Design, synthesis and biological evaluation of cinnamic acid derivatives with synergetic neuroprotection and angiogenesis effect

European Journal of Medicinal Chemistry 183 (2019) 111695

Contents lists available at ScienceDirect

European Journal of Medicinal Chemistry journal homepage: http://www.elsevier.com/locate/ejmech

Research paper

Design, synthesis and biological evaluation of cinnamic acid derivatives with synergetic neuroprotection and angiogenesis effect Wen-Xi Zhang, Hui Wang, He-Rong Cui, Wen-Bo Guo, Fei Zhou, De-Sheng Cai, Bing Xu, Xiao-Hui Jia, Xue-Mei Huang, Yu-Qin Yang, Hong-Shan Chen, Jin-Chai Qi, Peng-Long Wang**, Hai-Min Lei* School of Chinese Pharmacy, Beijing University of Chinese Medicine, Beijing, 100102, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 1 August 2019 Received in revised form 9 September 2019 Accepted 10 September 2019 Available online 13 September 2019

As for complex brain diseases involved with multiple pathogenic factors, it is extremely difficult to achieve curative effect by acting on a single target. Multi-approach drugs provide a promising prospect in the treatment of complex brain diseases and have been attracting more and more interest. Enlightened by synergetic effect of combination in traditional herb medicines, forty-two novel cinnamic acid derivatives were designed and synthesized by introducing capsaicin and/or ligustrazine moieties to enhance biological activities in both neurological function and neurovascular protection. Elevated levels of cell viability on human brain microvascular endothelium cell line (HBMEC-2) and human neuroblastoma cell line (SH-SY5Y) against free radical injury were observed in most of compounds. Among them, compound 14a exhibited the most potent activities with a significant EC50 value of 3.26 ± 0.16 mM (HBMEC-2) and 2.41 ± 0.10 mM (SH-SY5Y). Subsequently, the results of morphological staining and flow cytometry analysis experiments on both cell lines showed that 14a had the potential to block apoptosis, maintain cell morphological integrity and protect physiological function of mitochondria. Moreover, 14a displayed specific angiogenesis effect in the chick chorioallantoic membrane (CAM) assay; and the results of RT-PCR suggested that the mechanism for angiogenesis effect was associated with the enhancement of the expressions of VEGFR2 mRNA in chick embryo. Preliminary structure-activity relationship was analyzed. The above evidences suggested that conjunctures gained by combining active ingredients in traditional herb medicines deserved further study and might provide references in discovering dualeffective lead compounds for brain diseases. © 2019 Elsevier Masson SAS. All rights reserved.

Keywords: Cinnamic acids Brain injury Neuroprotective Angiogenesis Dual effects

1. Introduction The consequence of diverse brain injury is one of the leading health issues globally characterized by high morbidity and disability [1], and it may induce various lethal diseases. Among these, ischemic stroke has become a major brain disease causing substantial medical health burdens [2]. The pathogenesis of ischemic stroke is complex, involving with multiple signaling pathway damage and various pathological processes such as oxidative stress, apoptosis, inflammation and excitotoxicity, all of which interacting with multiple mechanisms, triggering each other, and eventually leading to neuronal apoptosis [3e5]. Therapeutic

* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (P.-L. Wang), [email protected] (H.-M. Lei). https://doi.org/10.1016/j.ejmech.2019.111695 0223-5234/© 2019 Elsevier Masson SAS. All rights reserved.

strategies such as antioxidants, anti-apoptotic agents, ROS scavengers have been intriguing research areas [6e8]. Despite the remarkable progress achieved in theory, the therapeutic drugs clinically have not achieved satisfactory efficiency until now. As for complex brain diseases involved with multiple pathogenic factors, it is extremely difficult to achieve curative effect by acting on a single target [9]. For several decades, most therapeutic concepts for stroke treatment were focused on neuroprotection [10]. Nowadays, researchers suggest that new vessel formation after ischemic stroke not only increases oxygen and nutrient supply to the affected tissue, but also promotes nerve recovery processes, including nerve regeneration and synaptogenesis, which in turn lead to the improvement of functional recovery [11e13]. After a stroke in the peri-infarct cortex, the neurogenesis and migration of newly born neurons are extensively associated with angiogenesis. Angiogenic

2

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

vessels provide neurotrophic support to newly generated neurons [14]. It has been reported that higher microvessel density in the ischemic border indeed correlates with longer survival in stroke patients [15]. Promoting angiogenesis to establish a new vascular system rapidly after ischemic stroke is beneficial to salvage potentially reversible ischemic tissue (ischemic penumbra) and to improve nerve function [16,17]. The coupling of angiogenesis and neuroprotection provides a new approach for the drug design. Indeed, recent experimental therapies have attempted to capitalize the combination of neuroprotective agents and pro-angiogenic drugs to promote recovery of brain diseases [18]. As therapies modulating single target seem not to provide satisfied benefits clinically because of the complexity of brain diseases, combination therapies using various agents to confer multieffects have been attracting increasing attention [19,20]. Researches have shown that the combination of drugs that differ in mode of action could provide pleiotropic effects and yield further improvement in the treatment of complex brain diseases [21,22]. Structure modification based on “combination principle” to find multi-approach and multi-functional drugs with synergic effects from active ingredients of traditional medicines has been regarded to be a promising strategy and will inevitably become a focus in short future [23,24]. For more than a decade, our lab have focused on phenolic acid, tyramine and pyrazine ingredients to discover lead compounds with multi-categories from traditional medicines [25e29]. For example, cinnamic acid and some of its derivatives (e.g. ferulic acid) are major active phenolic acid components exist widely in traditional herb medicines such as Radix Angelica, Radix scrophulariae, Ligustrazine Chuangxiong Hort, which attained an extensive use in clinical treatment of ischemic stroke [30]. Cinnamic acids present various pharmacological activities including antioxidant, neuroprotection, antithrombosis, angiogenesis and vascular protection capacity [31e33]. Clinical drugs for treatment of cerebrovascular diseases such as Ozagrel, cinepazide also contain the structure of cinnamic acids (Fig. 1). Cinnamic acids have become a research focus in structural modification for its drug-like properties and biological characteristics; introduction of active phytochemical moieties offers the potential to exert additive or synergistic effects to find multi-effective novel derivatives. Meanwhile, capsaicin, is also a neuroprotective tyramine component derived from Capsicum annuum [34]. As a TRPV1 receptor agonist, capsaicin exhibits significant neuroprotectant effect and its vanilla amide part has been demonstrated to be the critical structure to exert bioactivities [35e37]. Ligustrazine (2,3,5,6-tetramethylpyrazine, TMP), one of the major effective pyrazine component of traditional herb medicine Ligustrazine Chuangxiong Hort, has been widely used as a

multifunctional drug for ischemic stroke therapy in China for many years [38,39]. More interestingly, classical Chinese herbal prescriptions such as Buyang Huanwu Decoction (BHD), DangguiShaoyao-San (DSS) have been proved to be capable to create pharmacological superposition effects, actually their main active ingredients included ligustrazine, cinnamic acid and some of its derivatives [40,41]. Inspired by biological characteristics of them, we introduced ligustrazine and/or capsaicin moieties into cinnamic acids to enhance biological activities and obtain additive or synergistic effects. The drug design was illuminated as shown in Fig. 1. All of the designed forty-two targeted derivatives were synthesized and characterized by 1H NMR, 13C NMR and HR-MS analysis in this study. Their neuroprotective effects and angiogenic activities were assessed in vitro/in vivo. 2. Results and discussion 2.1. Chemical synthesis The synthetic routes for all the designed forty-two targeted derivatives were depicted in Schemes 1e4. Firstly, the 3,5,6trimethylpyrazine-2-chloride (TMP-Cl) was synthesized according to our previous study (Scheme 1) [42]. As shown in Scheme 2-method a, Compounds 1a-16a were synthesized through the combination of different substituted cinnamic acids and vanilla amide part of capsaicin under catalyzed by 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDCI), N-hydroxybenzotrizole (HOBT) and N, N-diisopropyl ethylamine (DIEPA) in anhydrous Dimethyl Formamide (DMF). To protect the carboxyl groups of cinnamic acid, methyl-esterification was firstly performed and then deprotection was performed under alkaline conditions to afford compounds 2b-6b (Scheme 3). Then according to whether cinnamic acid contains phenolic hydroxyl groups, we used different synthetic routes to combine TMP-Cl with the above-mentioned 1a-16a compounds through different conjunct sites. Compounds 1c, 7c-16c were obtained by coupling 1a, 7a-16a with TMP-Cl under catalyzed by K2CO3 in anhydrous DMF directly (Scheme 2-method b). As compounds 2a-6a contain

Scheme 1. Synthesis of 3,5,6-trimethylpyrazine-2-chloride. Reagents and Conditions: (a) NCS, BPO, CCl4, high-light, 85
C, 3 h.

