, Z.T., Xue, Y.G., Piao, X., 2018. Responses of microbial carbon metabolism and function diversity induced by complex fungal enzymes in lignocellulosic waste composting. Sci. Total Environ. 643, 539–547.
Acknowledgements This work was supported by National Key R&D Program of China (2019YFD1100603) and National Key Research and Development Plan Project of China (2017YFD0700705). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.biortech.2020.123064. References Cavicchioli, R., 2016. On the concept of a psychrophile. ISME J 10, 793–795. Chen, H., Liu, J., Chang, X., Chen, D., Xue, Y., 2017. A review on the pretreatment of lignocellulose for high-value chemicals. Fuel Process. Technol. 160, 196–206. Cui, Z.J., Yuan, X.F., Ma, L., Wen, B.T., 2016. Enhancing anaerobic digestion of cotton stalk by pretreatment with a microbial consortium (MC1). Bioresour. Technol. 207, 293–301. Editorial Committee of China Agriculture Yearbook, 2018. China Agriculture Yearbook. China Agriculture Press, Beijing, pp. 177. Fang, X.X., Li, Q.M., Lin, Y.Q., Lin, X.L., Dai, Y.Q., 2018. A screening of a microbial consortium for selective degradation of lignin from tree trimmings. Bioresour. Technol. 254, 247–255. Huang, Z., Qie, Y., Wang, Z., Zhang, Y., Zhou, W., 2015. Application of deep-sea treatment of psychrotolerant bacteria in wastewater treatment by aerobic dynamic membrane bioreactors at low temperature. J. Membr. Sci. 475, 47–56. Honeina, K., Kanekoa, G., 2012. Studies on the cellulose-degrading system in a shipworm and its potential applications. Energy Procedia 18, 1271–1274. Liu, C.M., Akiber, C.F., Wachemo.,, 2018. Biogas production and microbial community
4