- Email: [email protected]
Deletions in the repeating sequences of the toxin A gene of toxin A-negative, toxin B-positive Clostridium difficile strains
FEMS Microbiology Letters 175 (1999) 197^203
Deletions in the repeating sequences of the toxin A gene of toxin A-negative, toxin B-positive Clostridium di¤cile strains Haru Kato b
a;b
, Naoki Kato a; *, Shigetaka Katow c , Tsuneo Maegawa b , Shinichi Nakamura b , David M. Lyerly d
a Institute of Anaerobic Bacteriology, Gifu University School of Medicine, 40 Tsukasa-machi, Gifu 500-8705, Japan Department of Bacteriology, School of Medicine, Kanazawa University, 13-1 Takara-machi, Kanazawa 920-8640, Japan c Department of Viral Disease and Vaccine Control, National Institute of Infectious Diseases, 4-7-1 Gakuen, Musashi-Murayama 208-0011, Japan d TechLab, Blacksburg, VA 24060-6364, USA
Received 22 October 1998; received in revised form 13 April 1999; accepted 16 April 1999
Abstract The repeating sequences of the toxin A gene from toxin A-negative, toxin B-positive (toxin A3, toxin B+) strains of Clostridium difficile which were isolated in geographically separated facilities in Japan and Indonesia were determined. All six strains tested had identical repeating sequences with two deletions (1548 and 273 nucleotides in size) in the toxin A gene. A PCR method was designed to detect the deletions and the deletions were confirmed in all 50 toxin A3, toxin B+ strains examined by this method. Western immunoblot analysis revealed that polyclonal antiserum against native toxin A did not react with the concentrated culture filtrates of the toxin A3, toxin B+ strains. These results may suggest that toxin A3, toxin B+ strains have deletions of the two thirds of the repeating regions of the toxin A gene, which encodes the epitopes fully responsible for the reaction with the polyclonal antiserum. z 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Clostridium di¤cile ; Toxin A gene; Repeating sequence
1. Introduction Clostridium di¤cile, a principal pathogen causing antibiotic-associated diarrhea and colitis, is recognized as an important nosocomial pathogen. Toxins A (potent enterotoxin) and B (potent cytotoxin) produced by this organism play a major role in its enter-
* Corresponding author. Tel.: +81 (58) 2672342; Fax: +81 (58) 2638059; E-mail: [email protected]
opathogenicity [1,2]. The two toxins show 63% amino acid sequence homology and carry repetitive C-termini [3]. Nearly a third of the toxin A gene, at the 3P end, consists of 38 repeating nucleotide units [4] and the repetitive amino acid sequences encoded by repeating nucleotide units contain the cellbinding domain [5,6] and the enzymatic domain of toxin A is located in its N-terminal region [7]. The C-terminal amino acid regions also have epitopes recognized by the monoclonal antibody (mAb) PCG-4 [8] which is widely used in commercial en-
0378-1097 / 99 / $20.00 ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 9 ) 0 0 1 9 6 - 2
FEMSLE 8789 29-7-99
198
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
zyme-linked immunosorbent assay (ELISA) kits for toxin A detection [9]. All toxigenic strains were believed to produce both toxins A and B, but this has been found not always to be true [10^13]. We successfully used a PCR assay (with a primer set NK11-NK9) targeted to the repeating sequences of the toxin A gene to distinguish the strains which are toxin A3negative, toxin B-positive (toxin A3, toxin B+) strains from toxin A-positive, toxin B-positive (toxin A+, toxin B+) strains and toxin A-negative, toxin B-negative strains (toxin A3, toxin B3) [13]. By the PCR with NK11-NK9 primers, whereas toxin A+, toxin B+ strains generated an approximately 1200-bp product, a shorter segment of ca. 700 bp was ampli¢ed from toxin A3, toxin B+ strains [13], suggesting a constitutive di¡erence of the repetitive region between toxin A3, toxin B+ strains and toxin A+, toxin B+ strains [13]. In this study, we determined the whole repeating sequences of the toxin A gene of six toxin A3, toxin B+ strains. In addition, reverse transcriptase (RT)PCR was carried out to examine the transcription of the nonrepeating regions of the toxin A gene in toxin A3, toxin B+ strains and immunoblotting analysis was performed to detect a toxin A variant, if produced, with a polyclonal antiserum against native toxin A.
