Dementia rating and nicotinic receptor expression in the prefrontal cortex in schizophrenia

Dementia Rating and Nicotinic Receptor Expression in the Prefrontal Cortex in Schizophrenia Carmen M. Martin-Ruiz, Vahram H. Haroutunian, Philip Long, Allan H. Young, Kenneth L. Davis, Elaine K. Perry, and Jennifer A. Court Background: The etiology of dementia that occurs in patients with schizophrenia is not well understood. Nicotinic acetylcholine receptors have been implicated in cognitive function, and deficits in these receptors have been reported in schizophrenia. Methods: The present study investigates possible associations of nicotinic receptor subunit expression in the dorsal lateral prefrontal cortex, an area known to be affected in schizophrenia, and dementia rating. Results: ␣7 immunoreactivity was reduced by 20% to 28% and [3H]epibatidine binding was increased twofold in groups of patients with schizophrenia compared to normal control subjects matched for age, postmortem delay, and low levels of brain nicotine and cotinine. In contrast, no significant differences in ␣4, ␣3, or ␤2 immunoreactivity or ␣7 messenger RNA expression were observed in schizophrenia patients compared with control subject values. Clinical dementia ratings in patients with schizophrenia were correlated with neither [3H]epibatidine binding nor nicotinic receptor subunit expression. Conclusions: These data indicate no relationship between the trend for reduced neocortical ␣7 subunit protein expression in schizophrenia and dementia. Further investigations are required to establish whether the reduction in ␣7 protein in the dorsal lateral prefrontal cortex is associated with clinical features other than dementia in schizophrenia. Biol Psychiatry 2003;54: 1222–1233 © 2003 Society of Biological Psychiatry Key Words: Schizophrenia, nicotinic acetylcholine receptors, dorsolateral prefrontal cortex, ␣7, subunit expression, epibatidine binding

From the Institute for Ageing and Health (CMM-R, PL, EKP, JAC), Newcastle General Hospital, Newcastle upon Tyne, United Kingdom; Department of Psychiatry (VHH, KLD), Mt. Sinai School of Medicine, New York, New York; and Stanley Research Centre, School of Neurology, Neurobiology, and Psychiatry (AHY), University of Newcastle upon Tyne, Newcastle upon Tyne, United Kingdom. Address reprint requests to Jennifer A. Court, Newcastle General Hospital, Institute for Ageing and Health, MRC Building, Newcastle upon Tyne NE4 6BE, United Kingdom. Received October 1, 2002; revised February 13, 2003; accepted March 21, 2003.

© 2003 Society of Biological Psychiatry

Introduction

C

ognitive impairment is a recognized feature of schizophrenia, with patients often performing poorly on tests of memory and problem solving. Reports indicate that cognitive function in this patient group may either remain stable following the onset of symptoms or deteriorate with age, with progressive deficits associated with poor disease outcome, which in turn is likely to reflect increasing cerebral atrophy (reviewed in Harvey 2001). Over the last century, classical neuropathological studies have generally yielded no evidence of major brain changes (reviewed in Heckers 1997); more recent in vivo structural imaging (computed tomography [CT] and magnetic resonance imaging [MRI]) has confirmed subtle and variable brain changes in schizophrenia, with the most consistent findings being increased ventricular volume and involvement of temporal lobe structures (reviewed in Shenton et al 2001). Although concomitant Alzheimer’s disease (AD) pathology can occur in patients with schizophrenia (Prohovnik et al 1993), its frequency is not greater than that expected in the general population (Purohit et al 1998), and the profile of cognitive deficits in schizophrenia can, in many cases, be distinguished from that in AD. When patients with schizophrenia were compared with AD patients matched for global cognitive status, AD patients tended to perform better on naming and praxis tasks, whereas those with schizophrenia performed better on delayed recall (Davidson et al 1996). Neurotransmitter systems implicated in schizophrenia include dopamine, 5-hydroxytryptamine (5HT) (Kapur and Remington 1996; Sedvall and Farde 1995), glutamate (Breese et al 1995; Noga et al 1997), and possibly acetylcholine (Dean et al 1996; Tandon and Greden 1989). Dementia in the elderly, for example AD and dementia with Lewy bodies (DLB), is associated with reductions in cholinergic innervation of cortical areas and loss of nicotinic acetylcholine receptors (nAChRs) (Court et al 2000; Perry et al 1990; Tiraboschi et al 2000). In schizophrenia, no loss of cortical choline acetyltransferase (ChAT), a marker of cholinergic innervation (Haroutunian et al 1994), or reduction in the density of nucleus basalis 0006-3223/03/$30.00 doi:10.1016/S0006-3223(03)00348-2

Dementia, Schizophrenia, and nAChR Subunits

neurons (el-Mallakh et al 1991) appears to occur, although deficits in pontine ChAT have been reported (Karson et al 1993). There has been considerable interest in brain nAChRs in schizophrenia. These ligand-gated cation channels are composed of ␣ and ␤ subunits or solely ␣ subunits, with the most prevalent subtypes being associated with ␣4 and ␤2 or ␣7 subunits (Picciotto et al 2000). They are highly expressed during brain development (Court et al 1995, 1997; Hellstrom-Lindahl et al 1999) and have been implicated in memory, attention, and information processing (Picciotto et al 2000; Rezvani and Levin 2001). The involvement of nAChRs in the etiology of schizophrenia was initially suggested by the high proportion of smokers (de Leon et al 1995; Lohr and Flynn 1992; Ziedonis et al 1994), a report of reductions in the numbers of [3H]cytisine and [125I]␣-bungarotoxin binding sites in the hippocampus (Freedman et al 1995), and elevated levels of serum nAChR antibodies (Mukherjee et al 1994) in patients with schizophrenia compared with control subjects. More recently, reductions in [125I]␣-bungarotoxin binding have been observed in schizophrenic patients compared to normal age-matched control subjects in the reticular nucleus of the thalamus by 25% (Court et al 1999) and in the cingulate cortex by 50% (Marutle et al 2001). Guan et al (1999) also noted a reduction in ␣7 subunit protein expression in the frontal cortex in schizophrenia. Further, nicotine administration and tobacco smoking have been demonstrated to transiently normalize diminished suppression of auditory-evoked response (P50) in schizophrenic patients (Adler et al 1992, 1993). Freedman et al (1997) reported linkage between deficient P50 inhibition in schizophrenic patients and their relatives and a dinucleotide polymorphism on chromosome 15q13-14, which contains the ␣7 nAChR gene CHRNA7. Linkage between schizophrenia and similar loci on chromosome 15 has been observed in a number of subsequent analyses of large cohorts (Freedman et al 2001; Liu et al 2001; Tsuang et al 2001). However, in addition to patients with schizophrenia, patients with bipolar and schizoaffective disorders have been shown to display significantly different allelic distributions of two dinucleotide polymorphisms within the CHRNA7 gene compared with control subjects, suggesting that the linkage disequilibrium may relate to shared symptoms within these patient groups (Stassen et al 2000). Nicotinic receptor binding of agonists such as [3H]nicotine, [3H]cytisine, and [3H]epibatidine is upregulated by exposure to tobacco smoke to a greater extent than [125I]␣-bungarotoxin (Court et al 1998) and [3H]methyllycaconitine ([3H]MLA) (Breese et al 2000) binding in the human brain, consistent with the effects of nicotine in animal models (Pauly et al 1991; Sanderson et al 1993).