Fig. 1. Design of cinnamic acid-capsaicin-ligustrazine derivatives.

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

3

Scheme 2. Synthesis of 1a-16a, 1c, 7c-16c, 2d-6d. Reagents and Conditions: (a) EDCI, DIEPA, Hobt, DMF, room temperature, 4 h; (b) 3,5,6-trimethylpyrazine-2-chloride, K2CO3, DMF, 80
C, 4 h; (c) 3,5,6-trimethylpyrazine-2-chloride, K2CO3, DMF, 85
C, 6 h.

Scheme 3. Synthesis of 2b-6b. Reagents and Conditions: (a) MeOH, SoCl2, room temperature, 1 h; (b) K2CO3, DMF, 80
C,3 h; (c) THF-MeOH-H2O (3:1:1), NaOH (10%), 60
C, 2 h; (d) EDCI, DIEPA, Hobt, DMF, room temperature, 4 h.

Scheme 4. Synthesis of 2c-6c. Reagents and Conditions: (a) Boc2O, Et3N, MeOH, room temperature, 1 h; (b) 3,5,6-trimethylpyrazine-2-chloride, K2CO3, DMF, 80
C, 2 h; (c) TFA (20%), CH2Cl2, room temperature, 1 h; (d) EDCI, DIEPA, Hobt, DMF, room temperature, 4 h.

phenolic hydroxyl groups, we firstly introduced (Boc)2O to protect the amino group on the vanilla amide part of capsaicin, and then deprotection was performed with trifluoroacetic acid (TFA) in dry DCM to gain compounds 2c-6c (Scheme 4). The synthesis of compounds 2d-6d was similar to that of 1c, 7c-16c, coupling two molecules of TMP-Cl under catalyzed by K2CO3 in anhydrous DMF (Scheme 2-method c). As shown in Table 1, the overall novel cinnamic acid-capsaicin-ligustrazine derivatives were obtained and their structures were all characterized by 1H NMR, 13C NMR and HRMS analysis.

2.2. Biological activities 2.2.1. The establishment of H2O2-induced injury model in HBMEC2/SH-SY5Y cells Oxidative stress is one of the major pathogenesis that causes a variety of brain diseases [43]. A growing body of evidence supports that the occurrence of diverse brain diseases is closely related to the increase of oxidation products and apoptosis [44]. There have been quantities of reports on the relationship between oxidative stress and nervous system using human brain microvascular endothelium

4

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

Table 1 The EC50 Values (mM) of cinnamic acid-capsaicin-ligustrazine derivatives on H2O2-induced HBMEC-2/SH-SY5Y cells (n ¼ 3) and their structures. No.

Structure

No.

EC50 (HBMEC-2/SH-SY5Y)

Structure

No.

EC50 (HBMEC-2/SH-SY5Y)

No.

Structure EC50 (HBMEC-2/SH-SY5Y)

1c

1a

9.8 ± 0.66/3.66 ± 0.17 2a

4.99 ± 0.33/7.31 ± 0.06 2b

7.46 ± 1.03/9.76 ± 1.62 3a

2c

6.65 ± 0.57/11.98 ± 0.11 3b

5.75 ± 0.23/8.62 ± 0.44 4a

11.85 ± 0.77/7.85 ± 0.69

6.23 ± 0.36/3.74 ± 0.64

11.6 ± 0.18/10.23 ± 0.59

5.81 ± 0.37/13.43 ± 0.04 6c

9.30 ± 0.40/9.25 ± 0.15

12.02 ± 0.47/7.15 ± 0.42 8c

7.11 ± 0.48/5.24 ± 0.12

9.87 ± 0.35/4.32 ± 0.38 9c

10.44 ± 0.35/11.41 ± 0.44 10a

6.56 ± 0.17/5.05 ± 0.07 10c

13.13 ± 1.92/5.49 ± 0.36 11a

6.31 ± 0.36/7.15 ± 0.42 11c

8.85 ± 0.09/11.00 ± 0.09 12a

15.84 ± 1.34/4.47 ± 0.10 12c

7.81 ± 0.32/4.86 ± 0.20

12.93 ± 0.95/8.66 ± 0.28 13c

14.51 ± 1.08/11.06 ± 0.45 6d

13.49 ± 0.67/8.56 ± 0.54

6.48 ± 0.61/5.98 ± 0.03

9a

21.42 ± 1.30/7.77 ± 0.08 5d

7c

8a

12.76 ± 1.39/8.7 ± 0.23 4d

5c

6b

7a

6.17 ± 0.40/3.68 ± 0.20

12.53 ± 0.96/5.37 ± 0.17

6.34 ± 0.40/9.30 ± 0.61

15.1 ± 1.14/6.28 ± 0.22 3d

4c

5b

6a

6.07 ± 0.71/5.30 ± 0.19

10.58 ± 1.07/8.09 ± 0.07

8.04 ± 1.11/6.00 ± 0.12

2d

3c

4b

5a

13a

Structure EC50 (HBMEC-2/SH-SY5Y)

14.63 ± 0.11/11.58 ± 0.16

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

5

Table 1 (continued ) No.

Structure

No.

EC50 (HBMEC-2/SH-SY5Y)

Structure

No.

EC50 (HBMEC-2/SH-SY5Y)

EC50 (HBMEC-2/SH-SY5Y)

10.47 ± 0.41/9.50 ± 0.13

No.

Structure EC50 (HBMEC-2/SH-SY5Y)

11.80 ± 0.47/11.04 ± 0.26 14c

14a

3.26 ± 0.16/2.41 ± 0.10

12.5 ± 0.54/3.62 ± 0.05

15a

15c

2.59 ± 0.31/5.91 ± 0.16

3.55 ± 0.44/11.53 ± 0.11

16a

4.82 ± 0.22/7.45 ± 0.56 Edaravone 4.61 ± 0.17/3.75 ± 0.14

16c

TMP 15.18 ± 0.29/17.59 ± 0.24

cells, human neuroblastoma cells as in vitro model. Vascular endothelial cell injury is an important pathogenesis in ischemic stroke, while SH-SY5Y cells are recognized as a commen model for evaluating the function of nerve cells [45,46]. Therefore in this study, injury models induced by H2O2 in HBMEC-2/SH-SY5Y cell lines were established, laying a foundation for the evaluation of cinnamic acids derivatives’ effects on brain injury models, and furthermore for the mechanism research of protective effects against free radical damage. According to the results of MTT assay (Table 2), different concentrations of H2O2 solution exhibited different degrees of damage to HBMEC-2/SH-SY5Y cells, and with the increase of concentration, the survival rate of HBMEC-2/SH-SY5Y cells decreased gradually, showing a dose-effect relationship. According to results in Table 2, 0.6 mM H2O2 was selected to treat HBMEC-2 cells and meanwhile also 0.6 mM H2O2 for SH-SY5Y cells to investigate the possible protective effects of target derivatives against the damage induced by H2O2. 2.2.2. Protection of cinnamic acids derivatives against H2O2induced damage in HBMEC-2/SH-SY5Y cells The 50% effective concentrations (EC50) of target compounds for protecting damaged HBMEC-2/SH-SY5Y cells evaluated by MTT assay were summarized in Table 1. Most of the compounds showed higher cell viability against H2O2-induced cell death in HBMEC2 cells compared with capsaicin's vanilla amide part and TMP. Among them, the compounds 14a and 15a exhibited the highest capacity in neuroprotection with the EC50 value of 3.26 ± 0.16 mM and 2.59 ± 0.31 mM, respectively. Elevated levels of cell viability were also observed in most of the compounds in SH-SY5Y cells. Most of the derivatives were more active (with lower EC50 values) than capsaicin's vanilla amide part Table 2 Effect of different concentrations of H2O2 on the survival rate of HBMEC-2/SH-SY5Y cells. H2O2 (mM)

