Deletion of loop fragment adjacent to active site diminishes the stability and activity of exo-inulinase

International Journal of Biological Macromolecules 92 (2016) 1234–1241

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac

Deletion of loop fragment adjacent to active site diminishes the stability and activity of exo-inulinase Maryam Rezaei Arjomand a,c , Mehran Habibi-Rezaei a,b,∗ , Gholamreza Ahmadian c,∗∗ , Malihe Hassanzadeh d , Ali Asghar Karkhane c , Mandana Asadifar a , Massoud Amanlou d a

School of Biology, College of Science, University of Tehran, Tehran, Iran Nano-Biomedicine Center of Excellence, Nanoscience and Nanotechnology Research Center, University of Tehran, Tehran, Iran c Department of Industrial and Environmental Biotechnology, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran d Department of Medicinal Chemistry & Drug Design and Development Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran, Iran b

a r t i c l e

i n f o

Article history: Received 14 May 2016 Received in revised form 4 August 2016 Accepted 11 August 2016 Available online 12 August 2016 Keywords: Exo-inulinase -Loop Site-directed mutagenesis Functional thermostability Catalytic performance

a b s t r a c t Inulinases are classified as hydrolases and widely used in the food and medical industries. Here, we report the deletion of a six-membered adjacent active site loop fragment (74 YGSDVT79 sequence) from third -loop of the exo-inulinase containing aspartate residue from Aspergillus niger to study its structural and functional importance. Site-directed mutagenesis was used to create the mutant of the exo-inulinase (6SL). To investigate the stability of the region spanning this loop, MD simulations were performed 80 ns for 20-85 residues. Molecular docking was performed to compare the interactions in the active sites of enzymes with fructose as a ligand. Accordingly, the functional thermostability of the exo-inulinase was significantly decreased upon loop fragment deletion. Evaluation of the kinetics parameters (Vmax , Km , kcat and, kcat /Km ) and activation energy (Ea ) of the catalysis of enzymes indicated the importance of the deleted sequence on the catalytic performance of the enzyme. In conclusion, six-membered adjacent active site loop fragment not only plays a crucial role in the stability of the enzyme, but also it involves in the enzyme catalysis through lowering the activation energy of the catalysis and effective improving the catalytic performance. © 2016 Published by Elsevier B.V.

1. Introduction Inulin is a reserve polyfructan in the Compositae and Gramineae, typically in the roots and tubers of a wide range of plants such as Jerusalem artichoke, chicory, and dahlia, consisting of D-fructose monomers linked to each other by ␤(2 → 1) linkage, and a D-glucose unit at the reducing end [1,2]. Inulinases have a wide range of industrial applications and acting on inulin as a substrate [3]. These enzymes have been reported in plants, fungi, yeasts and bacteria [1]. Inulinases are classified as glycoside hydrolase family 32 (GH32), (CAZy) (http://www.cazy.org/), and are divided into two types according to the mode of action on inulin: endo-inulinase (1-␤-D-fructan fructanohydrolase, EC 3.2.1.7) and exo-inulinase

∗ Corresponding author at: School of Biology, College of Science, University of Tehran, Tehran, Iran. ∗∗ Corresponding author at: Department of Industrial and Environmental Biotechnology, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran. E-mail addresses: [email protected] (M. Habibi-Rezaei), [email protected] (G. Ahmadian). http://dx.doi.org/10.1016/j.ijbiomac.2016.08.039 0141-8130/© 2016 Published by Elsevier B.V.

(␤-D-fructan fructohydrolase, EC 3.2.1.80) [4]. Exo-inulinases are distinct from endo-inulinases by their ability to hydrolyse sucrose and split the terminal fructosyl residues from the nonreducing end of inulin [1] whereas endo-inulinases hydrolyze the internal bonds of inulin to yield FOS [5]. Inulinases have a potential to use for industrial production of high-fructose syrup (HFS), inulooligosaccharides, and bioethanol [3,6]. Various applications of inulinases encourage researchers to screen for new sources of inulinases, cloning of inulinase genes and optimization of process parameters for the production of inulinases [6]. Inulinase from Aspergillus niger, one of the most investigated species for production of inulinase, was first discovered by Pringsheim and Kohn in 1924 [1,6] and production of endo- and exo-inulinases from a strain of Aspergillus niger was first reported by Nakamura and co-workers in 1978 [6]. The tertiary structures of GH32 family members are well conserved and composed of Nterminal and C-terminal domains: the N-terminal domain contains five-bladed beta-propeller fold that embraces the active site of the enzyme. The C-terminal domain consists of a beta-sandwich-like