2. Materials and methods
various clinical settings were examined by PCR assay to con¢rm the deletion of the repeating regions of the toxin A gene. G95-13 was used as a representative of toxin A3, toxin B3 strains. 2.2. Sequencing analysis Bacterial genomic DNA was extracted and puri¢ed as described elsewhere [15]. Primers used for sequencing analysis are listed in Table 1. Primers NK16 and HK42 were originated at 330 nucleotides upstream from the beginning of the repeating sequences and at 26 nucleotides downstream from the stop codon, respectively, based on the published sequence of the toxin A gene in VPI10463 [4]. Primers NKV45 and NKV 46 were obtained from the results of sequencing for GAI95601. PCR ampli¢cation was performed as described previously [16,17]. The thermal pro¢le was 35 cycles comprising 95³C for 20 s for denature and 55³C for 2 min for annealing and extension. After electrophoresis, PCR products were puri¢ed by using Prep-AGene puri¢cation matrix kit (Bio-Rad, Richmond, CA, USA) and sequenced directly with ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems, Foster City, CA, USA) and 373 automatic DNA sequencer (PE Applied Biosystems). The DNA sequence analysis was performed by DNASIS software (Hitachi Software Engineering, Yokohama, Japan). 2.3. Nucleotide sequence accession number
2.1. Bacterial strains C. di¤cile strains used for sequencing analysis were the reference strain of serogroup F, ATCC 43598, and ¢ve toxin A3, toxin B+ clinical isolates which were isolated in geographically separated facilities in Japan and Indonesia: GAI 95601 and GAI 95603 from asymptomatic adults, GAI 95602 from a symptomatic adult, GAI 95600 and GAI 95606 from asymptomatic children. All strains were positive for toxin B by cell culture assay and negative for both toxin A by ELISA using monoclonal antibody and an ileal loop test in rabbits as reported previously [13]. All strains except for one (GAI 95606, serogroup X) were of serogroup F [14]. A total of 50 toxin A3, toxin B+ C. di¤cile strains isolated in
The repeating sequence of strain GAI95601 has been registered at the DDBJ database (accession number AB012304). 2.4. PCR assay to detect the deletion of the repeating regions of the toxin A gene PCR ampli¢cation was performed as described [13,17] for 35 cycles with modi¢cations. Brie£y, 1 Wl of DNA solution obtained by heat treatment of a bacterial colony was added to 30 Wl of a reaction solution comprising 0.75 U of TaKaRa Ex Taq (TaKaRa, Shiga, Japan), Ex Taq reaction bu¡er (TaKaRa), dNTP mixture (200 WM each), 4.5 ng of each primer. Primers used for PCR are shown in
FEMSLE 8789 29-7-99
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
Table 1. A hot start PCR using AmpliWax PCR Gem (TaKaRa) was carried out to obtain primerspeci¢c ampli¢cation. The cycling conditions for primer pair NK11-NK9 were 95³C for 20 s followed by 62³C for 2 min. PCR with primer pair NKV011NK9 was performed in a condition consisting of 95³C for 20 s and 60³C for 2 min. 2.5. RT-PCR analysis of transcription of the nonrepeating regions of the toxin A gene C. di¤cile VPI10463 and GAI95601 were cultured in each 10 ml of brain heart infusion (Difco Laboratories, Detroit, MI, USA), harvested at the early stationary phases of growth. Bacterial cells were suspended in 5% lysozyme (Sigma, St. Louis, MO, USA) in TE (10 mM Tris-HCl (pH 7.5), 1 mM EDTA) and frozen at 375³C for more than 1 day. Following thawing at 37³C, bacterial total RNA was extracted by using RNeasy Mini kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions. After ethanol precipitation following phenol/water/chloroform extraction, RNA samples were treated with 5 U Wl31 of DNase (Sigma) to remove contaminating DNA. Samples were again treated with phenol/water/chloroform followed by ethanol precipitation. Reverse transcription using 2 Wg of total RNA was performed with SuperScript Preampli¢cation System (Gibco BRL Life Technologies, Rockville, MD, USA) with random hexamers as per the manufacturer's instructions. PCR ampli¢-
199
cation was carried out with primers NK12 and NK2 (117-bp product) for a fragment of the nonrepeating region of the toxin A gene [17]. PCR with primers NK104 and NK105 was run with the same RNA sample to amplify a fragment of 204 bp of the toxin B gene [13], as transcription control. PCR ampli¢cation was carried out with or without RT during the initial cDNA generation to prove the non-DNA contamination in RNA samples tested. PCR products were analyzed with a 5% polyacrylamide gel electrophoresis (PAGE) followed by ethidium bromide staining. 2.6. PAGE and immunoblotting Strains of VPI10463, GAI95601, GAI95600, GAI95606, and G95-13 were grown anaerobically at 37³C for 72 h with the brain heart infusion dialysis £ask technique [18]. Precipitant of supernatant with ammonium sulfate was harvested by centrifugation, redissolved in 6 M urea in TBS (10 mM TrisHCl (pH 7.5), 150 mM NaCl), and dialyzed against TBS. The immunoblotting was performed as described previously [14]. The concentrated culture supernatant (15 Wg of total protein) and puri¢ed native toxin A were separated by 5% SDS-PAGE, electrophoretically transferred to a nitrocellulose membrane (Schleicher and Schuell, Dassel, Germany), and probed with a 1:500 diluted goat polyclonal antiserum against toxin A.
Table 1 Primers used in this study Primer Primer for sequencing NK16 HK42 HKV45 HKV46 Primer for PCR assay NK11 NK9 NKV011
Orientation
Nucleotide sequence (5P-3P)
Position
forward reverse forward reverse
TGGTCTACAGAAGGAAGTGA TAATTTCTTAGTAGCACAGG TTTGAGTATTTTGCACCTGC CATCCAGTAGCTGCTTCAGC
5215^5234a 8159^8178a 160^179b 337^356b
forward reverse forward
TGATGCTAATAATGAATCTAAAATGGTAAC CCACCAGCTGCAGCCATA TTTTGATCCTATAGAATCTAACTTAGTAAC
6795^6824a 8043^8060a , 678^695b 319^11b , 5526^5555c
a
The toxin A gene in VPI10463 [4]. The repeating sequence of the toxin A gene in GAI95601 (this study). c NKV011 primer has a mismatch of one nucleotide with the toxin A gene of VPI10463, 5P-TTTTGATCCTATAGAATTTAACTTAGTAAC3P, as indicated with an underline. b
FEMSLE 8789 29-7-99
200
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
3. Results 3.1. Sequences of the repeating portion of the toxin A gene Nucleotide sequences of the repeating portion of the toxin A gene in GAI95601 was determined. The size of the repeating sequences of GAI95601 was 741 nucleotides. Two in-frame deletion sites, 1548 nucleotides (nucleotide positions corresponding to 5839^7386 in VPI10463) and 273 nucleotides (7690^7962 in VPI10463) in length were found as compared with the corresponding sequence of VPI10463 [4] (Fig. 1). Three homologous regions (shaded boxes, Fig. 1) exhibited high identities (95^ 99%) between the two strains. Furthermore, sequencing analysis showed that the repeating sequences from four other clinical toxin A3 and toxin B+ strains and ATCC 43598 were identical with those of GAI95601. 3.2. Comparison of deduced amino acid sequences Comparisons of deduced amino acid sequences of the repeating units in GAI95601 and VPI10463 are
shown in Fig. 2. In GAI95601, there were 11 repeating units which consisted of two class I units (I1 and I6 ) and nine class II units according to the classi¢cation by Dove et al. [4]. The class II repeating units were composed of two class IIA, four class IIB, two class IIC, and one class IID. 3.3. PCR assay to detect the deletion of the repeating regions of the toxin A gene Although PCR with NK11-NK9 primers ampli¢ed DNA of approximately 700 nucleotides in 50 toxin A3, toxin B+ strains tested, the nucleotide sequences of primer NK11 were not found in the repeating region because of the deletion (Fig. 1). However, a sequence similar to that of primer NK11 was found to exist spanning from the end of the nonrepeating to the beginning of the repeating sequences in GAI95601. Then, primer NKV011 was designed according to the sequence results obtained (Fig. 1). PCR for DNA samples from GAI95601, GAI95600, and GAI95606 generated an amplicon with the same size (approximately 700 bp) using NKV011-NK9 primers as that seen in PCR using NK11-NK9 primers (Fig. 3). Hot start PCR to pro-
Fig. 1. Comparison of the repeating sequences of the toxin A gene in toxin A3, toxin B+ GAI95601 (data from the present study) and those of toxin A+, toxin B+ VPI10463 reported in the previous study [4].