0.3 0.6 0.9 1.2 1.5

Structure

cell survival rate HBMEC-2

SH-SY5Y

0.70 ± 0.02 0.60 ± 0.03 0.56 ± 0.03 0.47 ± 0.03 0.40 ± 0.03

0.73 ± 0.06 0.56 ± 0.05 0.47 ± 0.02 0.35 ± 0.04 0.29 ± 0.01

18.12 ± 0.22/3.84 ± 0.44 Capsaicin 16.37 ± 0.44/14.02 ± 0.22

and TMP. Among them, the compounds 14a and 14c displayed the most potent activity with a significant EC50 value of 2.41 ± 0.10 mM and 3.62 ± 0.05 mM, respectively. According to the experimental data above, 14a performed optimal protective activity in both HBMEC-2 cells and SH-SY5Y cells and were even better than Edarevone. Therefore, 14a was selected as the dominant compound for subsequent mechanism investigations. Preliminary structure-activity relationships analysis indicated that, the nature of the substituents played a vital role in the neuroprotective activity of derivatives. Compounds containing three methoxyl groups represented the optimal proliferation rates, implying methoxyl group was the most potential structure giving rise to protective activities, which was in accordance with our previous study [26]. Furthermore, most compounds containing single-ligustrazine or none-ligustrazine substituents exhibited better activities than that of bis-ligustrazine substituents, such as EC50: 3b < 3d, 4b < 4d, 5b < 5d, 6b < 6d. In addition, as for the derivatives containing single-ligustrazine, the position matters. Ligustrazine introduced to the hydroxyl group of capsaicin exhibited higher potency than that of cinnamic acids (EC50: 2c < 2b, 3c < 3b, 4c < 4b, 5c < 5b). 2.2.3. Protective effects of 14a on H2O2-induced cell apoptosis 2.2.3.1. Morphological analysis 2.2.3.1.1. Gimesa staining. Gimesa staining was performed to characterize the morphological protective effects of 14a on H2O2induced cell apoptosis under inverted phase-contrast microscope. As shown in Figs. 2 and 3, the cells in control group presented a normal cellular morphology, whereas phenomenon of cell shrinkage and cell disruption appeared in the model group. The number of cells in drug-administered groups were significantly higher than that in the model group. In summary, we found that 14a lead to an alleviated morphological lesion for H2O2-induced cell apoptosis in both HBMEC-2 cells and SH-SY5Y cells. 2.2.3.1.2. DAPI staining. To further study the mechanism of protective effects of 14a on H2O2-induced cells, the nuclear morphological changes in HBMEC-2/SH-SY5Y cells were observed using DAPI staining. As shown in Figs. 4 and 5, for both HBMEC2 cells and SH-SY5Y cells, intact cell bodies with clear round nuclei were observed in the control groups, while the number of cells decreased significantly and nuclear fragmentation with irregular shape formed in the model group, suggesting the validity of model group. As a result, the number of cells in administration groups

6

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

Fig. 2. Morphological detection of apoptosis using Gimesa staining on H2O2-induced HBMEC-2 cells treated with different concentrations of 14a (200  ): (A) control group; (B) model group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM.

Fig. 3. Morphological detection of apoptosis using Gimesa staining on H2O2-induced SH-SY5Y cells treated with different concentrations of 14a (200  ): (A) control group; (B) model group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM.

Fig. 4. Morphological detection of apoptosis using DAPI staining on H2O2-induced HBMEC-2 cells treated with different concentrations of 14a (200  ): (A) control group; (B) model group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM.

Fig. 5. Morphological detection of apoptosis using DAPI staining on H2O2-induced SH-SY5Y cells treated with different concentrations of 14a (200  ): (A) control group; (B) model group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM.

distinctly increased compared to the model group. What's more, nuclear fragmentation of the cells caused by apoptosis as well as the number of irregular cells was significantly reduced. At different doses of administration, the protective effects of the drugs appeared in a dose-dependent manner. Therefore, the results indicated that compound 14a could inhibit apoptosis in HBMEC-2/ SH-SY5Y cells. 2.2.3.2. Inhibition of apoptosis analysis using annexin V-FITC/PI staining. Inhibition of apoptosis is an effective way to prevent ischemic stroke [47]. The injury of cerebral ischemic penumbra is reversible, and the function of the brain tissue can be restored by inhibiting apoptosis and protecting the neurons in the penumbra [48]. For further study the function mechanism of compound 14a, annexin V-FITC/PI staining assay was performed. As shown in Fig. 6, when treated with 14a at three concentrations, the percentages of apoptotic cells (including early and late apoptosis ratios) decreased

to 28.4% (1.56 mM), 19.4% (3.13 mM), 18.5% (6.25 mM) from 37.5% in the model group. The anti-apoptotic effect of 14a on SH-SY5Y cells was similar to that of HBMEC-2 cells (Fig. 7), which took effect in a concentration-dependent manner. The apoptosis rate decreased from 31.9% in the model group to 28.2% (1.56 mM), 25.2% (3.13 mM), 16.6% (6.25 mM). The result demonstrated that 14a had the potential to inhibit the apoptosis of HBMEC-2 and SH-SY5Y cells induced by H2O2. 2.2.3.3. Mitochondrial membrane potential assay. Researches have shown that depolarization of the mitochondrial inner membrane was observed in stroke patients and animal brain tissue, leading to impaired oxidized phosphate and energy metabolism [49]. We performed mitochondrial membrane potential assay to estimate the effect of compound 14a on H2O2-induced loss of mitochondrial membrane potential in HBMEC-2/SH-SY5Y cells. Compared with the control group, the fluorescence intensity of the model group

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

7

Fig. 6. Apoptosis analysis using Annexin V-FITC/PI staining of 14a with different concentrations on H2O2-induced HBMEC-2 cells: (A) control group; (B) model group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM (Q1, normal cells that are mechanically damaged; Q2, late apoptotic cells; Q3, normal cells; Q4, early apoptotic cells).

Fig. 7. Apoptosis analysis using Annexin V-FITC/PI staining of 14a with different concentrations on H2O2-induced SH-SY5Y cells: (A) control group; (B) model group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM (Q1, normal cells that are mechanically damaged; Q2, late apoptotic cells; Q3, normal cells; Q4, early apoptotic cells).

was decreased, which demonstrated the mitochondrial membrane potential was decreased. Compared with the model group, the enhancement of green fluorescence intensity in the drug groups was observed (Figs. 8 and 9), indicating that 14a could suppress the decrease in mitochondrial transmembrane potential caused by hydrogen peroxide and inhibit neuronal apoptosis.

2.2.4. CAM assay in vivo CAM assay was performed to evaluate the angiogenesis effect of compound 14a. As shown in Fig. 10, the vascular density of chick embryo chorioallantoic membrane increased significantly, and the microvessels were more obvious compared to the control group, indicating that the compound 14a had an effect of promoting

8

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

Fig. 8. Effects of compound 14a on H2O2-induced loss of mitochondrial membrane potential in HBMEC-2 cells: (A) control group; (B) model group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM.

Fig. 9. Effects of compound 14a on H2O2-induced loss of mitochondrial membrane potential in SH-SY5Y cells: (A) control group; (B) model group; (C) 1.56 mM; (D) 3.13 mM; (E) 6.25 mM.

Fig. 10. Effects of compound 14a on the angiogenesis of CAM: (A) control group; (B) 0.5 mg/mL; (C) 1 mg/mL; (D) 2 mg/mL.

angiogenesis. Its pro-angiogenic activity was optimal at the concentration of 1 mg/mL. 2.2.5. VEGFR2 mRNA expression detected by RT-PCR Vascular endothelial growth factor (VEGF) is a key factor in angiogenesis [50]. After binding to its receptor, VEGF can promote endothelial cell proliferation, adhesion and migration to initiate

angiogenesis, furthermore can stimulate the penumbra neovascularization in the ischemic region and establish collateral circulation [51,52]. Besides, VEGF is also a neuroprotective agent. When ischemic cerebrovascular disease occurs, it can help to reduce the apoptosis of neurons, and increase neurogenesis of the subventricular zone [53,54]. To explore whether compound 14a could promote angiogenesis

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

9

our previous study. In brief, N-Chlorosuccinimide (1 equiv.) was suspended in CCl4, then TMP (1.2 equiv.) was added. Upon completion of the reaction, the mixture was stirred at room temperature for 2 h, and then under highlight at 85
C for 2 h. As flotage appeared in the upper layer of the solvent and the solution became clear and yellow, monitor the mixture by TLC. After completion of the reaction, the CCl4 was evaporated and the irritating yellow liquid was purified by flash chromatography to produce a transparent oily liquid (3,5,6-trimethylpyrazine-2-chloride).