BIOL PSYCHIATRY 2003;54:1222–1233

1223

The degree of upregulation of agonist binding appears to be dependent on numbers of cigarettes smoked (Breese et al 1997). Interpretation of agonist binding in schizophrenia is therefore complex because of the high incidence of heavy cigarette use in these patients. Despite the early report of reduced [3H]cytisine binding in the hippocampus of patients with schizophrenia, a more recent comparison of [3H]nicotine and [3H]epibatidine binding in the hippocampus, thalamus, cortex, and caudate of patients with schizophrenia and control subjects in which both groups were nonsmokers indicated no deficits in the disease group (Breese et al 2000). When groups of smokers were compared, there was a significant trend in the hippocampus, cortex, and caudate nucleus for lower levels in the schizophrenic group (Breese et al 2000), indicating either an abnormal response of this receptor subtype to chronic nicotine exposure or differences in nicotine metabolism in schizophrenia. In contrast, an increase in [3H]cytisine binding was observed in the cingulate and orbitofrontal, but not the temporal cortex, when values in schizophrenic patients were compared to those in normal control subjects that were known to smoke tobacco (Marutle et al 2001). An increase in [3H]nicotine binding (compared to control subjects that were smokers) has been noted in the striatum in schizophrenia (Court et al 2000), whereas another study not taking smoking status into account reported a significant loss of [3H]cytisine binding in this brain region in schizophrenia (Durany et al 2000). Inconsistencies between reports may derive from heterogeneity of the disorder and variability of duration of illness, drug exposure (type and duration), and clinical features (for example, tardive dyskinesia and dementia) which have not been fully considered to date. Furthermore, smoking histories are unlikely to be an accurate estimate of nicotine exposure, as nicotine content of cigarettes varies and reports of cigarette use may be deceptive (Lee 1987). In dementia associated with AD and dementia with Lewy bodies, there are consistent findings of reduced high-affinity nAChR agonist binding in the neocortex (Court et al 2001a; Reid et al 2000); however, for cortical ␣-bungarotoxin binding, results are variable, with reports of no change and reduction compared with age-matched control subjects (Court et al 2001a, 2001b; Reid et al 2000). This inconsistency may in part relate to variable clinical symptoms in cohorts, since there is the indication that reduced ␣-bungarotoxin binding in DLB is associated with visual hallucinations (Court et al 2001b). In the present study, we investigated nicotinic ␣3, ␣4, ␣7, and ␤2 receptor subunit protein expression, ␣7 messenger RNA (mRNA) expression levels, and [3H]epibatidine binding in the dorsolateral prefrontal cortex (DLPFC), Brodmann area 46 of the left hemisphere in a group of 28 patients with schizophrenia for whom demen-

1224

C.M. Martin-Ruiz et al

BIOL PSYCHIATRY 2003;54:1222–1233

tia rating was carried out. All schizophrenia subjects, because of the chronicity of their disease, had been exposed to antipsychotic medications for prolonged periods of time during their life; however, their exposure to antipsychotic medications varied significantly during the interval of time preceding death. Some subjects had received antipsychotic medications (predominantly typical neuroleptics) until the time of death, while others were neuroleptic medication free for differing periods of time ranging from 1 week to 7 years before death. In addition, brain nicotine and cotinine levels were determined as indicators of recent tobacco exposure. In vivo studies indicated a role for the DLPFC in working and episodic memory (Cabeza et al 2002; Cornette et al 2002; Manes et al 2002; Rugg et al 2002; Rypma et al 2002), planning (Manes et al 2002), and decision making (Ernst et al 2002; Kroger et al 2002), with some indication of verbal/ semantic processing being lateralized to left frontal cortical areas (Kelley et al 1998; Wagner et al 1998). Progressive atrophy of the frontal lobes has been observed in schizophrenia (Gur et al 1998), and the involvement of the DLPFC in schizophrenia has been implicated by neuroimaging and anatomical and neurochemical investigations (Bertolino et al 1998; Bunney and Bunney 2000; Weickert et al 2001). The DLPFC may therefore be involved with the symptoms of schizophrenia.

Methods and Materials Materials The antibodies mAb 313, mAb 306, and mAb 270 from Sigma (Dorset, UK) and sc-1772 from Autogen Bioclear (Calne, UK) were used to estimate the expression of ␣3, ␣7, ␤2, and ␣4, respectively. Secondary antibodies were horseradish peroxidase (HRP)-conjugated anti-IgGs from Chemicon (Temecula, California). Boehringer Mannheim (BM) chemiluminescence blotting substrate was from Boehringer Roche Diagnostics GmbH (Mannheim, Germany). Proteinase inhibitors and molecular weight standards were obtained from Sigma (Dorset, UK). Whatman GFC filters were obtained from Merck Ltd (Dorset, UK). Polyscreen polyvinylidene difluoride (PVDF) membranes and [3H]epibatidine (sp. act. 48.0 Ci/mmol) were from NEN Life Science (Boston, Massachusetts). Hyperfilm ECL was supplied by Amersham (Bucks, UK). For ␣7-nAChR mRNA measures, the 5⬘ primer was 5⬘TGCGCCGCAGGACACTCT3⬘, and the 3⬘ primer was 5⬘CCCCGGGCCTCTTCATTC3⬘, located at nucleotides 684-701 and 1038-1055, respectively, in the complementary DNA (cDNA) sequence (GeneBank U40583), with a predicted length of 372 base pair (bp) for the amplified fragment. For ␤-actin, the 5⬘ primer was 5⬘CACACCTTCTACAATGAGCTGCG3⬘, and the 3⬘ primer was 5⬘GTCATACTCCTGCTTGCTGCTCCACATCTGC3⬘, at positions 335-357 and 1132-1163, respectively, in the cDNA sequence (NID 5016088) and the expected length of

the fragment was 828 bp. Primer probes came from MWGBiotech AG (Ebersberg, Germany).

Cases Postmortem (PM) brain samples from subjects diagnosed with chronic schizophrenia with DSM-III-R criteria (n ⫽ 28) and age-matched control subjects (n ⫽ 14) were obtained from the Department of Psychiatry, Mount Sinai/Bronx Veterans Administration Medical Center Brain Bank, New York. Details of age, dementia rating, postmortem delay, reported smoking history, and nicotine and cotinine concentrations in the brain samples are shown in Table 1. All schizophrenic subjects had been chronically hospitalized at Pilgrim Psychiatric Center (West Brentwood, New York) for many years. Complete medical charts were available on all cases, and eight of the schizophrenic subjects had been prospectively diagnosed and neuropsychiatrically assessed by a team of research clinicians (Davidson et al 1995; Harvey et al 1998). Assessment of dementia was by use of the Washington University Clinical Dementia Rating Scale (CDR). Impairment estimates were made on a 5-point scale in six functional areas (memory, orientation, judgment, community affairs, home and hobbies, and personal care), which were combined using a scoring algorithm. Those patients who died before antemortem assessment were diagnosed by the same team of research clinicians who conducted diagnostic reviews of all medical chart records (Purohit et al 1998). The reliability of these postmortem diagnostic procedures was confirmed by assessing an independent group of 35 subjects from the same institution by structured interview and blindly by chart review. Interrater/interassessment reliability was .86. The patients selected for study were those whose only psychiatric diagnosis was schizophrenia and who had died of natural causes without coma. All assessment and postmortem evaluations and procedures were approved by the Institutional Review Boards of Pilgrim Psychiatric Center, Mount Sinai School of Medicine, and the Bronx VA Medical Center. All patients had thorough neuropathological characterization to rule out associated neurologic complications, such as Alzheimer’s disease and multi-infarct dementia. Normal controls had no history of any psychiatric or neurologic disorders and no discernible neuropathological lesions. For the schizophrenia subjects, the neuroleptic-free interval before death is indicated in Table 1 (range 0 to 124 weeks), nine were not receiving neuroleptic medications for at least 6 weeks before death.