M.R. Arjomand et al. / International Journal of Biological Macromolecules 92 (2016) 1234–1241

structure [7]. Generally, most residues contribute in periodical secondary structures including ␣-helices and ␤-sheets. Also, some residues contribute in non-periodical secondary structures that are featured by the lack of the periodic dihedral angles and periodic hydrogen bonding patterns, including loops. They not only link repetitive secondary-structure elements together, but also due to their dominant presence in the surface, they are largely responsible for the structural, dynamics, physiochemical and fuctional properties of a given protein [8]. Among them, -loops are frequently situated clustered on the surface of a protein and contain mostly of 6-16 amino acid residues [9]. Since the first definition of omega-loops in 1986 [10], their structural and functional importance has been emphasized. It has become clear that omega-loops are often vitally important and they are involved in protein-protein interactions, recognition, catalysis and protein stability [11]. Particularly a type of functional -loop forms “lids” over the active sites of proteins and mutagenesis experiments have revealed that residues within these loops are crucial for substrate binding or enzymatic catalysis [12]. Although -loops are placed at the protein surface, but the occurrence of the charged residues in these structures is low. However, aspartic acid (D) is an exception and frequently occurs in the -loops [9]. Moreover, acidic residues have been reported to be essential for enzyme activity in the GH32 family [13]. In the present study, a comparison was made between the mutant (third -loop six-membered fragment deletion; 6SL) and the native exo-inulinases from Aspergillus niger 5012 to investigate the role of this loop integrity in the stability and function of the enzyme. 2. Materials and methods

1235

MD simulations for the native and mutant enzymes (2085 residues) were performed by the GROMACS v4.6.5 program [19] with the Amber99SB force field. During the MD simulations, the proteins were placed in a cubic box with 0.9 nm containing TIP3P water molecules. To neutralize the system’s total charge, Na+ and Cl− counter ions being exchanged with the water molecules. The system was energy minimized with a tolerance of 1000 kJ mol−1 nm−1 by steepest descent algorithm. The system proceeded via an NVT ensemble MD simulation for 20 ps. Then, MD simulation was performed for 80 ns; it was started at 310 K for 50 ns and followed in 318, 333 and, 343 K for each temperature 10 ns (MD simulation at each temperature was followed the MD simulation of the previous temperature) with a time step of 2 fs, using NPT in a periodic boundary state. A twin-range cutoff of 1.4 nm and, 1.2 nm was used for the van der Waals and, electrostatic interactions, respectively. The dynamic motion of the region of the study was analyzed by calculation of the root mean square deviation (RMSD) and root mean square fluctuation (RMSF). Hydrogen bonds and hydrophobic interactions of residues of the deleted region (74 YGSDVT79 ) of native enzyme with neighbor residues were analyzed and presented by LigandScout v3.12 [20]. Rigid docking was performed using AutoDock v4.2 software [21]. A grid box with a size of 50 × 50 × 50 A´˚ grid points and with a grid point spacing of 0.375 A´˚ was used for docking studies. The 2D structure of fructose as ligand was designed using ChemAxon (http://www.chemaxon.com/). Then 3D structure of the fructose was modeled and energy minimized and, saved in mol2 format. Bioinformatics data were analyzed and presented using Discovery studio v3.5 [22], PyMOL software [23], LigandScout v3.12 [20] and LigPlot v1.4.5 [24].

2.1. Materials Substances related to bacterial and fungi cultures were obtained from Merck Company. Kanamycin antibiotic was received from Roche. Other materials used in this study were acquired from Merck or Sigma Company. All solutions were prepared using doubledistilled water. 2.2. Strains, culture condition, and plasmid Aspergillus niger strain 5012 (PTCC 5012) was prepared from the Persian Type Culture Collection. Fungi were cultivated in the medium containing 2% w/v malt extract, 2% w/v glucose, and 0.1% w/v Peptone. Culture was incubated at 24 ◦ C with shaking at 150 rpm for 16–18 h. E. coli strain DH5␣ was applied for the cloning process and strain BL21 (DE3) was used as a host for expression of the enzymes. The bacteria grew in Luria-Bertani medium, containing 1% w/v NaCl, 1% w/v trypton and, 0.5% w/v yeast extract. The pET-26b (+) vector (Novagen) was applied for both cloning and expression of enzymes. 2.3. Bioinformatics analysis The sequence of A. niger exo-inulinase (accession no. AAR31730.1) was obtained from the NCBI web service (http:// www.ncbi.nlm.nih.gov/). Tertiary structures of the native and 6SL exo-inulinases were predicted using I-TASSER server [14–16]. I-TASSER is an automated online server for protein structure and function prediction. To further investigate the quality of the predicted models, Verify-3D [17], ProSA-web [18] and, ERRAT2 (http://services.mbi.ucla.edu/ERRAT/) were used. The predicted 3D structures of the enzymes were energy minimized by GROMACS v4.6.5 [19] and employed in the other bioinformatics studies, including molecular dynamics (MD) simulations and docking studies.

2.4. Cloning The A. niger 5012 exo-inulinase gene was amplified using specific primers listed in Table 1, corresponding to the 5 and 3 end of the exo-inulinase gene; genomic DNA of A. niger 5012 fungi as a template and pfu DNA polymerase (Fermentas). Since the coding region of this gene contains an intron that is 60 bp long, overlap PCR was used to delete the intron region. NdeI (Fermentas) and NotI (Fermentas) restriction enzymes were applied for digestion of the gene and pET-26b (+) vector. Transformation of E. coli DH5␣ competent cells was performed using heat shock at 42 ◦ C for 90 s. Transformants were selected on Luria Bertani (LB) containing kanamycin (50 ␮g/ml).