Fig. 11. Compound 14a0 s effect on VEGFR2 gene expression in chick embryo (n ¼ 3). *P < 0.05 as compared to control group.

by up-regulating VEGFR2 gene, the expression of VEGFR2 mRNA on chick embryo was detected by Real-Time PCR. As shown in Fig. 11, the VEGFR2 mRNA in administrated chick embryo (1 mg/mL) increased significantly compared with the control group, indicating that the angiogenesis mechanism of 14a was involved with VEGFR2 signal pathway. The analyzed results were statistically significant. 3. Conclusions Above all, forty-two novel cinnamic acids derivatives were designed and synthesized, all of which were characterized by 1H NMR, 13C NMR and HR-MS analysis. The results of activity test demonstrated that most of the compounds displayed effective protection capacity against H2O2-induced cell death in HBMEC2 cells and SH-SY5Y cells, especially the compound 14a. It exhibited the most potent activities both on the nerve cells and the endothelium cells with the significant EC50 value of 3.26 ± 0.16 mM and 2.41 ± 0.10 mM respectively, which was even better than edaravone. Therefore, 14a was selected as the dominant compound for subsequent mechanism investigations. Morphological analysis indicated that compound 14a could improve cell survival rates, maintain cell integrity and block apoptosis. The detection of apoptosis and mitochondrial membrane potential demonstrated that compound 14a inhibited HBMEC-2/SH-SY5Y cells apoptosis and was correlated with stabilizing mitochondria membrane potential. In CAM assay, the vascular density of the chorioallantoic membrane increased significantly in administrated group compared with the injury group, and the results of Real-Time PCR demonstrated that 14a increased gene expression of VEGFR2 mRNA on chick embryo, indicating that compound 14a had an effect of promoting angiogenesis, and its mechanism might correlate with up-regulating VEGFR2 signal pathway. Altogether, the results of the series of cinnamic acids derivatives supported the potential value of neuroprotection and angiogenesis, suggesting that the attempt to apply structure combination to discover lead compounds with dual effects gained by combining active ingredients in traditional herb medicines was viable and deserved further study. 4. Experimental section 4.1. Chemistry 4.1.1. General synthesis of 3,5,6-trimethylpyrazine-2-chloride 3,5,6-trimethylpyrazine-2-chloride was prepared according to

4.1.2. General synthesis of compounds 1a-16a 4-Hydroxy-3-methoxybenzylamine hydrochloride (1.0 equiv.) and the corresponding cinnamic acid (1.0 equiv.) were dissolved in anhydrous DMF, then EDCI (0.75 equiv.)/HOBT (0.6 equiv.)/DIEPA (0.75 equiv.) was added and the mixture was stirred at room temperature for 4 h. After completion of the reaction as indicated by TLC, the reagent was extracted with ethyl acetate 3 times. After collecting the organic phase, anhydrous Na2SO4 and saturated NaCl were used to dry it over. Evaporating the solvent under vacuum, purification of the crude products was performed by flash chromatography. 4.1.2.1. (E)-N-(4-hydroxy-3-methoxybenzyl)cinnamamide (compound 1a). White powder, m.p.: 141.4e142.3
C, yield: 92.20%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.84 (s, 1H, -OH), 8.47 (t, J ¼ 5.7 Hz, 1H, -NH), 7.56 (d, J ¼ 7.3 Hz, 2H), 7.46 (d, J ¼ 15.8 Hz, 1H), 7.39 (dq, J ¼ 15.8, 7.3 Hz, 3H), 6.88 (s, 1H), 6.75e6.66 (m, 3H), 4.29 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 164.72, 147.45, 145.54, 138.74, 134.93, 130.02, 129.41, 128.92, 127.49, 122.23, 120.02, 115.25, 112.00, 55.59, 42.26. HRMS (ESI) m/z: 284.1281 [MþH]þ, calcd. for C17H17NO3: 284.1281. 4.1.2.2. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(2-hydroxyphenyl) acrylamide (compound 2a). White powder, m.p.: 200.8e202.0
C, yield: 73.24%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 10.01 (s, 1H, -OH), 8.83 (s, 1H, -OH), 8.43 (t, J ¼ 5.7 Hz, 1H, -NH), 7.67 (d, J ¼ 15.7 Hz, 1H), 7.41 (d, J ¼ 7.5 Hz, 1H), 7.17 (t, J ¼ 7.5 Hz, 1H), 6.89 (d, J ¼ 8.3 Hz, 1H), 6.87 (s, 1H), 6.82 (t, J ¼ 7.5 Hz, 1H), 6.70 (m, 3H), 4.27 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.37, 156.23, 147.42, 145.46, 134.62, 130.41, 130.25, 128.11, 121.69, 121.62, 119.96, 119.32, 116.06, 115.22, 111.95, 55.58, 42.20. HRMS (ESI) m/z: 300.1227 [MþH]þ, calcd. for C17H17NO4: 300.1230. 4.1.2.3. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(3-hydroxyphenyl) acrylamide (compound 3a). White powder, m.p.: 150.8e151.8
C, yield: 81.14%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 9.57 (s, 1H, -OH), 8.86 (s, 1H, -OH), 8.47 (t, J ¼ 5.7 Hz, 1H, -NH), 7.36 (d, J ¼ 15.7 Hz, 1H), 7.20 (t, J ¼ 7.5 Hz, 1H), 6.97 (d, J ¼ 7.5 Hz, 1H), 6.93 (s, 1H), 6.87 (s, 1H), 6.77 (d, J ¼ 7.9 Hz, 1H), 6.72 (d, J ¼ 7.9 Hz, 1H), 6.69 (d, J ¼ 7.9 Hz, 1H), 6.60 (d, J ¼ 15.7 Hz, 1H), 4.28 (d, J ¼ 5.6 Hz, 2H, -CH2), 3.78 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 164.75, 157.68, 147.45, 145.53, 138.94, 136.19, 130.03, 129.91, 121.96, 120.02, 118.71, 116.65, 115.25, 113.64, 111.99, 55.58, 42.24. HRMS (ESI) m/z: 300.1243 [MþH]þ, calcd. for C17H17NO4: 300.1230. 4.1.2.4. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(4-hydroxyphenyl) acrylamide (compound 4a). White powder, m.p.: 196.3e197.0
C, yield: 84.56%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 9.81 (s, 1H, -OH), 8.82 (s, 1H, -OH), 8.33 (t, J ¼ 5.7 Hz, 1H, -NH), 7.38 (d, J ¼ 8.4 Hz, 2H), 7.34 (s, 1H), 6.86 (s, 1H), 6.79 (d, J ¼ 8.4 Hz, 2H), 6.72 (d, J ¼ 8.0 Hz, 1H), 6.68 (d, J ¼ 8.0 Hz, 1H), 6.46 (d, J ¼ 15.7 Hz, 1H), 4.27 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.74 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.41, 159.02, 147.64, 145.69, 139.06,