Tissue Preparation Gray matter (50 to 100 mg wet weight) from the dorsolateral prefrontal cortex (Brodmann’s Area [BA] 46) was dissected from blocks of frozen brain (⫺80°C). The tissues were pulverized at ⫺190°C and stored at ⫺80°C. For western blot analyses and radioligand binding, pulverized tissue was homogenized using an Ultra Turrax in 200 ␮L of ice cold sample buffer: .3 mol/L sucrose, 20 mmol/L Tris-HCl pH 7.4 containing protease inhibitors (1 ␮mol/L pepstatin A, 1 mmol/L iodoacetamide, 1 mmol/L 1,10-phenanthroline, 1 mmol/L phenylmethyl-sulfonyl fluoride, 2 mmol/L DL-dithiothreitol, 1 mg/mL leupeptin, 1 mg/mL antipain, 2 mmol/L

Dementia, Schizophrenia, and nAChR Subunits

BIOL PSYCHIATRY 2003;54:1222–1233

1225

Table 1. Case Details

Patient b

1 2b 3b 4a,b 5a,b 6b 7b 8c 9b,c 10b,c 11b 12b,c 13b,c 14b,c 15b,c 16a,b 17a,b,c 18a,b,c 19a,b 20b 21a,b,c 22a,b,c 23b,c 24a,b 25a,bc 26b,c 27b 28a,c 29a,b 30a,b,c 31b,c 32b,c 33b 34c 35b,c 36a,b 37b,c 38a,c 39b 40b,c 41a,b,c 42b,c

Disease Category/Gender

Age (y)

Control/F Control/M Control/F Control/F Control/F Control/F Control/F Control/F Control/F Control/F Control/F Control/F Control/F Control/M Schizophrenia/M Schizophrenia/M Schizophrenia/M Schizophrenia/M Schizophrenia/M Schizophrenia/M Schizophrenia/M Schizophrenia/F Schizophrenia/M Schizophrenia/M Schizophrenia/M Schizophrenia/M Schizophrenia/F Schizophrenia/F Schizophrenia/F Schizophrenia/F Schizophrenia/F Schizophrenia/F Schizophrenia/M Schizophrenia/M Schizophrenia/M Schizophrenia/F Schizophrenia/M Schizophrenia/F Schizophrenia/F Schizophrenia/M Schizophrenia/M Schizophrenia/M

64 69 73 74 78 79 79 80 82 84 90 93 98 100 52 57 57 58 58 61 63 65 66 66 68 68 69 75 76 76 79 79 82 82 82 84 85 86 86 87 93 97

CDR 0 .5 0 1 .5 0 0 0 0 0 1 .5 0 0 0 3 .5 1 3 2 .5 1 1 1 3 .5 2 2 2 3 2 5 2 3 4 1 3 3 4 3 1 2

Reported Smoking History

Postmortem Delay (h)

N U U S U N U N N N U U U N N S N U S U N N U U S N S S U S U S U U S N S S N S U U

19.1 4.3 3.4 3 9.1 3 7.7 6.8 5.7 18.5 4.2 19 7.1 4.7 29.5 30.3 19 6.7 30 3.5 6.2 5.8 12.1 8.4 5.6 17.3 13.7 6.9 8.5 21.2 20.4 9.9 7.9 11.4 18.8 15.6 5.3 6.9 18.2 11.2 6.4 25.9

NFI

8 1 0 0 1 0 16 0 2 0 4 0 0 0 9 52 0 .5 124 115 0 36 1 11 0 0

Brain Nicotine ng/g

Brain Cotinine ng/g

⬍.2 .2 .2

.8 .2 2

10.8 .4 ⬍.2 ⬍.02 ⬍.2 .2 .2 ⬍.2 .2

.8 .6 .8 .60 .6 .8 1 ⬍.2 1.2 1.6 .6 1.4 32.2

1.4 41.8 3.6 43.4 12.8 .4 3.8 10.8 .2 26.8 10.4 ⬍.2 .2 .80

85.4 .4 133.6 .4 .4 87.4 .8 .6 1.2 22.00

37.4 .8 ⬍.2 .4 .4 .4

.2 .4 1.2 .4 1.6 1.6

⬍.2

.2

.2 .6

.8 .4 33.2 .4

1 .6

NFI refers to the neuroleptic free interval prior to death in weeks. Italics indicate younger schizophrenic cases excluded from age-matched comparisons. CDR, clinical dementia rating; NFI, neuroleptic free interval; F, female, M, male; N, nonsmoker; U, unknown; S, smoker. a Cases excluded from groups for comparison of cases with low levels of nicotine and or cotinine (⬎ 2 ng/g). b Cases used for determination of subunit protein expression. c Cases used for determination of ␣7 mRNA.

ethyleneglycoltetracetic acid [EGTA], and 2 mmol/L ethylenediaminetetraacetic acid [EDTA]). Homogenates were then centrifuged at 30,000g at 4°C for 30 minutes. The pellet was washed twice in the buffer and stored at ⫺70°C until used for the determination of [3H]epibatidine binding and nAChR subunit expression. Protein concentrations were determined by the method of Lowry et al (1951) with bovine serum albumin as a standard.

Total RNA was isolated from 50 to 100 mg of tissue and processed following the Qiagen (West Sussex, United Kingdom) RNeasy Mini Kit protocol. Briefly, after tissue homogenization using an UltraTurrax (IKA-Werk, Staufen, Germany) in the presence of a denaturing buffer containing ␤-mercaptoethanol, the lysate was applied to a silica-gel based membrane where total RNA was retained. After three washes, the RNA was eluted in

1226

C.M. Martin-Ruiz et al

BIOL PSYCHIATRY 2003;54:1222–1233

H2O. Traces of contaminating genomic DNA in the sample were removed by treatment with Amplification Grade DNase I (Sigma, Dorset, United Kingdom), at .1 Unit/␮L during 30 minutes at 37°C, followed by recovering and cleanup of the RNA through new clean silica-gel membranes and final elution in H2O. For nicotine and cotinine determinations, 150 to 250 ␮g of pulverized tissue was homogenized by UltraTurrax in two volumes of hydrochloride (HCl) buffer pH 2, and the membrane fraction was removed by centrifugation at 30,000g at 4°C for 20 minutes.

Radioligand Binding Assay Tissue homogenates (300 ␮g protein) were incubated for 3 hours at room temperature in .5 mL of 50 mmol/L Tris HCl, 8 mmol/L calcium chloride (CaCl2) pH 7.4 containing .5 nm [3H]epibatidine, and then passed through Whatman GFC filters and washed rapidly three times with 3 mL of ice-cold buffer using a Brandel Harvester (Semat, Herts, UK). At this concentration, [3H]epibatidine is in excess of the estimated KD in humans (Marutle et al 1998), and therefore receptor densities approach maximal binding (Bmax). Nonspecific binding was assessed in the presence of 10 ␮mol/L epibatidine and represented between 10% to 20% of total binding. Membrane bound radioactivity was measured using a scintillation counter. Determinations were made in triplicate.

Western Blot Analyses Protein extracts were dissolved 1:1 (vol/vol) in Laemmli Buffer and subjected to sodium dodecyl (lauryl) sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 8% polyacrylamide gels. Brain samples from control and schizophrenia cases, at 25 ␮g of protein per well, were loaded randomly and proteins were then transferred by electroblotting onto PVDF membranes using the Milliblot Graphite Electroblotter II (Millipore, Watford, UK). Blots were processed according to the Boehringer BM chemiluminescent blotting substrate kit with the primary nAChR subunit antibodies at .5 ␮g/mL and peroxidase-linked secondary antibodies. All samples were evaluated in triplicate. The blots were exposed to Hyperfilm ECL (Amersham, Bucks, UK) for 2 minutes. The integrated optical density of each band and blot background was measured using AIS MCID 4.0 Software, Imaging Research Inc. (St. Catharines, Ontario, Canada). Linearity of the immunoreactivity (IR) signal against amount of protein was assessed as previously (Martin-Ruiz et al 2000).

Semiquantitative Reverse Transcription-Polymerase Chain Reaction For quantification purposes, the ␣7 subunit mRNA expression was evaluated in relation to ␤-actin expression, used previously as a housekeeping gene in schizophrenia studies (Dracheva et al 2001; Ichinose et al 1994). Reverse transcription (RT) and polymerase chain reaction (PCR) amplification were performed using SuperScript One-Step RT-PCR with Platinum Taq (Life Technologies, Paisley, UK).