2.5. Site-directed mutagenesis The “Overlap extension PCR mutagenesis” method was applied to delete the 74 YGSDVT79 sequence in the N-terminal domain of the enzyme and creation of the mutant called 6SL. Briefly, in the first step of PCR (PCR PreMix Kit, iNtRON) two fragments were amplified using a pair of InuFforw and loopdelrev primers for amplification of the first fragment ( 244bp) and a pair of loopdelforw and InuFrev primers for the second fragment ( 1344bp). The products of PCR (fragment 1 & 2) were then purified (High Pure PCR Product Purification Kit, Roche) and were applied for the second step of PCR with a pair of InuFforw and InuFrev primers. As a result, the 74 YGSDVT79 sequence was deleted from the native gene and 6SL mutant was created (1539 bp). The insert DNA was sequenced to confirm accuracy of cloning. All steps in cloning were similar to the stages that were used for the native form of enzyme. All primers were used for this step were shown in Table 1.

1236

M.R. Arjomand et al. / International Journal of Biological Macromolecules 92 (2016) 1234–1241

Table 1 The primers were used in this study (overhang regions were marked with underline). Primer

Sequence (5 –3 )

InuFforw InuFrev Introndelforw Introndelrev loopdelforw loopdelrev

GGGG CATATG TTCAACTATGACCAGCCTTAC GGGG GCGGCCGC ATTCCACGTCGAAGTAATATTG GTTGCCATGTATACTTCCTATTACCCCGTTGCGCAGACATTG CAATGTCTGCGCAACGGGGTAATAGGAAGTATACATGGCAAC CTTCTGGCCCGAGGAGAGATGTACTTCAGCGGAAGTG GCTGAAGTACATCTCTCCTCGGGCCAGAAGGGC

2.6. Expression and purification 1% v/v of bacterial pre-culture was inoculated into Luria Bertani (LB) medium and incubated at 37 ◦ C for 3-4 h. In order to increase the amount of soluble proteins, the bacterial culture was heat shocked at 60 ◦ C for 20 min before induction (modified protocol from [25]). The bacterial cells were induced at OD600nm : 1.5 with 10% lactose and incubated at 18-20 ◦ C with shaking at 90 rpm for several days. After centrifugation of the bacterial culture for 10 min at 2000 × g (Beckman centrifuge), bacterial pellet was resuspended in buffer containing 50 mM sodium phosphate buffer (pH 8.0), 300 mM NaCl, 1 mM PMSF, 10 mM imidazole and, 0.05% v/v Tween-20 and sonicated on ice (6 cycles of 30 s at 7 ␮m with 30 s intervals). Samples were centrifuged at 4500 × g for 30 min and post-sonication supernatant containing active enzymes was stored at -20 ◦ C. Ni-NTA affinity chromatography was used to purify the enzymes. Post-sonication supernatant of the bacterial culture was added to nickel beads and rotated for 1 h at 4 ◦ C. Samples were centrifuged at 500 × g for 2 min and pellets (6xHis-tagged proteins bound to nickel beads) were resuspended in washing buffers, 1-4, [wash buffer 1; 50 mM NaH2 PO4 (pH 8.0), 2 M NaCl, 40 mM imidazole, 0.05% v/v Tween20, 1% v/v TritonX100, wash buffer 2; same as wash buffer 1 without TritonX100, wash buffer 3 and 4; 50 mM NaH2 PO4 (pH 8.0), 300 mM NaCl, 20 mM imidazole]. For each washing step, samples were rotated for about 30 min at 4 ◦ C and were centrifuged at 500 × g for 2 min. After washing steps, pellets were resuspended in elution buffer containing 50 mM NaH2 PO4 (pH 8.0), 300 mM NaCl, 250 mM imidazole and rotated at 4 ◦ C for 40 min. Samples were then centrifuged at 500 × g for 2 min and the supernatants containing purified enzymes were dialyzed against 100 mM sodium acetate buffer (pH 5.0) at 4 ◦ C. The quality of the purified enzymes was investigated by SDS-PAGE 10% and protein concentration was determined by spectrophotometric analysis, NanoDrop (Thermo2000). 2.7. Functional analysis For the enzyme assay, 140-280 ng of the purified enzyme (in 10 ␮l, dissolved in 100 mM sodium acetate buffer, pH 5.0) was added to 140 ␮l inulin (chicory inulin, Orafti) (concentration; 2 mM prepared in 100 mM sodium acetate buffer, pH 5.0) then incubated at 50 ◦ C for 8 min. DNS method was used to detect the formation of reducing sugars released from inulin [26]. One unit of inulinase activity is determined as amount of enzyme that produced 1 ␮mol of fructose for 1 min under experimental conditions. The absorbance of samples was measured at 540 nm using spectrophotometer (Beckman, Du® 530). pH optima were determined using phosphate-citrate buffer (200 mM dibasic sodium phosphate; 100 mM citric acid) in the pH range of 2.6-7.0, at 50 ◦ C for 8 min. Optimum temperature was determined in the temperature range of 25-75 ◦ C, in 100 mM sodium acetate buffer (pH 5.0) for 8 min. In both cases, 140-280 ng of the purified enzyme (in 10 ␮l, dissolved in 100 mM sodium acetate buffer, pH 5.0) and 140 ␮l inulin (concentration; 2 mM prepared in 100 mM sodium acetate buffer, pH 5.0) were used.