FEMSLE 8789 29-7-99
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
201
Fig. 2. Comparison of deduced amino acid sequences of the repeating units of GAI95601 and VPI10463. Unit designations of class I and II (A, B, C, and D) peptides in VPI10463 strain are presented according to the classi¢cation by Dove et al. [4]. Amino acids identical between two strains are marked by dots and gaps of the sequence by dashes.
vide more stringent annealing condition yielded an amplicon in GAI95601 with the NKV011-NK9 primer set but not with the NK11-NK9 primer set (data not shown). PCR ampli¢cation with the NKV011NK9 primer set generated a PCR product of the same size as that of GAI95601 for the 50 toxin A3, toxin B+ strains. Although primer NKV011 has a mismatch of one nucleotide with the toxin A gene of VPI10463 (Table 1), PCR with NKV011NK9 primers and TaKaRa Ex Taq generated an amplicon with an expected size of approximately 2500 bp in VPI10463 (Fig. 3). 3.4. RT-PCR analysis of the gene transcription We used RT-PCR to investigate transcription of the nonrepeating regions of the toxin A gene. Examination by PCR of the RNA samples for which reverse transcription was performed revealed that both VPI10463 and GAI95601 transcribed a 117-bp portion of the nonrepeating regions of the toxin A gene
Fig. 3. PCR assay to di¡erentiate toxin A3, toxin B+ strains from toxin A+, toxin B+ strains. Primers used were NK9 and NKV011 which was designed according to the sequence results obtained in this study. PCR using TaKaRa Ex Taq (TaKaRa), which allows ampli¢cation of over 1 kb, ampli¢ed a DNA of 2535 bp for VPI10463 (toxin A+, toxin B+ strain) and a product of 714 bp for toxin A3, toxin B+ strains; GAI95601 (lane 3), GAI95600 (lane 4), and GAI95606 (lane 5). Lane 1, V-HindIII digest DNA marker (Bio-Rad) ; lane 6, strain G95-13 (toxin A3, toxin B3 strain).
FEMSLE 8789 29-7-99
202
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
Fig. 4. Western blot analysis with polyclonal antiserum against toxin A. Lane 1: native toxin A; lane 2: VPI10463 ; lane 3: GAI95601; lane 4: GAI95600 ; lane 5: GAI95606; lane 6: G9513. The arrow indicates 308 kDa.
(data not shown) as well as a segment of 204 bp of the toxin B gene (data not shown). No transcript was observed for the RNA samples of these two strains for which reverse transcription was not performed. 3.5. Western immunoblot analysis Western immunoblot analysis revealed that the polyclonal antiserum against toxin A does not react with the concentrated culture ¢ltrates from toxin A3, toxin B+ strains while native toxin A and VPI10463 demonstrated the positive band of 308 kDa (Fig. 4).
4. Discussion The present study revealed two deletions in the repeating sequences of the toxin A gene for six toxin A3, toxin B+ C. di¤cile strains isolated in di¡erent facilities. PCR with a NKV011-NK9 primer set, which speci¢cally ampli¢es a DNA fragment of almost the entire repeating region of the toxin A gene, revealed a PCR product with an expected size in all of the 50 toxin A3, toxin B+ strains tested. These results suggest that toxin A3, toxin B+ C. di¤cile strains commonly have identical deletions in the repeating portion and constitute a distinct toxin-producing type. Thus, PCR with the NKV011-NK9 or NK11-NK9 primer set can di¡erentiate toxin A3, toxin B+ strains of C. di¤cile strains from toxin A+, toxin B+ strains. Frey et al. reported that mAb PCG-4 recognizes two epitopes, residues 2097^2141 and 2355^2398 in
an amino acid sequence [8]. The nucleotide sequences encoding both epitopes were included in the portions that were found to be deleted in toxin A3, toxin B+ strains. These results are consistent with the fact that toxin A3, toxin B+ strains were negative for toxin A by ELISA using mAb PCG-4 [13]. In addition, toxin A3, toxin B+ strains gave negative results in the Western blotting with anti-toxin A polyclonal antiserum, suggesting that the epitopes recognized by the polyclonal antiserum are also located within the C-terminal region of toxin A. In addition, RT-PCR study showed at least in part the transcription of the nonrepeating sequence of the toxin A gene in a toxin A3, toxin B+ strain. But in our study no direct evidence was obtained to prove that the truncated toxin is actually produced from the toxin A of toxin A3, toxin B+ strains since we did not carry out further studies using Northern blot analysis allowing quantitative deletion of the full-length mRNA or Western blotting using antisera against synthesized polypeptides deduced from the sequence of the mutated toxin A gene. Further study using a transcriptional and translational fusion systems would clarify whether toxin A variant is actually produced by toxin A3, toxin B+ strains. We isolated a toxin A3, toxin B+ strain of C. di¤cile from a 14-year-old child who su¡ered from PMC (unpublished data), indicating possible enteropathogenicity of toxin A3, toxin B+ strains in humans. Riegler et al. have demonstrated that the human colon is more sensitive to the damaging e¡ects of toxin B than to the e¡ects of toxin A [19], suggesting that toxin B alone may cause intestinal disorders in the human. Further studies are needed to clarify the clinical signi¢cance of toxin A3, toxin B+ strains of C. di¤cile in humans.