Primers for ␣7 nAChR subunit and ␤-actin were titrated at a concentration range between .25 and 2 ␮mol/L for 34 to 40 PCR cycles to determine in which conditions fragment amplification was a linear function of the amount of total RNA. In 20 ␮L reaction volume, the final conditions for ␣7 versus ␤-actin RT-PCR included .2 ␮g total RNA, .2 mmol/L deoxynucleoside triphosphates (dNTPs), 1.2 magnesium sulfate (MgSO4), 2 ␮mol/L ␣7 sense and antisense primers, .7 ␮mol/L ␤-actin sense and antisense primers, and .4 ␮L RT/Taq mix. The cDNA synthesis took place for 35 minutes at 60°C, followed by a denaturation for 2 minutes at 94°C and 38 PCR cycles. Each PCR amplification cycle consisted of denaturation for 30 seconds at 94°C, annealing for 30 seconds at 60°C, and extension for 1 minute at 72°C, with a final extension of 10 minutes at 72°C. Aliquots of DNA samples were analyzed by electrophoresis on 1.5% agarose gels containing .5 ␮g/mL ethydium bromide alongside 100-bp ladder DNA marker (New England Biolabs, Hitchin, UK). The absence of genomic DNA was established in samples that did not undergo reverse transcription. Gels were exposed to ultraviolet (UV) light in a Multi-Image Light cabinet (Alpha Innotech Corp, Cannock, UK), and the density of the bands corresponding to the amplified products was analyzed using AIS MCID 4.0 Software, Imaging Research Inc. Four determinations per sample were made.

Measurement of Nicotine and Cotinine Nicotine and cotinine concentrations were determined using GLP Capillary Gas Chromatography by ABS Laboratories Ltd, London (Feyerabend and Russell 1990).

Results Smoking Histories and Brain Nicotine and Cotinine Concentrations Smoking history was not available for a number of cases used in the present study, so brain nicotine and cotinine levels were measured as indicators of nicotine exposure before death. Concentrations of brain nicotine ranged from ⬍.2 to 41.8 ng/g and cotinine from ⬍.2 to 133.6 ng/g (Table 1). For all but one of the control subjects that were reported to be nonsmokers, brain nicotine and cotinine did not exceed 2 ng/g, and this was taken as a cutoff for low nicotine and cotinine. One reported nonsmoking control subject had a nicotine value of 10.8, a level likely to be indicative of a smoker (Benowitz et al 1990). Three reported nonsmokers from the schizophrenic group also had nicotine and/or cotinine values well in excess of 2 ng/g indicative of smokers (Table 1). That some reported smokers in this group had levels of nicotine and/or cotinine below 2 ng/g does not necessarily indicate misclassification but may reflect a period of days or more between smoking tobacco and demise since the mean half lives of nicotine and cotinine in the human are 120 minutes and 18 hours, respectively (Benowitz et al 1990).

Dementia, Schizophrenia, and nAChR Subunits

BIOL PSYCHIATRY 2003;54:1222–1233

1227

That brain cotinine may be an indicator of chronic intermittent nicotine exposure is consistent with the significant positive correlation between [3H]epibatidine binding and cotinine concentration (r ⫽ .42, p ⫽ .035; n ⫽ 24) but not with nicotine (r ⫽ ⫺.023, p ⫽ .919; n ⫽ 25) in the patients with schizophrenia in the present study.

Correlations of nAChR Binding and Subunits with Postmortem Delay, Age, Gender, and CDR Postmortem delay did not correlate within groups with any of the nAChR parameters investigated with the exception of ␤2 expression, which was significantly correlated (inversely) with PM delay for the schizophrenic group (r ⫽ ⫺.451, p ⫽ .024; n ⫽ 20) but not for controls (r ⫽ ⫺.131, p ⫽ .669; n ⫽ 13). There was a significant inverse correlation between [3H]epibatidine binding with age in the control individuals (r ⫽ ⫺.597, p ⫽ .031; n ⫽ 13); however, this was not the case for patients with schizophrenia (all cases and those with low nicotine and cotinine, r ⫽ .055, p ⫽ .793 [n ⫽ 20] and r ⫽ .002, p ⫽ .995 [n ⫽ 11], respectively). Expression of ␣3, ␣4, ␣7, and ␤2 subunits was not correlated with age for either group (age ranges: 52 to 97 years in schizophrenia group and 64 to 100 years in control subjects). Although there was a preponderance of females in the control subjects and males in the schizophrenia group, all nicotinic receptor parameters measured were similar in subgroups of males versus females; for example, within the schizophrenia patients, ␣7 protein expression in males was 78.2 ⫾ 38.8 (n ⫽ 12) in males and 85.6 ⫾ 39.5 (n ⫽ 8) in females, and epibatidine binding (low nicotine and cotinine subgroups) was 2.05 ⫾ 1.19 (n ⫽ 7) in males and 2.47 ⫾ 3.69 (n ⫽ 4) in females. There was no indication that [3H]epibatidine binding or ␣3, ␣4, ␣7, and ␤2 immunoreactivity correlated with CDR in the schizophrenia group (n ⫽ 25) (Figure 1). There was a trend in the schizophrenia patients for dementia rating (CDR) to be correlated with age, but this did not reach statistical significance (r ⫽ .353, p ⫽ .091; n ⫽ 28). There was also a trend for ␣7 mRNA expression to be inversely correlated with CDR but not significantly (r ⫽ ⫺.356, p ⫽ .193; n ⫽ 15).

Comparisons of nAChR Subunit Expression and [3H]epibatidine Binding Between Schizophrenia and Control Groups Comparison of nAChR subunit protein expression in Brodmann area 46 in cases with schizophrenia aged 61 years and above with similarly aged control subjects indicated a significant reduction (by 20%) in ␣7 expression (p ⬍ .05, Student t test, Table 2). There were no apparent differences in ␣3, ␣4, and ␤2 nAChR subunit

Figure 1. Correlations in schizophrenia patients between dementia rating (CDR) and ␣3, ␣4, ␣7, and ␣2 nAChR subunit protein expression (expressed as percentage of average control immunoreactivity), [3H]epibatidine binding (in fmol/mg protein), and ␣7 nAChR/␣-actin mRNA ratio. Pearson correlation coefficients (r) and p values were calculated using Minitab (State College, Pennsylvania) Release 13.1. Data were from 25 patients for all parameters except ␣7 nAChR/␤-actin mRNA ratio for which there were 18. CDR, Clinical Dementia Rating Scale; nAChR, nicotinic acetylcholine receptor; mRNA, messenger RNA; IR, immunoreactivity.

expression, although [3H]epibatidine binding was increased by approximately twofold in schizophrenia patients (Table 2). There was also no significant difference in ␣7 mRNA expression between schizophrenia cases and age-matched control subjects (Table 3). A similar pattern was observed in subgroups of patients and control subjects from which individual cases were excluded if levels of nicotine and cotinine were consistent with tobacco use before death (⬎2 ng/mg tissue weight) or in which determination of nicotine and cotinine was not possible (Table 2). Schizophrenia and control groups compared were well matched for postmortem delay (Tables 2 and 3). [3H]Epibatidine binding was not correlated with the protein expression of any of the nAChR subunits investi-

1228

C.M. Martin-Ruiz et al

BIOL PSYCHIATRY 2003;54:1222–1233

Table 2. Nicotinic Acetylcholine Receptor Subunit Expression in the Dorsolateral Prefrontal Cortex (Brodmann Area 46) in Schizophrenia Compared with Age-Matched Control Subjects Control Subjects

␣3 ␣4 ␣7 ␤2 [3H]epibatidine Binding (fmol/mg protein) Nicotine (ng/mg tissue) Cotinine (ng/mg tissue) Age (y) PM Delay (h)

Schizophrenia Cases

n ⫽ 13 11F:2M

[11] [9F:2M]

n ⫽ 20 8F:12M

[11] [4F:7M]

100.0 ⫾ 24.0 100.0 ⫾ 7.9 100.0 ⫾ 28.6 100.0 ⫾ 36.9 2.83 ⫾ 1.93

[100.3 ⫾ 24.2] [101.2 ⫾ 30.8] [102.9 ⫾ 28.6] [102.6 ⫾ 39.5] [2.20 ⫾ 1.28]

99.4 ⫾ 25.1 98.0 ⫾ 7.4 79.6 ⫾ 37.4a 91.4 ⫾ 39.1 5.61 ⫾ 3.59b

[90.5 ⫾ 17.6] [101.2 ⫾ 30.8] [74.1 ⫾ 34.5a] [97.1 ⫾ 42.6] [4.31 ⫾ 1.74b]

1.12 ⫾ 3.21 .87 ⫾ .55 81.6 ⫾ 10.5 8.3 ⫾ 6.0

[.15 ⫾ .13] [.88 ⫾ .17] [81.0 ⫾ 10.1] [8.9 ⫾ 6.5]

5.5 ⫾ 10.7 15.5 ⫾ 37.5 77.4 ⫾ 9.8 11.5 ⫾ 6.0

[.31 ⫾ .26] [.68 ⫾ .47] [78.9 ⫾ 9.7] [13.1 ⫾ 6.3]

Nicotine acetylcholine receptor subunit expression is expressed as percentage of mean control values. Values are means ⫾ SD. Figures in square brackets are those cases with low brain nicotine and cotinine. F, female; M, male; PM, postmortem. a p ⬍ .05. b p ⬍ .01.

gated (␣3, ␣4, ␣7, and ␤2) within groups or for all data pooled; however, ␣4 (but not ␣3 or ␣7) expression was correlated with ␤2 expression (for control subjects, schizophrenia patients, and all data pooled, r ⫽ .599, p ⫽ .03, n ⫽ 14; r ⫽ .526, p ⫽ .007, n ⫽ 25; and r ⫽ .550, p ⫽ .000, n ⫽ 39).