The kinetics stability of enzymes is mostly shown as half-life (t1/2 ) of them at desired temperature [27]. Half-life (t1/2 ) is the time period that enzyme activity is diminished to half of its initial value [28]; t1/2 was calculated using Eq. (1). t 1/2 = ln0.5/(−kd ) = 0.693/kd

(1)

where, kd is the slope of the plot of lnA/A0 versus time in which, A and A0 are residual and initial activities (%), respectively. To study the thermostability, the enzymes were incubated in the temperature range of 4-70 ◦ C at desired time, then 140-280 ng of incubated enzymes were assayed at 50 ◦ C for 8 min using inulin (2 mM prepared in 100 mM sodium acetate buffer with pH 5.0) as a substrate. The Km (Michaelis-Menten constant) and Vmax (maximum initial velocity) were determined using different concentrations of inulin (0.5-3 mM) dissolved in 100 mM sodium acetate buffer (pH 5.0), at 50 ◦ C for 8 min. Lineweaver-Burk plot was used for determination of the Km and Vmax . To determine the Ea , enzymes and inulin were incubated in the temperature range of 25-55 ◦ C for 8 min. 140-280 ng of purified enzymes and 140 ␮l inulin (2 mM prepared in 100 mM sodium acetate buffer with pH 5.0) were used. The Arrhenius plot [ln (v or specific activity) versus 1/T] was applied to calculate the activation energy (Ea ) using Eq. (2). ka = –E a /R

(2) (kJ mol−1 )

where, ka is the slope of the Arrhenius plot, Ea is the activation energy and R is the universal gas constant (8.314 J mol−1 K−1 ). To study the substrate specificity, the inulin to sucrose hydrolysis ratios (I/S ratio) was determined. 2 mM inulin and 100 mM sucrose were separately prepared in 100 mM sodium acetate buffer (pH 5.0). Then 140-280 ng of enzymes (10 ␮l) were added to 140 ␮l of prepared substrates and incubated at 50 ◦ C for 8 min. 3. Result and discussion 3.1. Bioinformatics analysis The catalytic domain of the exo-inulinase composes of five blade-shaped ␤-sheets arranged around a central hole as a betapropeller fold [5]. Each blade consists of 2-4 stranded beta-sheet motifs in which strands are connected to each other using nonperiodical elements consisting of 9 -loops in the range of 6-16 residues (Fig. 1). They are placed on the protein surface and aspartic acid (D) with a frequent occurrence in the -loops [9] has been reported to be essential for enzyme activity as an acidic residue in the GH32 family [13]. Among them, the third loop composes fifteen residues and is responsible to connect the first and the second blades (Fig. 1). Here, we report deletion of a six-membered adjacent active site loop 3 fragment (74 YGSDVT79 sequence) of the exoinulinase from A. niger containing D-residue to explore its structural and functional importance. The 3D structures of the native and 6SL exo-inulinases were predicted by I-TASSER server using structure of exo-inulinase from Aspergillus awamori (PDB ID: 1Y4W) as a template; RMSD and TM-scores were 3.2 ± 2.2 and 0.99 ± 0.04 Å, respectively for both enzymes. To further investigate the quality of the predicted models, Verify-3D, ProSA-web and, ERRAT2 were used (Supplementary data). Predicted structures were energy minimized using GROMACS (Fig. 2a) and employed for MD simulations and docking studies. To explore the possible effect of loop fragment deletion on the structure of the protein, restricted MD simulations were performed in a sequential location which covers the deleted hexapeptide region; residues 20-85. Molecular dynamics simulations

M.R. Arjomand et al. / International Journal of Biological Macromolecules 92 (2016) 1234–1241

1237

Fig. 1. -loops in the range of 6-16 residues in the catalytic domain of A. niger exo-inulinase. Data were obtained from I-TASSER server and 3D structure of the enzyme was presented by UCSF Chimera v1.5.3 (http://www.cgl.ucsf.edu/chimera) [29]. NR*; number of amino acid residue in the corresponding sequence, PSA**; predicted solvent accessibility as index determined by I-TASSER server, that is in the values range from 0 (buried residue) to 9 (highly exposed residue).