Acknowledgments We thank Hiroko Minahara of The National Institute of Infectious Diseases for technical assistance and George E. Killgore of the CDC for editing.
References [1] Banno, Y., Kobayashi, T., Kono, H., Watanabe, K., Ueno,
FEMSLE 8789 29-7-99
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
K. and Nozawa, Y. (1984) Biochemical characterization and biologic actions of two toxins (D-1 and D-2) from Clostridium di¤cile. Rev. Infect. Dis. 6, S11^20. Lyerly, D.M., Krivan, H.C. and Wilkins, T.D. (1988) Clostridium di¤cile : its disease and toxins. Clin. Microbiol. Rev. 1, 1^18. von Eichel-Streiber, C., Laufenberg-Feldmann, R., Sartingen, S., Schulze, J. and Sauerborn, M. (1992) Comparative sequence analysis of the Clostridium di¤cile toxins A and B. Mol. Gen. Genet. 233, 260^268. Dove, C.H., Wang, S.Z., Price, S.B., Phelps, C.J., Lyerly, D.M., Wilkins, T.D. and Johnson, J.L. (1990) Molecular characterization of the Clostridium di¤cile toxin A gene. Infect. Immun. 58, 480^488. Krivan, H.C., Clark, G.F., Smith, D.F. and Wilkins, T.D. (1986) Cell surface binding site for Clostridium di¤cile enterotoxin : evidence for a glycoconjugate containing the sequence GalK1-3GalL1-4GlcNAc. Infect. Immun. 53, 573^581. Sauerborn, M., Leukel, P. and von Eichel-Streiber, C. (1997) The C-terminal ligand-binding domain of Clostridium di¤cile toxin A (TcdA) abrogates TcdA-speci¢c binding to cells and prevents mouse lethality. FEMS Microbiol. Lett. 155, 45^54. Faust, C., Ye, B. and Song, K.P. (1998) The enzymatic domain of Clostridium di¤cile toxin A is located within its N-terminal region. Biochem. Biophys. Res. Commun. 251, 100^105. Frey, S.M. and Wilkins, T.D. (1992) Localization of two epitopes recognized by monoclonal antibody PCG-4 on Clostridium di¤cile toxin A. Infect. Immun. 60, 2488^2492. Lyerly, D.M., Phelps, C.J. and Wilkins, T.D. (1985) Monoclonal and speci¢c polyclonal antibodies for immunoassay of Clostridium di¤cile toxin A. J. Clin. Microbiol. 21, 12^14. Lyerly, D.M., Barroso, L.A., Wilkins, T.D., Depitre, C. and Corthier, G. (1992) Characterization of a toxin A-negative, toxin B-positive strain of Clostridium di¤cile. Infect. Immun. 60, 4633^4639. Borriello, S.P., Wren, B.W., Hyde, S., Seddon, S.V., Sibbons,
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
203
P., Krishna, M.M., Tabaqchali, S., Manek, S. and Price, A.B. (1992) Molecular, immunological, and biological characterization of a toxin A-negative, toxin B-positive strain of Clostridium di¤cile. Infect. Immun. 60, 4192^4199. Depitre, C., Delmee, M., Avesani, V., L'Haridon, R., Roels, A., Popo¡, M. and Corthier, G. (1993) Serogroup F strains of Clostridium di¤cile produce toxin B but not toxin A. J. Med. Microbiol. 38, 434^441. Kato, H., Kato, N., Watanabe, K., Iwai, N., Nakamura, H., Yamamoto, T., Suzuki, K., Kim, S.M., Chong, Y. and Wasito, E.B. (1998) Identi¢cation of toxin A-negative, toxin Bpositive Clostridium di¤cile by PCR. J. Clin. Microbiol. 36, 2178^2182. Kato, H., Cavallaro, J.J., Kato, N., Bartley, S.L., Killgore, G.E., Watanabe, K. and Ueno, K. (1993) Typing of Clostridium di¤cile by western immunoblotting with 10 di¡erent antisera. J. Clin. Microbiol. 31, 413^415. Cartwright, C.P., Stock, F., Beekmann, S.E., Williams, E.C. and Gill, V.J. (1995) PCR ampli¢cation of rRNA intergenic spacer regions as a method for epidemiologic typing of Clostridium di¤cile. J. Clin. Microbiol. 33, 184^187. Kato, N., Ou, C.Y., Kato, H., Bartley, S.L., Brown, V.K., Dowell, V.R. Jr. and Ueno, K. (1991) Identi¢cation of toxigenic Clostridium di¤cile by the polymerase chain reaction. J. Clin. Microbiol. 29, 33^37. Kato, N., Ou, C.Y., Kato, H., Bartley, S.L., Luo, C.C., Killgore, G.E. and Ueno, K. (1993) Detection of toxigenic Clostridium di¤cile in stool specimens by the polymerase chain reaction. J. Infect. Dis. 167, 455^458. Sterne, M. and Wentzel, L.M. (1950) A new method for the large-scale production of high-titer botulinum Formol-toxoid types C and D. J. Immunol. 65, 175^183. Riegler, M., Sedivy, R., Pothoulakis, C., Hamilton, G., Zacherl, J., Bischof, G., Cosentini, E., Feil, W., Schiessel, R., LaMont, J.T. and Wenzl, E. (1995) Clostridium di¤cile toxin B is more potent than toxin A in damaging human colonic epithelium in vitro. J. Clin. Invest. 95, 2004^2011.