10

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

130.44, 129.40, 126.13, 120.16, 118.86, 115.94, 115.44, 112.16, 55.79, 42.38. HRMS (ESI) m/z: 300.1228 [MþH]þ, calcd. for C17H17NO4: 300.1230. 4.1.2.5. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(4-hydroxy-3methoxyphenyl)acrylamide (compound 5a). White powder, m.p.: 181.2e182.4
C, yield: 78.98%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 9.41 (s, 1H, -OH), 8.83 (s, 1H, -OH), 8.31 (t, J ¼ 5.7 Hz, 1H, -NH), 7.35 (d, J ¼ 15.7 Hz, 1H), 7.12 (s, 1H), 6.99 (d, J ¼ 8.2 Hz, 1H), 6.86 (s, 1H), 6.79 (d, J ¼ 8.2, 1H), 6.72 (d, J ¼ 8.0 Hz, 1H), 6.68 (d, J ¼ 8.0 Hz, 1H), 6.50 (d, J ¼ 15.7 Hz, 1H), 4.27 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.80 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.21, 148.26, 147.81, 147.45, 145.48, 139.14, 130.25, 126.43, 121.49, 119.96, 118.97, 115.67, 115.24, 111.95, 110.81, 55.59, 55.51, 42.21. HRMS (ESI) m/z: 330.1337 [MþH]þ, calcd. for C18H19NO5: 330.1336. 4.1.2.6. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(3-hydroxy-4methoxyphenyl)acrylamide (compound 6a). White powder, m.p.: 155.4e156.5
C, yield: 89.12%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 9.18 (s, 1H, -OH), 8.84 (s, 1H, -OH), 8.38 (t, J ¼ 5.7 Hz, 1H, -NH), 7.31 (d, J ¼ 15.6 Hz, 1H), 6.98 (s, 1H), 6.94 (d, J ¼ 6.3 Hz, 2H), 6.86 (s, 1H), 6.70 (q, J ¼ 7.9 Hz, 2H), 6.45 (d, J ¼ 15.6 Hz, 1H), 4.27 (d, J ¼ 4.9 Hz, 2H, -CH2), 3.79 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm):165.05, 149.16, 147.44, 146.68, 145.50, 138.90, 130.18, 127.80, 120.25, 119.98, 119.51, 115.24, 113.31, 112.09, 111.98, 55.58, 42.19. HRMS (ESI) m/z: 330.1345 [MþH]þ, calcd. for C18H19NO5: 330.1336. 4.1.2.7. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(2-methoxyphenyl) acrylamide (compound 7a). White powder, m.p.: 150.5e151.3
C, yield: 82.14%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.84 (s, 1H, -OH), 8.44 (t, J ¼ 5.7 Hz, 1H, -NH), 7.69 (d, J ¼ 15.9 Hz, 1H), 7.50 (d, J ¼ 7.5 Hz, 1H), 7.35 (t, J ¼ 7.8 Hz, 1H), 7.06 (d, J ¼ 8.3 Hz, 2H), 6.98 (t, J ¼ 7.5 Hz, 1H), 6.77e6.65 (m, 3H), 4.28 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.85 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.11, 157.51, 147.44, 145.51, 133.78, 130.77, 130.12, 127.78, 123.31, 122.58, 120.67, 120.02, 115.24, 112.00, 111.67, 55.58, 55.52, 42.24. HRMS (ESI) m/z: 314.1393 [MþH]þ, calcd. for C18H19NO4: 314.1387. 4.1.2.8. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(3-methoxyphenyl) acrylamide (compound 8a). White powder, m.p.: 142.6e143.5
C, yield: 86.24%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H, -OH), 8.45 (t, J ¼ 5.7 Hz, 1H, -NH), 7.43 (d, J ¼ 15.7 Hz, 1H), 7.32 (t, J ¼ 7.9 Hz, 1H), 7.13 (d, J ¼ 7.9 Hz, 1H), 7.11 (s, 1H), 6.94 (dd, J ¼ 8.1 Hz, 1.9 Hz, 1H), 6.87 (s, 1H), 6.74e6.66 (m, 3H), 4.29 (d, J ¼ 5.6 Hz, 2H, -CH2), 3.78 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 164.70, 159.58, 147.46, 145.55, 138.66, 136.38, 130.01, 129.96, 122.58, 120.02, 119.84, 115.26, 115.22, 112.61, 112.01, 55.59, 55.09, 42.28. HRMS (ESI) m/z: 314.1389 [MþH]þ, calcd. for C18H19NO4: 314.1387. 4.1.2.9. (E)-N-(4-hydroxy-3-methoxybenzyl)-3-(4-methoxyphenyl) acrylamide (compound 9a). White powder, m.p.: 171.9e173.2
C, yield: 83.57%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.84 (s, 1H, -OH), 8.37 (t, J ¼ 5.7 Hz, 1H, -NH), 7.50 (d, J ¼ 8.7 Hz, 2H), 7.41 (d, J ¼ 15.7 Hz, 1H), 6.97 (d, J ¼ 8.7 Hz, 2H), 6.87 (s, 1H), 6.72 (d, J ¼ 5.4 Hz, 1H), 6.69 (d, J ¼ 8.7 Hz, 1H), 6.54 (d, J ¼ 15.7 Hz, 1H), 4.28 (d, J ¼ 5.6 Hz, 2H, -CH2), 3.78 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.05, 160.29, 147.45, 145.51, 138.45, 130.17, 129.06, 127.50, 119.99, 119.74, 115.24, 114.38, 111.97, 55.58, 55.24, 42.21. HR-MS (ESI) m/z: [MþH]þ calcd for C18H19NO4: 314.1348, found: 314.1392. HRMS (ESI) m/z: 314.1392 [MþH]þ, calcd. for C18H19NO4: 314.1387.

4 .1. 2 .10 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z y l ) - 3 - ( 2 , 3 dimethoxyphenyl)acrylamide (compound 10a). White powder, m.p.: 196.3e197.6
C, yield: 90.7%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H, -OH), 8.50 (t, J ¼ 5.7 Hz, 1H, -NH), 7.66 (d, J ¼ 15.8 Hz, 1H), 7.16e7.04 (m, 3H), 6.87 (s, 1H), 6.71 (dd, J ¼ 13.5 Hz, 8.9, 3H), 4.28 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.82 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3), 3.74 (s, 3H,-OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 164.85, 152.85, 147.45, 147.37, 145.54, 133.17, 130.02, 128.52, 124.36, 123.42, 120.05, 118.49, 115.26, 113.75, 112.03, 60.63, 55.75, 55.58, 42.28. HRMS (ESI) m/z: 344.1493 [MþH]þ, calcd. for C19H21NO5: 344.1492. 4 .1. 2 .11. ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z y l ) - 3 - ( 3 , 4 dimethoxyphenyl)acrylamide (compound 11a). White powder, m.p.: 121.7e122.4
C, yield: 82.98%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.84 (s, 1H, -OH), 8.35 (t, J ¼ 5.7 Hz, 1H, -NH), 7.38 (t, J ¼ 15.8 Hz, 1H), 7.15 (s, 1H), 7.11 (d, J ¼ 8.4 Hz, 1H), 6.98 (d, J ¼ 8.4 Hz, 1H), 6.87 (s, 1H), 6.70 (q, J ¼ 8.4 Hz, 2H), 6.57 (d, J ¼ 15.8 Hz, 1H), 4.28 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.79 (s, 3H, -OCH3), 3.78 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.05, 150.07, 148.88, 147.45, 145.50, 138.79, 130.18, 127.73, 121.29, 119.97, 115.24, 111.97, 111.75, 110.02, 55.59, 55.54, 55.40, 42.23. HRMS (ESI) m/z: 344.1491 [MþH]þ, calcd. for C19H21NO5: 344.1492. 4 .1. 2 .1 2 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z y l ) - 3 - ( 3 , 5 dimethoxyphenyl)acrylamide (compound 12a). White powder, m.p.: 153.6e154.9
C, yield: 86.19%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H, -OH),8.43 (t, J ¼ 5.6 Hz, 1H, -NH), 7.38 (d, J ¼ 15.7 Hz, 1H), 6.87 (s, 1H), 6.73 (d, J ¼ 1.8 Hz, 2H), 6.71 (d, J ¼ 5.2 Hz, 2H), 6.67 (d, J ¼ 6.9 Hz, 1H), 6.51 (s, 1H), 4.28 (d, J ¼ 5.7 Hz, 2H, -CH2), 3.76 (s, 6H, 2* -OCH3), 3.75 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 164.66, 160.70, 147.46, 145.55, 138.71, 136.94, 129.99, 122.84, 120.02, 115.26, 112.01, 105.40, 101.47, 55.59, 55.25, 42.29. HRMS (ESI) m/z: 344.1496 [MþH]þ, calcd. for C19H21NO5: 344.1492. 4 .1. 2 .13 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z y l ) - 3 - ( 2 , 5 dimethoxyphenyl)acrylamide (compound 13a). White powder, m.p.: 140.3e141.1
C, yield: 81.25%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H, -OH), 8.43 (t, J ¼ 5.7 Hz, 1H, -NH), 7.66 (d, J ¼ 15.9 Hz, 1H), 7.06 (d, J ¼ 2.7 Hz, 1H), 7.00 (d, J ¼ 9.0 Hz, 1H), 6.94 (dd, J ¼ 9.0, 2.7 Hz, 1H), 6.87 (s, 1H), 6.71 (dd, J ¼ 15.9, 7.9 Hz, 3H), 4.27 (d, J ¼ 5.6 Hz, 2H, -CH2), 3.80 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3), 3.73 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.05, 153.12, 151.89, 147.45, 145.53, 133.57, 130.10, 123.97, 122.97, 120.04, 116.08, 115.25, 112.94, 112.41, 112.03, 56.00, 55.59, 55.41, 42.28. HRMS (ESI) m/z: 344.1493 [MþH]þ, calcd. for C19H21NO5: 344.1492. 4 .1. 2 .14 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z yl ) - 3 - ( 2 , 4 , 5 trimethoxyphenyl)acrylamide (compound 14a). White powder, m.p.: 205.9e206.8
C, yield: 85.38%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.83 (s, 1H, -OH), 8.30 (s, 1H, -NH), 7.64 (d, J ¼ 15.9 Hz, 1H), 7.06 (s, 1H), 6.86 (s, 1H), 6.71 (s, 2H), 6.68 (d, J ¼ 8.0 Hz, 1H), 6.58 (d, J ¼ 15.9 Hz, 1H), 4.26 (d, J ¼ 5.2 Hz, 2H, -CH2), 3.84 (s, 3H, -OCH3), 3.83 (s, 3H, -OCH3), 3.75 (s, 3H, -OCH3), 3.73 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.47, 152.84, 151.21, 147.42, 145.47, 142.83, 133.44, 130.28, 119.97, 119.84, 115.22, 114.58, 111.99, 110.80, 97.95, 56.28, 56.02, 55.77, 55.59, 42.22. HRMS (ESI) m/z: 374.1615 [MþH]þ, calcd. for C20H23NO6: 374.1598. 4 .1. 2 .15 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z yl ) - 3 - ( 3 , 4 , 5 trimethoxyphenyl)acrylamide (compound 15a). White powder, m.p.: 179.3e180.7
C, yield: 81.58%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H, -OH), 8.40 (s, 1H, -NH), 7.41 (d, J ¼ 15.7 Hz, 1H),