provide information about the structure and dynamics of a protein, and also reveal the relationship between dynamics of protein to its stability and activity [30,31]. As shown in Fig. 2b, RMSD value vs. time graphs were predicted that deletion of 74 YGSDVT79 fragment leads to the significant structural change of this region. More importantly, RMSD value of 6SL exo-inulinase is higher than the RMSD value of the native enzyme. Moreover, RMSF value indicates flexibility of a macromolecule structure and higher RMSF value signifies higher flexibility [30,31]. As shown in Fig. 2c, RMSF values show that more residues of the 6SL exo-inulinase have higher RMSF values than residues from native enzyme. As a result, RMSD and RMSF data predicted that deleted fragment has a role in rigidity of this region of the enzyme. Since conditions that lead to destabilize any part of a protein structure are likely to destabilize the whole protein, we hypothesized that deleted fragment has a possible role in stability of the enzyme. Using LigandScout it can be deduced that the hexa-peptide (74 YGSDVT79 ) not only contributes to the protein-solvent interactions, but also is involved in multiple intra-molecular hydrogen bonds and hydrophobic interactions (Fig. 3a). Loops with more than average number of hydrogen bonds or hydrophobic interactions may have roles in protein folding and stability [9]. Accordingly, zooming in hexa-peptide fragment from -loop 3, showed that it might play an important role in exo-inulinase stability due to involvement in 5 hydrogen bonds and 4 hydrophobic interactions. Molecular docking analysis of the active site region of both enzymes (native and 6SL) with fructose as a ligand was also carried out. To verify the validity of AutoDock v4.2 program, the cocrystallized fructose was removed from the crystal structure of exo-inulinase from A. awamori (PDB ID: 1Y4W) and redocked within the binding cavity of enzyme. As shown in Fig. 3b and c, although the pattern of the hydrophobic interactions is almost preserved, but the pattern of hydrogen binding between active site residues and the substrate is completely changed upon hexa-peptide fragment deletion. As a result, binding energy between fructose and enzymes is attenuated from −2.26 kJ mol− –1 in the native enzyme (Fig. 3b), to –1.96 kJ mol− –1 in 6SL exo-inulinase (Fig. 3c) by examined hexapeptide fragment deletion.

3.2. Cloning and site-directed mutagenesis A. niger 5012 exo-inulinase gene (1558 bp without signal peptide) was cloned and overlap PCR technique was then applied for deletion of the intron from native enzyme and creation of 6SL

mutant. The insert DNA was sequenced to confirm accuracy of cloning. 3.3. Expression and purification Ni-NTA affinity chromatography was applied for purification of the enzymes. Expression of the native and 6SL exo-inulinases resulted in single bands of 58.5 and 58kDa according to the result of SDS-PAGE analysis, respectively (data not shown). 3.4. Functional analysis Enzyme assay was carried out to analyse the effect of the deletion on structure and function of the native and mutant proteins. Fig. 4 shows the result of comparative kinetics analysis of the pH and temperature effects on the native and 6SL exo-inulinases. Accordingly, the optimum pH was increased from 3.9 to 4.3, upon fragment deletion (Fig. 4a). The optimum pH values of inulinases activity have been mostly reported in the range of 4.0-5.5 [6]. Moreover, 12 ◦ C decreases in optimum temperature was observed upon fragment deletion such that the optimum temperature deleteriously decreased from 65 to 53 ◦ C for the native and 6SL exo-inulinases, respectively (Fig. 4b). The optimum temperatures of the inulinases activity have been usually reported in the range of 50-60 ◦ C [3]. A comparison of functional thermostability of the native and 6SL exo-inulinases is shown in Fig. 5. Moreover, half-lives (t1/2 ) of enzymes are compared in the table provided by Fig. 5. As depicted, enzyme activity is vigorously decreased upon loop fragment deletion at temperatures in the range of 4-70 ◦ C (Fig. 5). As shown, the native exo-inulinase retained its full acitivity even after 60 days incubation at 25, 37 and 45 ◦ C, however, 6SL exo-inulinase crucially lost its activity in the same condition. Accordingly, deletion of the hexa-peptide fragment had a deleterious impact on the thermostability of the enzyme that suggests the importance of the loop and their residues on structural and functional stability of exoinulinase. Almost similar conclusion on the stabilizing effect of the loop structures have been previously reported for the other proteins such as pea lectin [32] and dihydrofolate reductase from E. coli [33]. The kinetics parameters of the native and 6SL exo-inulinases were also investigated. Fig. 6a shows the kinetics behavior of the native and 6SL exo-inulinases using Lineweaver-Burk plot. As summarized in table provided at the bottom of Fig. 6, the Vmax of the native enzyme is decreased upon hexa-peptide deletion from

1238

M.R. Arjomand et al. / International Journal of Biological Macromolecules 92 (2016) 1234–1241

Fig. 2. (a) Prediction of the 3D structure of the native exo-inulinase from A. niger 5012 using I-TASSER server after energy minimization by GROMACS v4.6.5. Active site region is shown by black circle and deleted region of -loop 3 is shown with an asterisk, figure was prepared using PyMOL software. (b & c) MD simulations data of native and 6SL enzymes at final temperature (343 K). (b) RMSD graphs of 20-85 residues. (c) RMSF graphs of 20-85 residues. Blue color represented native enzyme and, pink 6SL (for interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.