FEMSLE 8789 29-7-99
Deletions in the repeating sequences of the toxin A gene of toxin A-negative, toxin B-positive Clostridium di¤cile strains Haru Kato b
a;b
, Naoki Kato a; *, Shigetaka Katow c , Tsuneo Maegawa b , Shinichi Nakamura b , David M. Lyerly d
a Institute of Anaerobic Bacteriology, Gifu University School of Medicine, 40 Tsukasa-machi, Gifu 500-8705, Japan Department of Bacteriology, School of Medicine, Kanazawa University, 13-1 Takara-machi, Kanazawa 920-8640, Japan c Department of Viral Disease and Vaccine Control, National Institute of Infectious Diseases, 4-7-1 Gakuen, Musashi-Murayama 208-0011, Japan d TechLab, Blacksburg, VA 24060-6364, USA
Received 22 October 1998; received in revised form 13 April 1999; accepted 16 April 1999
Abstract The repeating sequences of the toxin A gene from toxin A-negative, toxin B-positive (toxin A3, toxin B+) strains of Clostridium difficile which were isolated in geographically separated facilities in Japan and Indonesia were determined. All six strains tested had identical repeating sequences with two deletions (1548 and 273 nucleotides in size) in the toxin A gene. A PCR method was designed to detect the deletions and the deletions were confirmed in all 50 toxin A3, toxin B+ strains examined by this method. Western immunoblot analysis revealed that polyclonal antiserum against native toxin A did not react with the concentrated culture filtrates of the toxin A3, toxin B+ strains. These results may suggest that toxin A3, toxin B+ strains have deletions of the two thirds of the repeating regions of the toxin A gene, which encodes the epitopes fully responsible for the reaction with the polyclonal antiserum. z 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Clostridium di¤cile ; Toxin A gene; Repeating sequence
1. Introduction Clostridium di¤cile, a principal pathogen causing antibiotic-associated diarrhea and colitis, is recognized as an important nosocomial pathogen. Toxins A (potent enterotoxin) and B (potent cytotoxin) produced by this organism play a major role in its enter-
* Corresponding author. Tel.: +81 (58) 2672342; Fax: +81 (58) 2638059; E-mail: [email protected]
opathogenicity [1,2]. The two toxins show 63% amino acid sequence homology and carry repetitive C-termini [3]. Nearly a third of the toxin A gene, at the 3P end, consists of 38 repeating nucleotide units [4] and the repetitive amino acid sequences encoded by repeating nucleotide units contain the cellbinding domain [5,6] and the enzymatic domain of toxin A is located in its N-terminal region [7]. The C-terminal amino acid regions also have epitopes recognized by the monoclonal antibody (mAb) PCG-4 [8] which is widely used in commercial en-
0378-1097 / 99 / $20.00 ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 9 ) 0 0 1 9 6 - 2
FEMSLE 8789 29-7-99
198
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
zyme-linked immunosorbent assay (ELISA) kits for toxin A detection [9]. All toxigenic strains were believed to produce both toxins A and B, but this has been found not always to be true [10^13]. We successfully used a PCR assay (with a primer set NK11-NK9) targeted to the repeating sequences of the toxin A gene to distinguish the strains which are toxin A3negative, toxin B-positive (toxin A3, toxin B+) strains from toxin A-positive, toxin B-positive (toxin A+, toxin B+) strains and toxin A-negative, toxin B-negative strains (toxin A3, toxin B3) [13]. By the PCR with NK11-NK9 primers, whereas toxin A+, toxin B+ strains generated an approximately 1200-bp product, a shorter segment of ca. 700 bp was ampli¢ed from toxin A3, toxin B+ strains [13], suggesting a constitutive di¡erence of the repetitive region between toxin A3, toxin B+ strains and toxin A+, toxin B+ strains [13]. In this study, we determined the whole repeating sequences of the toxin A gene of six toxin A3, toxin B+ strains. In addition, reverse transcriptase (RT)PCR was carried out to examine the transcription of the nonrepeating regions of the toxin A gene in toxin A3, toxin B+ strains and immunoblotting analysis was performed to detect a toxin A variant, if produced, with a polyclonal antiserum against native toxin A.