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

6.90 (s, 2H), 6.88 (s, 1H), 6.70 (q, J ¼ 8.5 Hz, 2H), 6.64 (q, J ¼ 15.7 Hz, 1H), 4.29 (d, J ¼ 4.5 Hz, 2H, -CH2), 3.82 (s, 6H, 2*-OCH3), 3.76 (s, 3H, -OCH3), 3.69 (s, 3H, -OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 164.80, 153.06, 147.44, 145.51, 138.84, 138.62, 130.57, 130.07, 121.62, 119.98, 115.23, 111.99, 104.91, 60.08, 55.85, 55.59, 42.27. HRMS (ESI) m/z: 374.1591 [MþH]þ, calcd. for C20H23NO6: 374.1598. 4 .1. 2 .16 . ( E ) - N - ( 4 - h y d r o x y - 3 - m e t h o x y b e n z y l ) - 3 - ( 2 , 3 , 4 trimethoxyphenyl)acrylamide (compound 16a). White powder, m.p.: 175.6e176.4
C, yield: 90.17%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.84 (s, 1H, -OH), 8.41 (s, 1H, -NH), 7.53 (t, J ¼ 15.9 Hz, 1H), 7.27 (d, J ¼ 8.6 Hz, 1H), 6.87 (s, 2H), 6.71 (s, 2H), 6.62 (d, J ¼ 15.9 Hz, 1H), 4.27 (d, J ¼ 4.2 Hz, 2H, -CH2), 3.82 (s, 3H, -OCH3), 3.80 (s, 3H, -OCH3), 3.75 (s, 6H, 2*-OCH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.17, 154.50, 152.20, 147.44, 145.51, 141.91, 133.44, 130.16, 122.42, 121.34, 121.14, 120.03, 115.25, 112.01, 108.47, 61.17, 60.42, 55.93, 55.58, 42.24. HRMS (ESI) m/z: 374.1599 [MþH]þ, calcd. for C20H23NO6: 374.1598. 4.1.3. General synthesis of compounds 2be6b The corresponding cinnamic acid (1.0 equiv.) was dissolved in MeOH, then SOCl2 (1.0 equiv.) was added. The mixture was stirred at room temperature for 2 h. Reaction was monitored by TLC. After completion of the reaction, evaporate the solution and purify the crud product by flash chromatography. TMP (1.2 equiv.) were added to the methyl esterfied cinnamic acid dissolved in DMF under catalysis by K2CO3 (2.0 equiv.), the mixture was stirred at 80
C for 4 h. As indicated by TLC, the reagent was extracted with ethyl acetate 3 times after completion of the reaction. And then anhydrous Na2SO4 and saturated NaCl were used to dry the organic layer over. Evaporating the solvent under vacuum. The product we obtained was dissolved by the solvent THF-MeOH-H2O (3:1:1), then NaOH (10%) was added. The mixture was stirred at 60
C for 2 h. The pH of the product was adjusted to 7 with hydrochloric acid, and after dried over anhydrous sodium sulfate, filtered and evaporated, finally the EDCI (0.75 equiv.)/HOBT (0.6 equiv.)/HOBT (0.75 equiv.) dissolved in DMF was added. The mixture was stirred at room temperature for 4 h. The reaction solution was filtered and evaporated with vacuum. The product was lyophilized after separation by flash chromatography. 4.1.3.1. (E)-3-(2-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N(4-hydroxy-3-methoxybenzyl)acrylamide (compound 2b). White powder, m.p.: 179.4e180.3
C, yield: 43.15%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H, -OH), 8.44 (s, 1H, -NH), 7.70 (d, J ¼ 15.9 Hz, 1H), 7.55 (d, J ¼ 7.5 Hz, 1H), 7.37 (t, J ¼ 7.5 Hz, 1H), 7.24 (d, J ¼ 8.2 Hz, 1H), 7.02 (t, J ¼ 7.3 Hz, 1H), 6.85 (s, 1H), 6.68 (dt, J ¼ 23.8, 11.9 Hz, 3H), 5.25 (s, 2H, -CH2), 4.26 (d, J ¼ 4.9 Hz, 2H, -CH2), 3.75 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.47 (s, 6H, 2*-CH3); 13 C NMR (100 MHz, DMSO‑d6) d (ppm): 165.38, 156.82, 151.65, 149.84, 148.85, 147.91, 145.98, 145.65, 133.62, 131.27, 130.53, 127.53, 124.19, 122.86, 121.67, 120.45, 115.71, 113.64, 112.41, 70.32, 56.04, 42.68, 21.75, 21.48, 20.64. HRMS (ESI) m/z: 434.2055 [MþH]þ, calcd. for C25H27N3O4: 434.2074. 4.1.3.2. (E)-3-(3-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N(4-hydroxy-3-methoxybenzyl)acrylamide (compound 3b). White powder, m.p.: 82.7e83.3
C, yield: 48.36%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H, -OH), 8.46 (s, 1H, -NH), 7.43 (d, J ¼ 15.7 Hz, 1H), 7.33 (t, J ¼ 7.7 Hz, 1H), 7.25 (s, 1H), 7.16 (d, J ¼ 7.4 Hz, 1H), 7.05 (d, J ¼ 7.4 Hz, 1H), 6.88 (s, 1H), 6.77e6.64 (m, 3H), 5.19 (s, 2H, -CH2), 4.29 (d, J ¼ 5.0 Hz, 2H, -CH2), 3.75 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2*-CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.15, 159.18, 151.50, 149.83, 148.76, 147.94, 146.02, 145.74, 139.03, 136.92, 130.49, 123.19, 120.72, 120.48, 116.39,

11

115.73, 114.16, 112.47, 69.84, 56.07, 42.74, 21.73, 21.44, 20.64. HRMS (ESI) m/z: 434.2056 [MþH]þ, calcd. for C25H27N3O4: 434.2074. 4.1.3.3. (E)-3-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N(4-hydroxy-3-methoxybenzyl)acrylamide (compound 4b). White powder, m.p.: 92.6e93.7
C, yield: 46.37%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.86 (s, 1H, -OH), 8.40 (s, 1H, -NH), 7.52 (d, J ¼ 7.9 Hz, 2H), 7.43 (d, J ¼ 15.7 Hz, 1H), 7.08 (d, J ¼ 7.9 Hz, 2H), 6.88 (s, 1H), 6.72 (q, J ¼ 7.9 Hz, 2H), 6.56 (d, J ¼ 15.7 Hz, 1H), 5.20 (s, 2H, -CH2), 4.30 (d, J ¼ 4.5 Hz, 2H, -CH2), 3.76 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.46 (s, 6H, 2*-CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.02, 159.37, 151.06, 149.33, 148.32, 147.45, 145.51, 145.17, 138.36, 130.15, 129.06, 127.93, 119.99, 115.25, 115.17, 111.98, 69.39, 55.58, 42.23, 21.26, 20.97, 20.16. HRMS (ESI) m/z: 434.2063 [MþH]þ, calcd. for C25H27N3O4: 434.2074. 4.1.3.4. (E)-3-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxyphenyl)-N-(4-hydroxy-3-methoxybenzyl)acrylamide (compound 5b). White powder, m.p.: 112.0e112.8
C, yield: 48.10%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.89 (s, 1H, -OH), 8.41 (s, 1H, -NH), 7.44 (d, J ¼ 15.8 Hz, 1H), 7.22 (s, 1H), 7.17 (q, J ¼ 8.4 Hz, 2H), 6.92 (s, 1H), 6.75 (q, J ¼ 8.4 Hz, 2H), 6.63 (d, J ¼ 15.8 Hz, 1H), 5.20 (s, 2H, -CH2), 4.32 (d, J ¼ 5.0 Hz, 2H, -CH2), 3.82 (s, 3H, -OCH3), 3.80 (s, 3H, -OCH3),2.54 (s, 3H, -CH3), 2.50 (s, 6H, 2*-CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 164.98, 151.05, 149.53, 149.28, 148.97, 148.25, 147.43, 145.49, 145.24, 138.64, 130.14, 128.42, 121.09, 120.29, 119.96, 115.23, 113.70, 111.97, 110.38, 70.09, 55.58, 55.48, 42.22, 21.24, 20.94, 20.12. HRMS (ESI) m/z: 464.2165 [MþH]þ, calcd. for C26H29N3O5: 464.2180. 4.1.3.5. (E)-3-(3-((3,5,6-trimethylpyrazin-2-yl)methoxy)-4methoxyphenyl)-N-(4-hydroxy-3-methoxybenzyl)acrylamide (compound 6b). White powder, m.p.: 124.5e125.2
C, yield: 48.35%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.85 (s, 1H, -OH), 8.39 (s, 1H, -NH), 7.39 (d, J ¼ 15.7 Hz, 2H), 7.16 (d, J ¼ 8.3 Hz, 1H), 7.01 (t, J ¼ 8.3 Hz, 1H), 6.88 (s, 1H), 6.72 (q, J ¼ 8.3 Hz, 2H), 6.58 (t, J ¼ 15.7 Hz, 1H), 5.17 (s, 2H, -CH2), 4.29 (d, J ¼ 4.9 Hz, 2H, -CH2), 3.78 (s, 3H, -OCH3), 3.76 (s, 3H, -OCH3), 2.51 (s, 3H, -CH3), 2.46 (s, 6H, 2*CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.03, 151.07, 150.50, 149.60, 148.24, 147.79, 147.44, 145.49, 145.29, 138.66, 130.19, 127.70, 121.90, 120.10, 119.94, 115.23, 112.51, 112.15, 111.95, 70.15, 55.63, 55.58, 21.25, 20.93, 20.13. HRMS (ESI) m/z: 464.2188 [MþH]þ, calcd. for C26H29N3O5: 464.2180. 4.1.4. General synthesis of compounds 1c, 7c-16c To a mixture of 1a, 7a-16a (1.0 equiv.) and anhydrous K2CO3 (2.0 equiv.) in anhydrous DMF, the TMP (1.2 equiv.) was added. The mixture was stirred at 80
C for 4 h. As indicated by TLC, the reagent was extracted with ethyl acetate 3 times after completion of the reaction. And then anhydrous Na2SO4 and saturated NaCl were used to dry the organic layer over. Evaporating the solvent under vacuum, purification of the crude products was performed by flash chromatography. 4.1.4.1. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)cinnamamide (compound 1c). White powder, m.p.: 121.6e122.2
C, yield: 65.54%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.54 (s, 1H, -NH), 7.57 (d, J ¼ 6.8 Hz, 2H), 7.48 (d, J ¼ 15.8 Hz, 1H), 7.44e7.33 (m, 3H), 7.06 (t, J ¼ 8.0 Hz, 1H), 6.96 (s, 1H), 6.82 (d, J ¼ 8.0 Hz, 1H), 6.70 (d, J ¼ 15.8 Hz, 1H), 5.10 (s, 2H, -CH2), 4.34 (s, 2H, -CH2), 3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.02, 151.11, 149.76, 149.42, 148.35, 146.94, 145.77, 139.06, 135.11, 132.82, 129.64, 129.13, 127.72, 122.33, 119.75, 114.26, 112.09, 70.59, 55.75, 42.38, 21.44, 21.14, 20.33. HRMS (ESI) m/z: 418.2116 [MþH]þ, calcd.