4384.27 ± 209.94 to 2368.92 ± 168.62 ␮mol min−1 mg−1 , while the Km increased from 1.88 ± 0.14 to 2.86 ± 0.24 mM. As shown in Fig. 6a, the observed inactivation mode of 6SL exo-inulinase represents a mixed inhibition pattern. However, the effect of deletion of the 74 YGSDVT79 sequence in the third -loop, was more evident on substrate binding than the enzyme catalysis. Moreover, kcat and kcat /Km parameters were calculated for both of the native and 6SL exo-inulinases. These data suggest the importance of the integrity of the -loops in the catalytic function of the exo-inulinase again. Fig. 6b presents the Arrhenius plots regarding the catalytic function of the native and 6SL exo-inulinases in which the activation energy (Ea ) of the catalysis has been calculated using slopes and included in table at the bottom of Fig. 6. Accordingly, the activation energy has been increased from 24.56 ± 0.51 kJ mol−1 for the native protein to 26.88 ± 0.006 kJ mol−1 for 6SL exo-inulinase. Therefore, it can be deduced that deletion of the 74 YGSDVT79

sequence decreased the efficiency of the transition state stabilization in the active site of the 6SL exo-inulinase than the native enzyme which brings about lowering the catalytic performance 6SL exo-inulinase close to 2.8 folds. More importantly, Asp41 and Glu241 have been reported to play a role as a nucleophile through an acid/base catalysis in exo-inulinase from A. awamori and fructose as a substrate [5] and a double displacement mechanism of the reaction is resolute [5]. These residues are corresponding to Asp22 and Glu222 in A. niger, respectively, considering that 19 residues of signal peptide of exo-inulinase gene was deleted in cloning process. Glu222, as an important residue in the native enzyme, binds through two hydrogen bonds to the oxygens attached to C4 and C5 ´˚ respectively, of fructose with the bond distance of 2.89 and 2.86 A, while according to the docking results provided in Fig. 3c, Glu216 (correspond to Glu222 in native enzyme) from 6SL exo-inulinase binds to the fructose moieties by hydrophobic interaction instead

M.R. Arjomand et al. / International Journal of Biological Macromolecules 92 (2016) 1234–1241

1239

Fig. 3. (a) The contribution of the hexa-peptide fragment (74 YGSDVT79 ) in intra-molecular interactions, the picture was prepared by LigandScout v3.12. Green and red dashed lines represent hydrogen bond, while yellow color indicates hydrophobic interaction. T79 involves in four interactions with three residues including Q117 (one hydrogen bond), R72 (two hydrogen bonds) and, V115 (hydrophobic interaction). V78 involves in two hydrophobic interactions with A71 and, M81 . G75 involves in hydrogen bond with G73 . Y74 involves in hydrophobic interaction with L70 . Moreover, side-chain of Y74 involves in hydrogen bond with A71 . (b) The rigid docking of the native exo-inulinase with fructose as ligand (using AutoDock 4.2). (c) The rigid docking of the 6SL exo-inulinase with fructose as ligand (using AutoDock 4.2). Green dashed lines show hydrogen bond, while red semi-circular shapes represent hydrophobic interactions. Fructose molecule is violet in the center of figures. The figures represented using LigPlot v1.4.5 (for interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

Fig. 4. (a) pH optima and, (b) temperature optima of the native and 6SL exo-inulinases from A. niger 5012. To determine the pH optima, the activities were measured using 2 mM inulin prepared in phosphate-citrate buffer in the pH range of 2.6-7, 50 ◦ C for 8 min. To determine the temperature optima, the activities were determinated in the temperature range of 25-75 ◦ C using inulin (2 mM prepared in 100 mM sodium acetate buffer, pH 5.0) for 8 min. Error bars represent the standard deviation obtained from at least three repeats of each assay.

of the hydrogen bonds. This might be one of the possible reasons involved in decreasing the activity of exo-inulinase as the result of loop fragment deletion in 6SL exo-inulinase. Inulinases also present invertase activity (S) beside their inulinase activity (I) [3]. If the ratio of inulinase to invertase activity (I/S ratio) is more than 10−2 , inulinase activity predominates and if this ratio is lower than 10−4 invertase activity overweights [3]. This tendency to inulin or sucrose may be related to differences in binding site affinity of inulinases [34]. As shown in Table 2, the I/S ratio of the native and 6SL exo-inulinases was obtained 0.18 ± 0.01 and, 0.25 ± 0.02 at 37 ◦ C and 0.26 ± 0.01 and, 0.32 ± 0.01 at 50 ◦ C, respec-

Table 2 The inulinase to invertase activity (I/S ratio) of the native and 6SL exo-inulinases at 37 ◦ C and 50 ◦ C. I/S ratio

Native 6SL

37 ◦ C

50 ◦ C

0.18 ± 0.01 0.25 ± 0.02

0.26 ± 0.01 0.32 ± 0.01

tively. Considering these data, the 6SL exo-inulinase has a more I/S ratio than native enzyme. We observed during MD simulations that deleted region was slowly moving away from the catalytic cen-

1240

M.R. Arjomand et al. / International Journal of Biological Macromolecules 92 (2016) 1234–1241

Fig. 5. Thermostability of the native and 6SL exo-inulinases from A. niger 5012 at various temperatures. Curves were applied for calculation of the half-lives (t1/2 ) of exoinulinases. The enzymes were incubated in desired temperatures in the range of 4-70 ◦ C in 100 mM sodium acetate buffer (pH 5.0), then incubated enzymes were assayed at intervals. Error bars show the standard deviation obtained from at least three repeats of each assay. Table provides the half-lives (t1/2 ) of the native and 6SL exo-inulinases.