2. Materials and methods
various clinical settings were examined by PCR assay to con¢rm the deletion of the repeating regions of the toxin A gene. G95-13 was used as a representative of toxin A3, toxin B3 strains. 2.2. Sequencing analysis Bacterial genomic DNA was extracted and puri¢ed as described elsewhere [15]. Primers used for sequencing analysis are listed in Table 1. Primers NK16 and HK42 were originated at 330 nucleotides upstream from the beginning of the repeating sequences and at 26 nucleotides downstream from the stop codon, respectively, based on the published sequence of the toxin A gene in VPI10463 [4]. Primers NKV45 and NKV 46 were obtained from the results of sequencing for GAI95601. PCR ampli¢cation was performed as described previously [16,17]. The thermal pro¢le was 35 cycles comprising 95³C for 20 s for denature and 55³C for 2 min for annealing and extension. After electrophoresis, PCR products were puri¢ed by using Prep-AGene puri¢cation matrix kit (Bio-Rad, Richmond, CA, USA) and sequenced directly with ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems, Foster City, CA, USA) and 373 automatic DNA sequencer (PE Applied Biosystems). The DNA sequence analysis was performed by DNASIS software (Hitachi Software Engineering, Yokohama, Japan). 2.3. Nucleotide sequence accession number
2.1. Bacterial strains C. di¤cile strains used for sequencing analysis were the reference strain of serogroup F, ATCC 43598, and ¢ve toxin A3, toxin B+ clinical isolates which were isolated in geographically separated facilities in Japan and Indonesia: GAI 95601 and GAI 95603 from asymptomatic adults, GAI 95602 from a symptomatic adult, GAI 95600 and GAI 95606 from asymptomatic children. All strains were positive for toxin B by cell culture assay and negative for both toxin A by ELISA using monoclonal antibody and an ileal loop test in rabbits as reported previously [13]. All strains except for one (GAI 95606, serogroup X) were of serogroup F [14]. A total of 50 toxin A3, toxin B+ C. di¤cile strains isolated in
The repeating sequence of strain GAI95601 has been registered at the DDBJ database (accession number AB012304). 2.4. PCR assay to detect the deletion of the repeating regions of the toxin A gene PCR ampli¢cation was performed as described [13,17] for 35 cycles with modi¢cations. Brie£y, 1 Wl of DNA solution obtained by heat treatment of a bacterial colony was added to 30 Wl of a reaction solution comprising 0.75 U of TaKaRa Ex Taq (TaKaRa, Shiga, Japan), Ex Taq reaction bu¡er (TaKaRa), dNTP mixture (200 WM each), 4.5 ng of each primer. Primers used for PCR are shown in
FEMSLE 8789 29-7-99
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
Table 1. A hot start PCR using AmpliWax PCR Gem (TaKaRa) was carried out to obtain primerspeci¢c ampli¢cation. The cycling conditions for primer pair NK11-NK9 were 95³C for 20 s followed by 62³C for 2 min. PCR with primer pair NKV011NK9 was performed in a condition consisting of 95³C for 20 s and 60³C for 2 min. 2.5. RT-PCR analysis of transcription of the nonrepeating regions of the toxin A gene C. di¤cile VPI10463 and GAI95601 were cultured in each 10 ml of brain heart infusion (Difco Laboratories, Detroit, MI, USA), harvested at the early stationary phases of growth. Bacterial cells were suspended in 5% lysozyme (Sigma, St. Louis, MO, USA) in TE (10 mM Tris-HCl (pH 7.5), 1 mM EDTA) and frozen at 375³C for more than 1 day. Following thawing at 37³C, bacterial total RNA was extracted by using RNeasy Mini kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions. After ethanol precipitation following phenol/water/chloroform extraction, RNA samples were treated with 5 U Wl31 of DNase (Sigma) to remove contaminating DNA. Samples were again treated with phenol/water/chloroform followed by ethanol precipitation. Reverse transcription using 2 Wg of total RNA was performed with SuperScript Preampli¢cation System (Gibco BRL Life Technologies, Rockville, MD, USA) with random hexamers as per the manufacturer's instructions. PCR ampli¢-
199
cation was carried out with primers NK12 and NK2 (117-bp product) for a fragment of the nonrepeating region of the toxin A gene [17]. PCR with primers NK104 and NK105 was run with the same RNA sample to amplify a fragment of 204 bp of the toxin B gene [13], as transcription control. PCR ampli¢cation was carried out with or without RT during the initial cDNA generation to prove the non-DNA contamination in RNA samples tested. PCR products were analyzed with a 5% polyacrylamide gel electrophoresis (PAGE) followed by ethidium bromide staining. 2.6. PAGE and immunoblotting Strains of VPI10463, GAI95601, GAI95600, GAI95606, and G95-13 were grown anaerobically at 37³C for 72 h with the brain heart infusion dialysis £ask technique [18]. Precipitant of supernatant with ammonium sulfate was harvested by centrifugation, redissolved in 6 M urea in TBS (10 mM TrisHCl (pH 7.5), 150 mM NaCl), and dialyzed against TBS. The immunoblotting was performed as described previously [14]. The concentrated culture supernatant (15 Wg of total protein) and puri¢ed native toxin A were separated by 5% SDS-PAGE, electrophoretically transferred to a nitrocellulose membrane (Schleicher and Schuell, Dassel, Germany), and probed with a 1:500 diluted goat polyclonal antiserum against toxin A.
Table 1 Primers used in this study Primer Primer for sequencing NK16 HK42 HKV45 HKV46 Primer for PCR assay NK11 NK9 NKV011
Orientation
Nucleotide sequence (5P-3P)
Position
forward reverse forward reverse
TGGTCTACAGAAGGAAGTGA TAATTTCTTAGTAGCACAGG TTTGAGTATTTTGCACCTGC CATCCAGTAGCTGCTTCAGC
5215^5234a 8159^8178a 160^179b 337^356b
forward reverse forward
TGATGCTAATAATGAATCTAAAATGGTAAC CCACCAGCTGCAGCCATA TTTTGATCCTATAGAATCTAACTTAGTAAC
6795^6824a 8043^8060a , 678^695b 319^11b , 5526^5555c
a
The toxin A gene in VPI10463 [4]. The repeating sequence of the toxin A gene in GAI95601 (this study). c NKV011 primer has a mismatch of one nucleotide with the toxin A gene of VPI10463, 5P-TTTTGATCCTATAGAATTTAACTTAGTAAC3P, as indicated with an underline. b
FEMSLE 8789 29-7-99
200
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
3. Results 3.1. Sequences of the repeating portion of the toxin A gene Nucleotide sequences of the repeating portion of the toxin A gene in GAI95601 was determined. The size of the repeating sequences of GAI95601 was 741 nucleotides. Two in-frame deletion sites, 1548 nucleotides (nucleotide positions corresponding to 5839^7386 in VPI10463) and 273 nucleotides (7690^7962 in VPI10463) in length were found as compared with the corresponding sequence of VPI10463 [4] (Fig. 1). Three homologous regions (shaded boxes, Fig. 1) exhibited high identities (95^ 99%) between the two strains. Furthermore, sequencing analysis showed that the repeating sequences from four other clinical toxin A3 and toxin B+ strains and ATCC 43598 were identical with those of GAI95601. 3.2. Comparison of deduced amino acid sequences Comparisons of deduced amino acid sequences of the repeating units in GAI95601 and VPI10463 are
shown in Fig. 2. In GAI95601, there were 11 repeating units which consisted of two class I units (I1 and I6 ) and nine class II units according to the classi¢cation by Dove et al. [4]. The class II repeating units were composed of two class IIA, four class IIB, two class IIC, and one class IID. 3.3. PCR assay to detect the deletion of the repeating regions of the toxin A gene Although PCR with NK11-NK9 primers ampli¢ed DNA of approximately 700 nucleotides in 50 toxin A3, toxin B+ strains tested, the nucleotide sequences of primer NK11 were not found in the repeating region because of the deletion (Fig. 1). However, a sequence similar to that of primer NK11 was found to exist spanning from the end of the nonrepeating to the beginning of the repeating sequences in GAI95601. Then, primer NKV011 was designed according to the sequence results obtained (Fig. 1). PCR for DNA samples from GAI95601, GAI95600, and GAI95606 generated an amplicon with the same size (approximately 700 bp) using NKV011-NK9 primers as that seen in PCR using NK11-NK9 primers (Fig. 3). Hot start PCR to pro-
Fig. 1. Comparison of the repeating sequences of the toxin A gene in toxin A3, toxin B+ GAI95601 (data from the present study) and those of toxin A+, toxin B+ VPI10463 reported in the previous study [4].