Associations Between nAChRs, Brain Nicotine and Cotinine, and Neuroleptic Medication Comparisons of subgroups of schizophrenia patients with low versus high nicotine and cotinine indicated no differences in nAChR subunit expression, but as expected, the subgroup with higher nicotine and/or cotinine had significantly elevated [3H]epibatidine binding (7.77 ⫾ 4.48, n ⫽ 9 versus 4.31 ⫾ 1.74, n ⫽ 11, p ⬍ .05). There were no significant correlations between the duration of being free from antipsychotic medications before death and nAChR subunit expression or [3H]epibatidine binding. In addition, there were no differences in these parameters between those subjects who had received neuroleptic medications until the time of death versus

those who had been neuroleptic medication free for 6 weeks (a period equivalent to 6 half-lives of haloperidol in chronically treated patients (Kornhuber et al 1999).

Associations of Negative and Positive Symptoms with nAChR Measures Eight of the schizophrenia subjects had been enrolled in neuropsychiatric assessment studies and had been assessed using the Positive and Negative Syndrome Scale (PANSS) (Kay 1991) within 18 months of death. Within this limited cohort, none of the nicotinic receptor expression measures studied here correlated significantly (p values ⬎ .05) with the overall PANSS score or its positive, negative, and general subscales.

Discussion In the present study, measurements of brain nicotine and cotinine levels indicated that reported nonsmoking status was incorrect for a number of cases. Reported smoking-

Table 3. Nicotinic Acetylcholine Receptor ␣7 Subunit mRNA Expression in Dorsolateral Prefrontal Cortex (Brodmann Area 46) in Schizophrenia Compared with Age-Matched Controls

␣7/␤-actin mRNA Ratio Age (y) PM Delay (h) Nicotine (ng/g tissue) Cotinine (ng/g tissue)

Schizophrenia (n ⫽ 15) [n ⫽ 10]

Controls [n ⫽ 6] [F5:M1]

F5:M10

[F3:7M]

[1.12 ⫾ .57] [87.4 ⫾ 7.7] [11.4 ⫾ 6.7] [1.03 ⫾ 3.08] [.85 ⫾ .53]

1.96 ⫾ 1.64 79.1 ⫾ 9.9 13.1 ⫾ 6.7 4.52 ⫾ 9.83 13.7 ⫾ 34.0

[1.62 ⫾ 1.20] [81.1 ⫾ 9.0] [15.0 ⫾ 6.1] [.27 ⫾ .24] [.75 ⫾ .46]

Values are means ⫾ SD. Figures in square brackets are those cases with low brain nicotine and cotinine. F, female; M, male; mRNA, messenger RNA; PM, postmortem.

Dementia, Schizophrenia, and nAChR Subunits

history was therefore not used in the current analysis. Although the presence of high levels of brain nicotine and cotinine in the schizophrenia group was associated with higher levels of [3H]epibatidine binding and cotinine was significantly correlated with epibatidine binding, the expression of nAChR subunit proteins and ␣7 mRNA was not influenced by this indicator of nicotine exposure. That nAChR subunits, including ␣3, ␣4, and ␤2, which are known to contribute to [3H]epibatidine binding (Flores et al 1997; Zoli et al 1998), were not elevated in parallel with receptor binding is in agreement with the lack of increase in subunit mRNA expression in response to chronic nicotine exposure in mice (Marks et al 1992) and that the elevated numbers of binding sites as a consequence of nicotine exposure may reflect reduced receptor breakdown and/or a shift in receptor proteins between pools with variable capacity to bind agonists (discussed in Collins and Marks 1996; Lukas et al 1996). This is the first study in which ␣3, ␣4, and ␤2 nAChR subunit proteins have been examined in schizophrenia. The expression of these subunit proteins in the DLPFC was not different between groups of schizophrenia patients and control subjects matched for age and PM delay or between groups in which those cases with levels of nicotine and/or cotinine greater than 2 ng/g were excluded. However, there was a significant reduction in ␣7 protein expression in the schizophrenia group in the DLPFC, indicating a specific deficit of this nAChR subunit in schizophrenia. Since atrophy of the frontal lobes is observed in schizophrenia (Gur et al 1998; Rapoport et al 1999), the observed 20% decrease in ␣7 expression in Brodmann area 46 may be an underestimate of the total loss of the ␣7-type nAChRs from this brain region. The reduced ␣7 protein expression may reflect attenuation of ␣7 bearing elements within the dorsolateral prefrontal cortex. Recent findings indicate abnormalities of glutamate and gamma-aminobutyric-acid (GABA) metabolism and glutamate receptor expression in this brain region in individuals with schizophrenia (Dracheva et al 2001; Gluck et al 2002; Meador-Woodruff et al 2001). Functional ␣4 and ␣7 containing nAChRs have been demonstrated on pyramidal and GABAergic interneurons in the human neocortex (Alkondon et al 2000; Krenz et al 2001; Wevers et al 1999), with at least a proportion of neurons expressing both receptor subtypes (Krenz et al 2001; Wevers et al 1999). That cortical ␣7 nAChRs appear to be selectively reduced in schizophrenia in contrast to the predominant reduction in neocortical ␣4 containing receptors in AD (reviewed in Court et al 2001a) indicates the possibility of subsets of neurons being differentially affected in the two disorders. In the rat, ␣-bungarotoxin binding sites are reduced in the frontoparietal cortex after ibotenic acid lesion of the nucleus basalis, suggesting that

BIOL PSYCHIATRY 2003;54:1222–1233

1229

␣7 nAChRs may also be present on cortical cholinergic projections; however, since cortical ChAT is not reduced in schizophrenia (Haroutunian et al 1994), it is unlikely that the present finding of reduced ␣7 expression is a reflection of attenuation of cortical cholinergic afferents. ␣7 receptors capable of stimulating increases in intracellular calcium have been demonstrated on rat astrocytes (Sharma and Vijayaraghavan 2001) and their presence on human astrocytes has been confirmed by immunohistochemistry, with the degree of ␣7 expression being increased by AD-type pathology (Graham et al 2002; Wevers et al 1999). Reported changes in the numbers of cortical astroglia in schizophrenia are inconsistent (Arnold et al 1996; Falkai et al 1999; Rajkowska et al 2002) with the suggestion that the number of astrocytes may be reduced in schizophrenia without concomitant dementia and increased in those patients with dementia (Arnold et al 1996). Since the present cases investigated were composed of those with and without dementia and ␣7 expression was not correlated with dementia, it is unlikely that changes in ␣7 expression on astrocytes contribute to the observed deficit in ␣7; however, Rajkowska et al (2002) reported layer-specific reductions in glial fibrillary acidic protein (GFAP)-reactive astrocytes, and immunohistochemical studies are required to investigate this deficit in ␣7 expression at a cellular level. Reduction in brain ␣7-containing nAChRs in schizophrenia has not been observed in all brain areas investigated. Guan et al (1999) reported a 20% reduction in frontal cortex but no loss of ␣7 protein expression in the parietal cortex (no precise area specified). Also, no significant changes were noted in [125I]␣-bungarotoxin binding in the orbitofrontal (BA 11, 12, and 47) or posterior temporal (BA 20, 21, and 36) cortices (Marutle et al 2001) or thalamic nuclei other than the reticular (Court et al 1999). In addition, no significant reduction in the binding of [3H]methyllycaconitine (MLA) to the ␣7 receptor was observed in the hippocampus of patients with schizophrenia (Breese et al 2000), in contrast to the earlier report of reduced ␣-bungarotoxin binding in this brain region (Freedman et al 1995). It is therefore possible that the reduction in ␣7 nAChR expression observed in schizophrenia is area-specific, reflecting pathology, and variable dependent on symptomatology, severity of pathology, or medication. In the present study, there was no indication that variations in ␣7 expression in the DLPFC were correlated with dementia rating and no suggestion that ␣7 expression was associated with negative or positive symptoms, although the latter was only investigated in a small subset of cases (n ⫽ 8). The present estimate of ␣7 mRNA expression indicated no change in this parameter in schizophrenia; however, the