Fig. 6. (a) Kinetics analysis of the native and 6SL exo-inulinases from A. niger 5012 using Lineweaver-Burk plots. Different concentrations of inulin (0.5-3 mM) were prepared in 100 mM sodium acetate buffer (pH 5.0), then 140-280 ng of enzymes were added to them and assayed at 50 ◦ C for 8 min. (b) Arrhenius plots were used for calculation of activation energy (Ea). For assay, 140-280 ng of enzymes were added to 140 ␮l inulin (2 mM) and incubated in the temperature range of 25-55 ◦ C for 8 min. Error bars show the standard deviations obtained from at least three repeats of each assay.

ter of the native enzyme (data not shown), implying that this region has a little interference with entrance of inulin to catalytic hole. As a result, deletion of this region leads inulin to bind the enzyme active

site more easily. According to the kinetics data (Fig. 6), in spite of facilitating of inulin entrance and binding to the active site, the rate

M.R. Arjomand et al. / International Journal of Biological Macromolecules 92 (2016) 1234–1241

of catalysis is lowered and collectively the catalytic performance is decreased upon loop fragment deletion. 4. Conclusion In conclusion, non-periodical secondary structures of proteins, including loops play important roles in structure, dynamics, physiochemical properties and function of the proteins [8] and can be considered as one of the important targets for bioengineering studies [10]. Therefore, it might be inferred that loop deletions and substitutions may result in severe effect on protein stability however, sometimes have little effect [9]. Although, it has been suggested that loop shortening results in protein stabilizing due to providing the less entropic loss [35] but here we are reporting that loop shortening through a loop fragment deletion in exo-inulinase not only brings about deleterious destabilizing effect but also effectively impacts on the enzyme catalytic performance. In the present study, the important role of a six-membered adjacent active site loop fragment (74 YGSDVT79 sequence) from third -loop of the exo-inulinase from A. niger has been explored and both bioinformatics and experimental data confirm the importance of this fragment in activity and stability of exo-inulinase. Conflict of interest

[6] [7]

[8] [9] [10] [11]

[12]

[13]

[14] [15] [16] [17] [18]

The Authors declare that they have no conflict of interest with the contents of this article.

[19]

Authors contributions

[20]

MRA conducted most of the experiments, analysed the results and wrote most of the paper. MHR conceived the idea for the project, designed the experiments, analysed data, wrote the manuscript. GA designed the experiments, supported the molecular section of the project, analysed data and wrote the manuscript. MH conducted the bioinformatics works. AAK contributed in the experiment designing. MAs contributed to the acquisition of data. MAm supported the bioinformatics works and analysed the related data. All authors approved the final manuscript. MHR is the guarantor of this work.

[21]

Acknowledgements The support of University of Tehran and Iran National Science Foundation (INSF) are gratefully acknowledged. This work was supported by a grant from National Institute of Genetic Engineering and Biotechnology (NIGEB) of Iran (Project no. 920701-I-475). Appendix A. Supplementary data

[22] [23]

[24]

[25]

[26] [27]

[28]

[29]

[30]

Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ijbiomac.2016. 08.039.

[31]

References

[32]

[1] E.J. Vandamme, D.G. Derycke, Microbial inulinases: fermentation process, properties, and applications, Adv. Appl. Microbiol. 29 (1983) 139–176. [2] K. Ohta, H. Akimoto, S. Matsuda, D. Toshimitsu, T. Nakamura, Molecular cloning and sequence analysis of two endoinulinase genes from Aspergillus niger, Biosci. Biotechnol. Biochem. 62 (1998) 1731–1738. [3] C. Neagu (Bonciu), G. Bahrim, Inulinases–a versatile tool for biotechnology, Innovative Rom. Food Biotechnol. 9 (2011) 1–11. [4] M. Karimi, M. Habibi–Rezaei, M. Safari, A.A. Moosavi–Movahedi, M. Sayyah, R. Sadeghi, J. Kokini, Immobilization of endo-inulinase on Poly-D-Lysine coated CaCO3 micro-particles, Food Res. Int. 66 (2014) 485–492. [5] R.A.P. Nagem, A.L. Rojas, A.M. Golubev, O.S. Korneeva, E.V. Eneyskaya, A.A. Kulminskaya, K.N. Neustroev, I. Polikarpov, Crystal structure of exo-inulinase

[33]

[34]

[35]