12

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

for C25H27N3O3: 418.2125. 4.1.4.2. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(2-methoxyphenyl)acrylamide (compound 7c). White powder, m.p.: 148.9e149.8
C, yield: 70.32%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.51 (s, 1H, -NH), 7.70 (d, J ¼ 15.9 Hz, 1H), 7.52 (d, J ¼ 7.5 Hz, 1H), 7.37 (t, J ¼ 7.5 Hz, 1H), 7.06 (t, J ¼ 9.2 Hz, 2H), 6.99 (t, J ¼ 9.2 Hz, 1H), 6.95 (s, 1H), 6.81 (d, J ¼ 8.1 Hz, 1H), 6.71 (d, J ¼ 15.9 Hz, 1H), 5.10 (s, 2H, -CH2), 4.33 (d, J ¼ 5.0 Hz, 2H, -CH2), 3.86 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.18, 157.51, 150.89, 149.54, 149.19, 148.13, 146.69, 145.56, 133.88, 132.71, 130.80, 127.80, 123.27, 122.48, 120.67, 119.53, 114.06, 111.90, 111.67, 70.37, 55.53, 42.14, 21.22, 20.93, 20.11. HRMS (ESI) m/z: 448.2225 [MþH]þ, calcd. for C26H29N3O4: 448.2231. 4.1.4.3. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(3-methoxyphenyl)acrylamide (compound 8c). White powder, m.p.: 161.3e162.4
C, yield: 69.94%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.52 (s, 1H, -NH), 7.44 (d, J ¼ 15.8 Hz, 1H), 7.33 (d, J ¼ 7.8 Hz, 1H), 7.15 (d, J ¼ 7.8 Hz, 1H), 7.13 (s, 1H), 7.05 (d, J ¼ 8.1 Hz, 1H), 6.95 (s, 2H), 6.82 (d, J ¼ 8.1, 1H), 6.70 (d, J ¼ 15.8 Hz, 1H), 5.10 (s, 2H, -CH2), 4.34 (d, J ¼ 5.2 Hz, 2H, -CH2), 3.79 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.25, 160.06, 151.38, 150.03, 149.69, 148.62, 147.21, 146.04, 139.23, 136.83, 133.08, 130.44, 122.96, 120.34, 120.02, 115.72, 114.55, 113.10, 112.38, 70.86, 56.04, 55.58, 42.65, 21.71, 21.42, 20.60. HRMS (ESI) m/z: 448.2233 [MþH]þ, calcd. for C26H29N3O5: 448.2231. 4.1.4.4. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(4-methoxyphenyl)acrylamide (compound 9c). White powder, m.p.: 136.4e137.2
C, yield: 73.13%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.44 (s, 1H, -NH), 7.52 (d, J ¼ 8.2 Hz, 2H), 7.42 (d, J ¼ 15.8 Hz, 1H), 7.05 (d, J ¼ 8.2 Hz, 1H), 6.98 (d, J ¼ 8.2 Hz, 2H), 6.95 (s, 1H), 6.91 (d, J ¼ 7.7, 1H), 6.55 (d, J ¼ 15.8 Hz, 1H), 5.10 (s, 2H, -CH2), 4.33 (d, J ¼ 4.6 Hz, 2H, -CH2), 3.79 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3); 13 C NMR (100 MHz, DMSO‑d6) d (ppm): 165.11, 160.29, 150.88, 149.54, 149.20, 148.13, 146.69, 145.55, 138.53, 132.76, 129.06, 127.45, 119.62, 119.49, 114.36, 114.06, 111.86, 70.38, 55.54, 55.23, 42.11, 21.22, 20.92, 20.10. HRMS (ESI) m/z: 448.2225 [MþH]þ, calcd. for C26H29N3O5: 448.2231. 4.1.4.5. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(2,3-dimethoxyphenyl)acrylamide (compound 10c). White powder, m.p.: 146.7e147.6
C, yield: 68.49%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.56 (s, 1H, -NH), 7.67 (d, J ¼ 15.9 Hz, 1H), 7.13 (t, J ¼ 9.4 Hz, 2H), 7.08 (d, J ¼ 8.5 Hz, 2H), 6.96 (s, 1H), 6.82 (d, J ¼ 8.5 Hz, 1H), 6.71 (d, J ¼ 15.9 Hz, 1H), 5.10 (s, 2H, -CH2), 4.34 (d, J ¼ 4.4 Hz, 2H, -CH2), 3.83 (s, 3H, -OCH3), 3.75 (s, 6H, 2* -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 164.94, 152.85, 150.91, 149.56, 149.20, 148.15, 147.38, 146.73, 145.56, 133.28, 132.62, 128.49, 124.36, 123.32, 119.58, 118.51, 114.06, 113.78, 111.92, 70.37, 60.63, 55.76, 55.55, 42.19, 21.24, 20.94, 20.12. HRMS (ESI) m/z: 478.2325 [MþH]þ, calcd. for C27H31N3O5: 478.2336. 4.1.4.6. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(3,4-dimethoxyphenyl)acrylamide (compound 11c). White powder, m.p.: 136.6e137.9
C, yield: 65.36%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.46 (s, 1H, -NH), 7.45 (d, J ¼ 15.8 Hz, 1H), 7.42 (d, J ¼ 15.8 Hz, 1H), 7.21 (s, 1H), 7.16 (d, J ¼ 8.2 Hz, 1H), 7.09 (d, J ¼ 8.2 Hz, 1H), 7.03 (d, J ¼ 8.2 Hz, 1H), 6.99 (s, 1H), 6.85 (d, J ¼ 8.0 Hz, 1H), 5.14 (s, 2H, -CH2), 4.37 (d, J ¼ 4.8 Hz, 2H, -CH2), 3.83