1230

BIOL PSYCHIATRY 2003;54:1222–1233

␣7 gene (CHRNA7) has been found to be partially duplicated (Gault et al 1998; Riley et al 2002), with the duplication being a hybrid between exons 5 to 10 of CHRNA7 and a copy of a novel gene (FAM7A) with opposite orientation to the CHRNA7 gene. Hence, with the primers employed to amplify ␣7 transcripts and used previously for human studies (Utsugisawa et al 1999), it is possible that amplification was not entirely specific for the ␣7 gene transcripts. Nevertheless, this duplication does not occur in all individuals (Gault et al 1998; Riley et al 2002) and its specific association with schizophrenia is not proven. The elevated epibatidine binding observed in the schizophrenia group is difficult to interpret. Although it was evident in groups matched for low nicotine and/or cotinine levels, the possibility that it could be the result of greater nicotine exposure in the groups of schizophrenic patients could not be excluded. From animal studies, it appears that upregulation of agonist binding persists for several days after nicotine withdrawal (Collins et al 1990), whereas the half-life of nicotine and cotinine in humans is less than 24 hours (Benowitz et al 1990). Although we have previously observed attenuated striatal [3H]nicotine binding in patients with dementia treated with neuroleptics (Court et al 2000), the present results of no group differences between patients taking or not taking neuroleptics up until death and no correlation between neuroleptic free interval and ␣7 expression indicate that such medication is unlikely to be a confounding factor in the present analysis. The finding of no correlation between neuroleptic free interval and [3H]epibatidine binding is also consistent with the reported lack of effect of haloperidol on the response of nAChR binding to nicotine in the rat (Breese et al 2000). Future analyses of nicotinic receptors in chronic disorders such as schizophrenia would benefit from specific receptor subtype ligands suitable for in vivo analysis. These would allow investigations at an early stage of the disorder, before long-term medication, and comparison of receptor changes in relation to specific clinical symptoms.

This work was supported by the Medical Research Council, United Kingdom; a European Union Training and Mobility of Researchers Programme on Nicotinic Receptors coordinated by F. Clementi, Milan; a National Alliance for Research in Schizophrenia and Depression (NARSAD) award to A.H. Young; a National Institute of Mental Health grant MH-45212 awarded to K.L. Davis; and VA Merit Review award to V. Haroutunian.

References Adler LE, Hoffer LJ, Griffith J, Waldo MC, Freedman R (1992): Normalization by nicotine of deficient auditory sensory gat-

C.M. Martin-Ruiz et al

ing in the relatives of schizophrenics. Biol Psychiatry 32:607– 616. Adler LE, Hoffer LD, Wiser A, Freedman R (1993): Normalization of auditory physiology by cigarette smoking in schizophrenic patients. Am J Psychiatry 150:1856 –1861. Alkondon M, Pereira EF, Eisenberg HM, Albuquerque EX (2000): Nicotinic receptor activation in human cerebral cortical interneurons: A mechanism for inhibition and disinhibition of neuronal networks. J Neurosci 20:66 –75. Arnold SE, Franz BR, Trojanowski JQ, Moberg PJ, Gur RE (1996): Glial fibrillary acidic protein-immunoreactive astrocytosis in elderly patients with schizophrenia and dementia. Acta Neuropathol (Berl) 91:269 –277. Benowitz NL, Porchet H, Jacob PR (1990): Pharmacokinetics, metabolism, and pharmacodynamics of nicotine. In: Wonnacott S, Russell MAH, Stolerman IP, editors. Nicotine Psychopharmacology. New York: Oxford University Press, 112– 157. Bertolino A, Callicott JH, Elman I, Mattay VS, Tedeschi G, Frank JA, et al (1998): Regionally specific neuronal pathology in untreated patients with schizophrenia: A proton magnetic resonance spectroscopic imaging study. Biol Psychiatry 43:641–648. Breese CR, Freedman R, Leonard SS (1995): Glutamate receptor subtype expression in human postmortem brain tissue from schizophrenics and alcohol abusers. Brain Res 674:82–90. Breese CR, Lee MJ, Adams CE, Sullivan B, Logel J, Gillen KM, et al (2000): Abnormal regulation of high affinity nicotinic receptors in subjects with schizophrenia. Neuropsychopharmacology 23:351–364. Breese CR, Marks MJ, Logel J, Adams CE, Sullivan B, Colins AC, et al (1997): Effect of smoking history on [3H] nicotine binding in human postmortem brain. J Pharmacol Exp Ther 282:7–13. Bunney WE, Bunney BG (2000): Evidence for a compromised dorsolateral prefrontal cortical parallel circuit in schizophrenia. Brain Res Brain Res Rev 31:138 –146. Cabeza R, Dolcos F, Graham R, Nyberg L (2002): Similarities and differences in the neural correlates of episodic memory retrieval and working memory. Neuroimage 16:317–330. Collins AC, Marks MJ (1996): Are nicotinic receptors activated or inhibited following chronic nicotine treatment? Drug Dev Res 38:231–242. Collins AC, Romm E, Wehner JM (1990): Dissociation of the apparent relationship between nicotine tolerance and upregulation of nicotinic receptors. Brain Res Bull 25:373–379. Cornette L, Dupont P, Orban GA (2002): The neural substrate of orientation short-term memory and resistance to distractor items. Eur J Neurosci 15:165–175. Court J, Martin-Ruiz C, Piggott M, Spurden D, Griffiths M, Perry E (2001a): Nicotinic receptor abnormalities in Alzheimer’s disease. Biol Psychiatry 49:175–184. Court J, Spurden D, Lloyd S, McKeith I, Ballard C, Cairns N, et al (1999): Neuronal nicotinic receptors in dementia with Lewy bodies and schizophrenia: Alpha-bungarotoxin and nicotine binding in the thalamus. J Neurochem 73:1590 – 1597. Court JA, Ballard CG, Piggott MA, Johnson M, O’Brien JT, Holmes C, et al (2001b): Visual hallucinations are associated