FEMSLE 8789 29-7-99
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
201
Fig. 2. Comparison of deduced amino acid sequences of the repeating units of GAI95601 and VPI10463. Unit designations of class I and II (A, B, C, and D) peptides in VPI10463 strain are presented according to the classi¢cation by Dove et al. [4]. Amino acids identical between two strains are marked by dots and gaps of the sequence by dashes.
vide more stringent annealing condition yielded an amplicon in GAI95601 with the NKV011-NK9 primer set but not with the NK11-NK9 primer set (data not shown). PCR ampli¢cation with the NKV011NK9 primer set generated a PCR product of the same size as that of GAI95601 for the 50 toxin A3, toxin B+ strains. Although primer NKV011 has a mismatch of one nucleotide with the toxin A gene of VPI10463 (Table 1), PCR with NKV011NK9 primers and TaKaRa Ex Taq generated an amplicon with an expected size of approximately 2500 bp in VPI10463 (Fig. 3). 3.4. RT-PCR analysis of the gene transcription We used RT-PCR to investigate transcription of the nonrepeating regions of the toxin A gene. Examination by PCR of the RNA samples for which reverse transcription was performed revealed that both VPI10463 and GAI95601 transcribed a 117-bp portion of the nonrepeating regions of the toxin A gene
Fig. 3. PCR assay to di¡erentiate toxin A3, toxin B+ strains from toxin A+, toxin B+ strains. Primers used were NK9 and NKV011 which was designed according to the sequence results obtained in this study. PCR using TaKaRa Ex Taq (TaKaRa), which allows ampli¢cation of over 1 kb, ampli¢ed a DNA of 2535 bp for VPI10463 (toxin A+, toxin B+ strain) and a product of 714 bp for toxin A3, toxin B+ strains; GAI95601 (lane 3), GAI95600 (lane 4), and GAI95606 (lane 5). Lane 1, V-HindIII digest DNA marker (Bio-Rad) ; lane 6, strain G95-13 (toxin A3, toxin B3 strain).
FEMSLE 8789 29-7-99
202
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
Fig. 4. Western blot analysis with polyclonal antiserum against toxin A. Lane 1: native toxin A; lane 2: VPI10463 ; lane 3: GAI95601; lane 4: GAI95600 ; lane 5: GAI95606; lane 6: G9513. The arrow indicates 308 kDa.
(data not shown) as well as a segment of 204 bp of the toxin B gene (data not shown). No transcript was observed for the RNA samples of these two strains for which reverse transcription was not performed. 3.5. Western immunoblot analysis Western immunoblot analysis revealed that the polyclonal antiserum against toxin A does not react with the concentrated culture ¢ltrates from toxin A3, toxin B+ strains while native toxin A and VPI10463 demonstrated the positive band of 308 kDa (Fig. 4).
4. Discussion The present study revealed two deletions in the repeating sequences of the toxin A gene for six toxin A3, toxin B+ C. di¤cile strains isolated in di¡erent facilities. PCR with a NKV011-NK9 primer set, which speci¢cally ampli¢es a DNA fragment of almost the entire repeating region of the toxin A gene, revealed a PCR product with an expected size in all of the 50 toxin A3, toxin B+ strains tested. These results suggest that toxin A3, toxin B+ C. di¤cile strains commonly have identical deletions in the repeating portion and constitute a distinct toxin-producing type. Thus, PCR with the NKV011-NK9 or NK11-NK9 primer set can di¡erentiate toxin A3, toxin B+ strains of C. di¤cile strains from toxin A+, toxin B+ strains. Frey et al. reported that mAb PCG-4 recognizes two epitopes, residues 2097^2141 and 2355^2398 in
an amino acid sequence [8]. The nucleotide sequences encoding both epitopes were included in the portions that were found to be deleted in toxin A3, toxin B+ strains. These results are consistent with the fact that toxin A3, toxin B+ strains were negative for toxin A by ELISA using mAb PCG-4 [13]. In addition, toxin A3, toxin B+ strains gave negative results in the Western blotting with anti-toxin A polyclonal antiserum, suggesting that the epitopes recognized by the polyclonal antiserum are also located within the C-terminal region of toxin A. In addition, RT-PCR study showed at least in part the transcription of the nonrepeating sequence of the toxin A gene in a toxin A3, toxin B+ strain. But in our study no direct evidence was obtained to prove that the truncated toxin is actually produced from the toxin A of toxin A3, toxin B+ strains since we did not carry out further studies using Northern blot analysis allowing quantitative deletion of the full-length mRNA or Western blotting using antisera against synthesized polypeptides deduced from the sequence of the mutated toxin A gene. Further study using a transcriptional and translational fusion systems would clarify whether toxin A variant is actually produced by toxin A3, toxin B+ strains. We isolated a toxin A3, toxin B+ strain of C. di¤cile from a 14-year-old child who su¡ered from PMC (unpublished data), indicating possible enteropathogenicity of toxin A3, toxin B+ strains in humans. Riegler et al. have demonstrated that the human colon is more sensitive to the damaging e¡ects of toxin B than to the e¡ects of toxin A [19], suggesting that toxin B alone may cause intestinal disorders in the human. Further studies are needed to clarify the clinical signi¢cance of toxin A3, toxin B+ strains of C. di¤cile in humans.