1241

from Aspergillus awamori: the enzyme fold and structural determinants of substrate recognition, J. Mol. Biol. 344 (2004) 471–480. N. Kango, S.C. Jain, Production and properties of microbial inulinases: recent advances, Food Biotechnol. 25 (2011) 165–212. W. Lammens, K. Le Roy, L. Schroeven, A. Van Laere, A. Rabijns, W. Van den Ende, Structural insights into glycoside hydrolase family 32 and 68 enzymes: functional implications, J. Exp. Bot. 60 (2009) 727–740. A. Fiser, A. Sali, ModLoop: automated modeling of loops in protein structures, Bioinformatics 19 (2003) 2500–2501. J.S. Fetrow, Omega loops: nonregular secondary structures significant in protein function and stability, FASEB J. 9 (1995) 708–717. J.F. Leszczynski, G.D. Rose, Loops in globular proteins: a novel category of secondary structure, Science 234 (1986) 849–855. J. Espadaler, E. Querol, F.X. Aviles, B. Oliva, Identification of function-associated loop motifs and application to protein function prediction, Bioinformatics 22 (2006) 2237–2243. D. Joseph, G.A. Petsko, M. Karplus, Anatomy of a conformational change: hinged  lid motion of the triosephosphate isomerase loop, Science 249 (1990) 1425–1428. A.M. Vandamme, C. Michaux, A. Mayard, I. Housen, Asparagine 42 of the conserved endo-inulinase INU2 motif WMNDPN from Aspergillus ficuum plays a role in activity specificity, FEBS Open Bio. 3 (2013) 467–472. J. Yang, R. Yan, A. Roy, D. Xu, J. Poisson, Y. Zhang, The I-TASSER suite: protein structure and function prediction, Nat. Methods 12 (2015) 7–8. A. Roy, A. Kucukural, Y. Zhang, I-TASSER: a unified platform for automated protein structure and function prediction, Nat. Protoc. 5 (2010) 725–738. Y. Zhang, I-TASSER server for protein 3D structure prediction, BMC Bioinform. 9 (2008) 40. J.U. Bowie, R. Lüthy, D. Eisenberg, A method to identify protein sequences that fold into a known three-dimensional structure, Science 253 (1991) 164–170. M. Wiederstein, M.J. Sippl, ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins, Nucleic Acids Res. 35 (2007) W407–W410. S. Pronk, R. Pall, P. Larsson, P. Bjelkmar, R. Apostolov, M.R. Shirts, P.M. Smith, D. Van der Spoel, B. Hess, E. Lindahl, GROMACS 4. 5: a high-throughput and highly parallel open source molecular simulation toolkit, Bioinformatics. 29 (2013) 845–854. G. Wolber, T. Langer, LigandScout: 3-D pharmacophores derived from protein-bound ligands and their use as virtual screening filters, J. Chem. Inf. Model. 45 (2005) 160–169. G.M. Morris, D.S. Goodsell, R.S. Halliday, R. Huey, W.E. Hart, R.K. Belew, A.J. Olson, Automated docking using a Lamarckian genetic algorithm and an empirical binding free energy function, J. Comput. Chem. 19 (1998) 1639–1662. Accelrys Software Inc., Discovery studio modeling environment, Release 4.0, Accelrys Software Inc., San Diego, CA, 2013. ´ T. Makarewicz, R. Kazmierkiewicz, Molecular dynamics simulation by GROMACS using GUI plugin for PyMOL, J. Chem. Inf. Model. 53 (2013) 1229–1234. A.C. Wallace, R.A. Laskowski, J.M. Thornton, LIGPLOT: a program to generate schematic diagrams of protein?ligand interactions, Protein Eng. 8 (1995) 127–134. C. Goosen, M.J.E.C. Van Der Maarel, L. Dijkhuizen, Exo-inulinase of Aspergillus niger N402: A hydrolytic enzyme with significant transfructosylating activity, Biocatal. Biotransform. 26 (2008) 49–58. G.L. Miller, Use of dinitrosalicylic acid reagent for determination of reducing sugar, Anal. Chem. 31 (1959) 426–428. C. Vieille, G.J. Zeikus, Hyperthermophilic enzymes: sources, uses, and molecular mechanisms for thermostability, Microbiol Mol. Biol. Rev. 65 (2001) 1–43. L.P.V. Calsavara, F.F. Moraes, G.M. Zanin, Thermal stability and energy of deactivation of free and immobilized cellobiase, Braz. J. Chem. Eng. 17 (2000) 841–848. E.F. Pettersen, T.D. Goddard, C.C. Huang, G.S. Couch, D.M. Greenblatt, E.C. Meng, T.E. Ferrin, UCSF Chimera-a visualization system for exploratory research and analysis, J. Comput. Chem. 25 (2004) 1605–1612. T. Lazaridis, I. Lee, M. Karplus, Dynamics and unfolding pathways of a hyperthermophilic and a mesophilic rubredoxin, Protein Sci. 6 (1997) 2589–2605. M.Z. Kamal, T.A.S. Mohammad, G. Krishnamoorthy, N.M. Rao, Role of active site rigidity in activity: MD simulation and fluorescence study on a lipase mutant, PLoS One 7 (2012) e35188. F.J. Hoedemaeker, R.R. Van Eijsden, C.L. Diaz, B.S. De Pater, J.W. Kijne, Destabilization of pea lectin by substitution of a single amino acid in a surface loop, Plant Mol. Biol. 22 (1993) 1039–1046. K. Gekko, K. Yamagami, Y. Kunori, S. Ichihara, M. Kodama, M. Iwakura, Effects of point mutation in a flexible loop on the stability and enzymatic function of Escherichia coli dihydrofolate reductase, Biochem 113 (1993) 74–80. T. Uchiyama, Metabolism in microorganisms part II. Biosynthesis and degradation of fructans by microbial enzymes other than levansucrase, in: M. Suzuki, N.J. Chatterton (Eds.), Science and Technology of Fructans, CRC Press, Boca Raton, FL, USA, 1993, pp. 169–190. M.W. Klemba, M. Munson, L. Regan, De novo design of protein structure and function, in: R.H. Angeletti (Ed.), Proteins Analysis and Design, Academic Press, San Diego, California, 1998, pp. 313–353.