Dementia, Schizophrenia, and nAChR Subunits

with lower alphabungarotoxin binding in dementia with Lewy bodies. Pharmacol Biochem Behav 70:571–579. Court JA, Lloyd S, Johnson M, Griffiths M, Birdsall NJ, Piggott MA, et al (1997): Nicotinic and muscarinic cholinergic receptor binding in the human hippocampal formation during development and aging. Brain Res Dev Brain Res 101:93– 105. Court JA, Lloyd S, Thomas N, Piggott MA, Marshall EF, Morris CM, et al (1998): Dopamine and nicotinic receptor binding and the levels of dopamine and homovanillic acid in human brain related to tobacco use. Neuroscience 87:63–78. Court JA, Perry EK, Spurden D, Griffiths M, Kerwin JM, Morris CM, et al (1995): The role of the cholinergic system in the development of the human cerebellum. Brain Res Dev Brain Res 90:159 –167. Court JA, Piggott MA, Lloyd S, Cookson N, Ballard CG, McKeith IG, et al (2000): Nicotine binding in human striatum: Elevation in schizophrenia and reductions in dementia with Lewy bodies, Parkinson’s disease and Alzheimer’s disease and in relation to neuroleptic medication. Neuroscience 98:79 –87. Davidson M, Harvey P, Welsh KA, Powchik P, Putnam KM, Mohs RC (1996): Cognitive functioning in late-life schizophrenia: A comparison of elderly schizophrenic patients and patients with Alzheimer’s disease. Am J Psychiatry 153:1274 –1279. Davidson M, Harvey PD, Powchik P, Parrella M, White L, Knobler HY, et al (1995): Severity of symptoms in chronically institutionalized geriatric schizophrenic patients. Am J Psychiatry 152:197–207. Dean B, Crook JM, Opeskin K, Hill C, Keks N, Copolov DL (1996): The density of muscarinic M1 receptors is decreased in the caudate-putamen of subjects with schizophrenia. Mol Psychiatry 1:54 –58. de Leon J, Dadvand M, Canuso C, White AO, Stanilla JK, Simpson GM (1995): Schizophrenia and smoking: An epidemiological survey in a state hospital. Am J Psychiatry 152:453–455. Dracheva S, Marras SA, Elhakem SL, Kramer FR, Davis KL, Haroutunian V (2001): N-methyl-D-aspartic acid receptor expression in the dorsolateral prefrontal cortex of elderly patients with schizophrenia. Am J Psychiatry 158:1400 – 1410. Durany N, Zochling R, Boissl KW, Paulus W, Ransmayr G, Tatschner T, et al (2000): Human post-mortem striatal ␣4␤2 nicotinic acetylcholine receptor density in schizophrenia and Parkinson’s syndrome. Neurosci Lett 287:109 –112. el-Mallakh RS, Kirch DG, Shelton R, Fan KJ, Pezeshkpour G, Kanhouwa S, et al (1991): The nucleus basalis of Meynert, senile plaques, and intellectual impairment in schizophrenia. J Neuropsychiatry Clin Neurosci 3:383–386. Ernst M, Bolla K, Mouratidis M, Contoreggi C, Matochik JA, Kurian V, et al (2002): Decision-making in a risk-taking task: A PET study. Neuropsychopharmacology 26:682–691. Falkai P, Honer WG, David S, Bogerts B, Majtenyi C, Bayer TA (1999): No evidence for astrogliosis in brains of schizophrenic patients. A post-mortem study. Neuropathol Appl Neurobiol 25:48 –53. Feyerabend C, Russell MA (1990): A rapid gas-liquid chromatographic method for the determination of cotinine and nicotine in biological fluids. J Pharm Pharmacol 42:450 –452.

BIOL PSYCHIATRY 2003;54:1222–1233

1231

Flores CM, Davila-Garcia MI, Ulrich YM, Kellar KJ (1997): Differential regulation of neuronal nicotinic receptor binding sites following chronic nicotine administration. J Neurochem 69:2216 –2219. Freedman R, Coon H, Myles-Worsley M, Orr-Urtreger A, Oliney A, Davis A, et al (1997): Linkage of a neurophysiological deficit in schizophrenia to a chromosome 15 locus. Proc Natl Acad Sci U S A 94:587–592. Freedman R, Hall M, Adler LE, Leonard S (1995): Evidence in postmortem brain tissue for decreased numbers of hippocampal nicotinic receptors in schizophrenia. Biol Psychiatry 38:22–33. Freedman R, Leonard S, Gault JM, Hopkins J, Cloninger CR, Knufmann CA, et al (2001): Linkage disequilibrium for schizophrenia at the chromosome 15q13–14 locus of the alpha7-nicotinic acetylcholine receptor subunit gene (CHRNA7). Am J Med Genet 105:20 –22. Gault J, Robinson M, Berger R, Drebing C, Logel J, Hopkins J, et al (1998): Genomic organization and partial duplication of the human alpha7 neuronal nicotinic acetylcholine receptor gene (CHRNA7). Genomics 52:173–185. Gluck MR, Thomas RG, Davis KL, Haroutunian V (2002): Implications for altered glutamate and GABA metabolism in the dorsolateral prefrontal cortex of aged schizophrenic patients. Am J Psychiatry 159:1165–1173. Graham AJ, Martin-Ruiz CM, Teaktong T, Ray MA, Court JA (2002): Human brain nicotinic receptors, their distribution and participation in neuropsychiatric disorders. Curr Drug Targets CNS Neurol Disord 1:387–397. Guan ZZ, Zhang X, Blennow K, Nordberg A (1999): Decreased protein level of nicotinic receptor alpha7 subunit in the frontal cortex from schizophrenic brain. Neuroreport 10:1779 –1782. Gur RE, Cowell P, Turetsky BI, Gallacher F, Cannon T, Bilker W, et al (1998): A follow-up magnetic resonance imaging study of schizophrenia. Relationship of neuroanatomical changes to clinical and neurobehavioral measures. Arch Gen Psychiatry 55:145–152. Haroutunian V, Davidson M, Kanof PD, Perl DP, Powchik P, Losoncay M, et al (1994): Cortical cholinergic markers in schizophrenia. Schizophr Res 12:137–144. Harvey PD (2001): Cognitive impairment in elderly patients with schizophrenia: Age related changes. Int J Geriatr Psychiatry 16(suppl 1):S78 –S85. Harvey PD, Howanitz E, Parrella M, White L, Davidson M, Mohn RC, et al (1998): Symptoms, cognitive functioning, and adaptive skills in geriatric patients with lifelong schizophrenia: A comparison across treatment sites. Am J Psychiatry 155:1080 –1086. Heckers S (1997): Neuropathology of schizophrenia: Cortex, thalamus, basal ganglia, and neurotransmitter-specific projection systems. Schizophr Bull 23:403–421. Hellstrom-Lindahl E, Mousavi M, Zhang X, Ravid R, Nordberg A (1999): Regional distribution of nicotinic receptor subunit mRNAs in human brain: Comparison between Alzheimer and normal brain. Brain Res Mol Brain Res 66:94 –103. Ichinose H, Ohye T, Fujita K, Pantucek F, Lange K, Riederer P, et al (1994): Quantification of mRNA of tyrosine hydroxylase and aromatic L-amino acid decarboxylase in the substantia

1232

BIOL PSYCHIATRY 2003;54:1222–1233

C.M. Martin-Ruiz et al

nigra in Parkinson’s disease and schizophrenia. J Neural Transm Park Dis Dement Sect 8:149 –158.

in cortical regions in schizophrenia. J Chem Neuroanat 22:115–126.

Kapur S, Remington G (1996): Serotonin-dopamine interaction and its relevance to schizophrenia. Am J Psychiatry 153:466 – 476.

Meador-Woodruff JH, Davis KL, Haroutunian V (2001): Abnormal kainate receptor expression in prefrontal cortex in schizophrenia. Neuropsychopharmacology 24:545–552.

Karson CN, Casanova MF, Kleinman JE, Griffin WS (1993): Choline acetyltransferase in schizophrenia. Am J Psychiatry 150:454 –459.

Mukherjee S, Mahadik SP, Korenovsky A, Laer H, Schnur DB, Reddy R (1994): Serum antibodies to nicotinic acetylcholine receptors in schizophrenic patients. Schizophr Res 12:131– 136.