Acknowledgments We thank Hiroko Minahara of The National Institute of Infectious Diseases for technical assistance and George E. Killgore of the CDC for editing.
References [1] Banno, Y., Kobayashi, T., Kono, H., Watanabe, K., Ueno,
FEMSLE 8789 29-7-99
H. Kato et al. / FEMS Microbiology Letters 175 (1999) 197^203
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
K. and Nozawa, Y. (1984) Biochemical characterization and biologic actions of two toxins (D-1 and D-2) from Clostridium di¤cile. Rev. Infect. Dis. 6, S11^20. Lyerly, D.M., Krivan, H.C. and Wilkins, T.D. (1988) Clostridium di¤cile : its disease and toxins. Clin. Microbiol. Rev. 1, 1^18. von Eichel-Streiber, C., Laufenberg-Feldmann, R., Sartingen, S., Schulze, J. and Sauerborn, M. (1992) Comparative sequence analysis of the Clostridium di¤cile toxins A and B. Mol. Gen. Genet. 233, 260^268. Dove, C.H., Wang, S.Z., Price, S.B., Phelps, C.J., Lyerly, D.M., Wilkins, T.D. and Johnson, J.L. (1990) Molecular characterization of the Clostridium di¤cile toxin A gene. Infect. Immun. 58, 480^488. Krivan, H.C., Clark, G.F., Smith, D.F. and Wilkins, T.D. (1986) Cell surface binding site for Clostridium di¤cile enterotoxin : evidence for a glycoconjugate containing the sequence GalK1-3GalL1-4GlcNAc. Infect. Immun. 53, 573^581. Sauerborn, M., Leukel, P. and von Eichel-Streiber, C. (1997) The C-terminal ligand-binding domain of Clostridium di¤cile toxin A (TcdA) abrogates TcdA-speci¢c binding to cells and prevents mouse lethality. FEMS Microbiol. Lett. 155, 45^54. Faust, C., Ye, B. and Song, K.P. (1998) The enzymatic domain of Clostridium di¤cile toxin A is located within its N-terminal region. Biochem. Biophys. Res. Commun. 251, 100^105. Frey, S.M. and Wilkins, T.D. (1992) Localization of two epitopes recognized by monoclonal antibody PCG-4 on Clostridium di¤cile toxin A. Infect. Immun. 60, 2488^2492. Lyerly, D.M., Phelps, C.J. and Wilkins, T.D. (1985) Monoclonal and speci¢c polyclonal antibodies for immunoassay of Clostridium di¤cile toxin A. J. Clin. Microbiol. 21, 12^14. Lyerly, D.M., Barroso, L.A., Wilkins, T.D., Depitre, C. and Corthier, G. (1992) Characterization of a toxin A-negative, toxin B-positive strain of Clostridium di¤cile. Infect. Immun. 60, 4633^4639. Borriello, S.P., Wren, B.W., Hyde, S., Seddon, S.V., Sibbons,
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
203
P., Krishna, M.M., Tabaqchali, S., Manek, S. and Price, A.B. (1992) Molecular, immunological, and biological characterization of a toxin A-negative, toxin B-positive strain of Clostridium di¤cile. Infect. Immun. 60, 4192^4199. Depitre, C., Delmee, M., Avesani, V., L'Haridon, R., Roels, A., Popo¡, M. and Corthier, G. (1993) Serogroup F strains of Clostridium di¤cile produce toxin B but not toxin A. J. Med. Microbiol. 38, 434^441. Kato, H., Kato, N., Watanabe, K., Iwai, N., Nakamura, H., Yamamoto, T., Suzuki, K., Kim, S.M., Chong, Y. and Wasito, E.B. (1998) Identi¢cation of toxin A-negative, toxin Bpositive Clostridium di¤cile by PCR. J. Clin. Microbiol. 36, 2178^2182. Kato, H., Cavallaro, J.J., Kato, N., Bartley, S.L., Killgore, G.E., Watanabe, K. and Ueno, K. (1993) Typing of Clostridium di¤cile by western immunoblotting with 10 di¡erent antisera. J. Clin. Microbiol. 31, 413^415. Cartwright, C.P., Stock, F., Beekmann, S.E., Williams, E.C. and Gill, V.J. (1995) PCR ampli¢cation of rRNA intergenic spacer regions as a method for epidemiologic typing of Clostridium di¤cile. J. Clin. Microbiol. 33, 184^187. Kato, N., Ou, C.Y., Kato, H., Bartley, S.L., Brown, V.K., Dowell, V.R. Jr. and Ueno, K. (1991) Identi¢cation of toxigenic Clostridium di¤cile by the polymerase chain reaction. J. Clin. Microbiol. 29, 33^37. Kato, N., Ou, C.Y., Kato, H., Bartley, S.L., Luo, C.C., Killgore, G.E. and Ueno, K. (1993) Detection of toxigenic Clostridium di¤cile in stool specimens by the polymerase chain reaction. J. Infect. Dis. 167, 455^458. Sterne, M. and Wentzel, L.M. (1950) A new method for the large-scale production of high-titer botulinum Formol-toxoid types C and D. J. Immunol. 65, 175^183. Riegler, M., Sedivy, R., Pothoulakis, C., Hamilton, G., Zacherl, J., Bischof, G., Cosentini, E., Feil, W., Schiessel, R., LaMont, J.T. and Wenzl, E. (1995) Clostridium di¤cile toxin B is more potent than toxin A in damaging human colonic epithelium in vitro. J. Clin. Invest. 95, 2004^2011.
FEMSLE 8789 29-7-99