Kay S (1991): Positive and negative syndromes in schizophrenia: Assessment and research. Clinical and Experimental Psychiatry. New York, NY: Brunner/Mazel. Kelley WM, Miezin FM, McDermott KB, Buckner RL, Raichle ME, Cohen NJ, et al (1998): Hemispheric specialization in human dorsal frontal cortex and medial temporal lobe for verbal and nonverbal memory encoding. Neuron 20:927–936. Kornhuber J, Schultz A, Wiltfang J, Meineke I, Gleiter CH, Zochling R, et al (1999): Persistence of haloperidol in human brain tissue. Am J Psychiatry 156:885–890. Krenz I, Kalkan D, Wevers A, de Vos RA, Steur EN, Lindstrom J, et al (2001): Parvalbumin-containing interneurons of the human cerebral cortex express nicotinic acetylcholine receptor proteins. J Chem Neuroanat 21:239 –246. Kroger JK, Sabb FW, Fales CL, Bookheimer SY, Cohen MS, Holyoak KJ (2002): Recruitment of anterior dorsolateral prefrontal cortex in human reasoning: A parametric study of relational complexity. Cereb Cortex 12:477–485. Lee PN (1987): Passive smoking and lung cancer association: A result of bias? Hum Toxicol 6:517–524. Liu CM, Hwu HG, Lin MW, Ou-Yang WC, Lee SF, Fann CS, et al (2001): Suggestive evidence for linkage of schizophrenia to markers at chromosome 15q13–14 in Taiwanese families. Am J Med Genet 105:658 –661. Lohr JB, Flynn K (1992): Smoking and schizophrenia. Schizophr Res 8:93–102. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951): Protein Measurement with the Folin phenol reagent. J Biol Chem 193:265–275. Lukas R, Ke L, Bencherif M, Eisenlour C (1996): Regulation by nicotine of its own receptors. Drug Dev Res 38:136 –148. Manes F, Sahakian B, Clark L, Rogers R, Antoun N, Aitken M, et al (2002): Decision-making processes following damage to the prefrontal cortex. Brain 125:624 –639. Marks MJ, Pauly JR, Gross SD, Deneris DS, Hermans-Borgmeyor I, Heinemann SF, et al (1992): Nicotine binding and nicotinic receptor subunit RNA after chronic nicotine treatment. J Neurosci 12:2765–2784. Martin-Ruiz CM, Piggott M, Gotti C, Lindstrom J, Mendelow AD, Siddique JS, et al (2000): Alpha and beta nicotinic acetylcholine receptors subunits and synaptophysin in putamen from Parkinson’s disease. Neuropharmacology 39:2830 –2839. Marutle A, Warpman U, Bogdanovic N, Nordberg A (1998): Regional distribution of subtypes of nicotinic receptors in human brain and effect of aging studied by (⫾)-[3H]epibatidine. Brain Res 801:143–149. Marutle A, Zhang X, Court J, Piggott M, Johnson M, Perry R, et al (2001): Laminar distribution of nicotinic receptor subtypes

Noga JT, Hyde TM, Herman MM, Spurney CF, Bigelow LB, Weinberger DR, et al (1997): Glutamate receptors in the postmortem striatum of schizophrenic, suicide, and control brains. Synapse 27:168 –176. Pauly JR, Marks MJ, Gross SD, Collins AC (1991): An autoradiographic analysis of cholinergic receptors in mouse brain after chronic nicotine treatment. J Pharmacol Exp Ther 258:1127–1136. Perry EK, Smith CJ, Court JA, Perry RH (1990): Cholinergic nicotinic and muscarinic receptors in dementia of Alzheimer, Parkinson and Lewy body types. J Neural Transm Park Dis Dement Sect 2:149 –158. Picciotto MR, Caldarone BJ, King SL, Zachariou V (2000): Nicotinic receptors in the brain. Links between molecular biology and behavior. Neuropsychopharmacology 22:451– 465. Prohovnik I, Dwork AJ, Kaufman MA, Willson N (1993): Alzheimer-type neuropathology in elderly schizophrenia patients. Schizophr Bull 19:805–816. Purohit DP, Perl DP, Haroutunian V, Powchik P, Davidson M, Davis KL (1998): Alzheimer disease and related neurodegenerative diseases in elderly patients with schizophrenia: A postmortem neuropathologic study of 100 cases. Arch Gen Psychiatry 55:205–211. Rajkowska G, Miguel-Hidalgo J, Makkos Z, Meltzer H, Overholser J, Stockmeier C (2002): Layer-specific reductions in GFAP-reactive astroglia in the dorsolateral prefrontal cortex in schizophrenia. Schizophr Res 57:127. Rapoport JL, Giedd JN, Blumenthal J, Hamburger S, Jeffries N, Fernandez T, et al (1999): Progressive cortical change during adolescence in childhood-onset schizophrenia. A longitudinal magnetic resonance imaging study. Arch Gen Psychiatry 56:649 –654. Reid RT, Sabbagh MN, Corey-Bloom J, Tiraboschi P, Thal LJ (2000): Nicotinic receptor losses in dementia with Lewy bodies: Comparisons with Alzheimer’s disease. Neurobiol Aging 21:741–746. Rezvani AH, Levin ED (2001): Cognitive effects of nicotine. Biol Psychiatry 49:258 –267. Riley B, Williamson M, Collier D, Wilkie H, Makoff A (2002): A 3-Mb map of a large Segmental duplication overlapping the alpha7-nicotinic acetylcholine receptor gene (CHRNA7) at human 15q13-q14. Genomics 79:197–209. Rugg MD, Otten LJ, Henson RN (2002): The neural basis of episodic memory: Evidence from functional neuroimaging. Philos Trans R Soc Lond B Biol Sci 357:1097–1110. Rypma B, Berger JS, D’Esposito M (2002): The influence of working-memory demand and subject performance on prefrontal cortical activity. J Cogn Neurosci 14:721–731.

Dementia, Schizophrenia, and nAChR Subunits

Sanderson EM, Drasdo AL, McCrea K, Wonnacott S (1993): Upregulation of nicotinic receptors following continuous infusion of nicotine is brain-region-specific. Brain Res 617:349 –352. Sedvall G, Farde L (1995): Chemical brain anatomy in schizophrenia. Lancet 346:743–749. Sharma G, Vijayaraghavan S (2001): Nicotinic cholinergic signaling in hippocampal astrocytes involves calcium-induced calcium release from intracellular stores. Proc Natl Acad Sci U S A 98:4148 –4153. Shenton ME, Dickey CC, Frumin M, McCarley RW (2001): A review of MRI findings in schizophrenia. Schizophr Res 49:1–52. Stassen HH, Bridler R, Hagele S, Hergersberg M, Mehmann B, Schinzel A, et al (2000): Schizophrenia and smoking: Evidence for a common neurobiological basis? Am J Med Genet 96:173–177. Tandon R, Greden JF (1989): Cholinergic hyperactivity and negative schizophrenic symptoms. A model of cholinergic/ dopaminergic interactions in schizophrenia. Arch Gen Psychiatry 46:745–753. Tiraboschi P, Hansen LA, Alford M, Sabbagh MN, Schoos B, Masliah E, et al (2000): Cholinergic dysfunction in diseases with Lewy bodies. Neurology 54:407–411. Tsuang DW, Skol AD, Faraone SV, Bingham S, Young KA, Prabhadesai S, et al (2001): Examination of genetic linkage of

BIOL PSYCHIATRY 2003;54:1222–1233

1233

chromosome 15 to schizophrenia in a large Veterans Affairs Cooperative Study sample. Am J Med Genet 105:662–668. Utsugisawa K, Nagane Y, Tohgi H, Yoshimura M, Ohba H, Genda Y (1999): Changes with aging and ischemia in nicotinic acetylcholine receptor subunit alpha7 mRNA expression in postmortem human frontal cortex and putamen. Neurosci Lett 270:145–148. Wagner AD, Poldrack RA, Eldridge LL, Desmond JE, Glover GH, Gabrieli JD (1998): Material-specific lateralization of prefrontal activation during episodic encoding and retrieval. Neuroreport 9:3711–3717. Weickert CS, Webster MJ, Hyde TM, Herman MM, Bachus SE, Bali G, et al (2001): Reduced GAP-43 mRNA in dorsolateral prefrontal cortex of patients with schizophrenia. Cereb Cortex 11:136 –147. Wevers A, Monteggia L, Nowacki S, Block W, Schutz U, Lindstrom J, et al (1999): Expression of nicotinic acetylcholine receptor subunits in the cerebral cortex in Alzheimer’s disease: Histotopographical correlation with amyloid plaques and hyperphosphorylated-tau protein. Eur J Neurosci 11:2551–2565. Ziedonis DM, Kosten TR, Glazer WM, Frances RJ (1994): Nicotine dependence and schizophrenia. Hosp Community Psychiatry 45:204 –206. Zoli M, Lena C, Picciotto MR, Changeux JP (1998): Identification of four classes of brain nicotinic receptors using beta2 mutant mice. J Neurosci 18:4461–4472.