(s, 6H, 2* -OCH3), 3.78 (s, 3H, -OCH3), 2.54 (s, 3H, -CH3), 2.49 (s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 171.55, 165.13, 150.91, 150.09, 149.55, 149.20, 148.88, 148.15, 146.69, 145.57, 138.89, 132.77, 127.69, 121.33, 119.85, 119.48, 114.04, 111.85, 111.73, 110.01, 70.38, 55.55, 55.39, 42.14, 21.23, 20.94, 20.12. HRMS (ESI) m/z: 478.2332 [MþH]þ, calcd. for C27H31N3O5: 478.2336. 4.1.4.7. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(3,5-dimethoxyphenyl)acrylamide (compound 12c). White powder, m.p.: 135.8e136.9
C, yield: 61.47%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.53 (s, 1H, -NH), 7.71 (d, J ¼ 15.9 Hz, 1H), 7.14e7.08 (m, 2H), 7.05 (d, J ¼ 8.1 Hz, 1H), 6.99 (s, 2H), 6.86 (d, J ¼ 8.1 Hz, 1H), 6.77 (d, J ¼ 15.9 Hz, 1H), 5.14 (s, 2H, -CH2), 4.37 (d, J ¼ 4.9 Hz, 2H, -CH2), 3.85 (s, 3H, -OCH3), 3.78 (s, 6H, 2* -OCH3), 2.54 (s, 3H, -CH3), 2.49 (s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.12, 153.11, 151.89, 150.91, 149.55, 149.19, 148.15, 146.71, 145.56, 133.67, 132.68, 123.92, 122.86, 119.55, 116.11, 114.05, 112.94, 112.42, 111.91, 70.37, 56.01, 55.55, 55.41, 42.18, 21.23, 20.94, 20.12. HRMS (ESI) m/z: 478.2333 [MþH]þ, calcd. for C27H31N3O5: 478.2336. 4.1.4.8. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(2,5-dimethoxyphenyl)acrylamide (compound 13c). White powder, m.p.: 151.5e152.7
C, yield: 66.82%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.53 (t, J ¼ 5.3 Hz, 1H, -NH), 7.71 (d, J ¼ 15.9 Hz, 1H), 7.10 (dd, J ¼ 9.0, 8.1 Hz, 2H), 7.05 (d, J ¼ 9.0 Hz, 1H), 6.99 (s, 2H), 6.85 (d, J ¼ 8.1 Hz, 1H), 6.76 (d, J ¼ 15.9Hz, 1H), 5.14 (s, 2H, -CH2), 4.37 (d, J ¼ 5.5 Hz, 2H, -CH2), 3.85 (s, 3H, -OCH3), 3.78 (s, 6H, 2* -OCH3), 2.54 (s, 3H, -CH3), 2.49 (s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.12, 153.11, 151.89, 150.90, 149.55, 149.19, 148.14, 146.71, 145.56, 133.66, 132.68, 123.92, 122.86, 119.55, 116.10, 114.04, 112.93, 112.41, 111.91, 70.37, 56.00, 55.55, 55.41, 42.18, 21.23, 20.93, 20.12. HRMS (ESI) m/z: 478.2331 [MþH]þ, calcd. for C27H31N3O5: 478.2336. 4.1.4.9. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(2,4,5-trimethoxyphenyl)acrylamide (compound 14c). White powder, m.p.: 156.3e157.3
C, yield: 70.01%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.37 (d, J ¼ 5.4 Hz, 1H, -NH), 7.65 (d, J ¼ 15.9 Hz, 1H), 7.08 (s, 1H), 7.04 (d, J ¼ 8.2 Hz, 1H), 6.94 (s, 1H), 6.80 (d, J ¼ 8.2 Hz, 1H), 6.72 (s, 1H), 6.59 (d, J ¼ 15.9 Hz, 1H), 5.10 (s, 2H, -CH2), 4.32 (d, J ¼ 5.4 Hz, 2H, -CH2), 3.86 (s, 3H, -OCH3), 3.84 (s, 3H, -OCH3), 3.74 (s, 6H, 2* -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.56, 152.87, 151.24, 150.91, 149.55, 149.19, 148.15, 146.66, 145.57, 142.83, 133.56, 132.88, 119.71, 119.49, 114.53, 114.04, 111.87, 110.80, 97.93, 70.38, 56.29, 56.02, 55.77, 55.55, 42.13, 21.23, 20.94, 20.12. HRMS (ESI) m/ z: 508.2429 [MþH]þ, calcd. for C28H33N3O6: 508.2442. 4.1.4.10. (E)-N-(4-((3,4,5-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(2,4,5-trimethoxyphenyl)acrylamide (compound 15c). White powder, m.p.: 180.6e181.9
C, yield: 72.84%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.45 (s, 1H, -NH), 7.41 (d, J ¼ 15.9 Hz, 1H), 7.03 (d, J ¼ 8.1 Hz, 1H), 6.95 (s, 1H), 6.91 (s, 2H), 6.81 (d, J ¼ 8.1 Hz, 1H), 6.65 (d, J ¼ 15.9 Hz, 1H), 5.10 (s, 2H, -CH2), 4.33 (d, J ¼ 5.4 Hz, 2H, -CH2), 3.82 (s, 6H, 2* -OCH3), 3.74 (s, 3H, -OCH3), 3.69 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 164.68, 152.86, 150.71, 149.35, 148.99, 147.95, 146.49, 145.36, 138.75, 138.43, 132.46, 130.33, 121.30, 119.29, 113.83, 111.66, 104.72, 70.16, 59.88, 55.65, 55.35, 41.96, 21.03, 20.73, 19.91. HRMS (ESI) m/z: 508.2434 [MþH]þ, calcd. for C28H33N3O6: 508.2442. 4.1.4.11. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(2,3,4-trimethoxyphenyl)acrylamide (compound

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

16c). White powder, m.p.: 174.6e175.3
C, yield: 71.24%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.48 (t, J ¼ 5.7 Hz, 1H, -NH), 7.57 (d, J ¼ 15.9 Hz, 1H), 7.29 (d, J ¼ 8.9 Hz, 1H), 7.05 (d, J ¼ 8.2 Hz, 1H), 6.95 (d, J ¼ 1.8 Hz, 1H), 6.88 (d, J ¼ 8.9 Hz, 1H), 6.81(dd, J ¼ 8.2, 1.8 Hz, 1H), 6.67e6.60 (m, 1H), 5.10 (s, 2H, -CH2), 4.33 (d, J ¼ 5.8 Hz, 2H, -CH2), 3.83 (s, 3H, -OCH3), 3.81 (s, 3H, -OCH3), 3.77 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (d, J ¼ 3.3 Hz, 6H, 2* -CH3); 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.26, 154.52, 152.21, 150.91, 149.55, 149.19, 148.15, 146.70, 145.56, 141.91, 133.55, 132.75, 122.45, 121.31, 121.02, 119.55, 114.05, 111.89, 108.45, 70.38, 61.16, 60.42, 55.93, 55.54, 42.15, 21.23, 20.94, 20.12. HRMS (ESI) m/z: 508.2449 [MþH]þ, calcd. for C28H33N3O6: 508.2442. 4.1.5. General synthesis of compounds 2c-6c To a solution of 4-Hydroxy-3-methoxybenzylamine hydrochloride (1.0 equiv.) and MeOH, Et3N (1.0 equiv.) and Boc2O (1.2 equiv.) were added. Dissolve the protected capsaicin with Boc group (1.0 equiv.) into DMF, then K2CO3 (2.0 equiv.) were added and the mixture were stirred at 80
C for 4 h. As the reaction indicated by TLC finished, the bocprotected compound was extracted with ethyl acetate 3 times and the organic layer was dried over with anhydrous Na2SO4 and saturated NaCl. After evaporating the solvent under vacuum, purification of the crude products was performed by flash chromatography. Then TFA (1.5 mL) was added slowly to the bocprotected compound in CH2Cl2 (10 mL) and the mixture was stirred in an ice bath for 2 h. The corresponding cinnamic acid (1.0 equiv.) were then added to the TMP-Capsaicin dissolved in anhydrous DMF. Under catalysis by EDCI (0.75 equiv.)/HOBT (0.6 equiv.)/ DIEPA (0.75 equiv.), the mixture was stirred at room temperature for 4 h. The reaction solution was filtered and evaporated with vacuum. The product was lyophilized after separated by flash chromatography. 4.1.5.1. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(2-hydroxyphenyl)acrylamide (compound 2c). Yellow powder, m.p.: 167.3e168.1
C, yield: 60.39%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 10.07 (s, 1H, -OH), 8.53 (s, 1H), 7.74 (d, J ¼ 16.0 Hz, 1H), 7.48 (d, J ¼ 7.5 Hz, 1H), 7.23 (t, J ¼ 7.5 Hz, 1H), 7.10 (d, J ¼ 8.0 Hz, 1H), 7.00 (s, 1H), 6.95 (d, J ¼ 8.0 Hz, 1H), 6.88 (t, J ¼ 8.1 Hz, 2H), 6.77 (d, J ¼ 16.0 Hz, 1H), 5.15 (s, 2H, -CH2), 4.38 (d, J ¼ 4.8 Hz, 2H, -CH2), 3.74 (s, 3H, -OCH3), 2.55 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.47, 156.23, 150.85, 149.52, 149.21, 148.11, 146.68, 145.56, 134.74, 132.86, 130.39, 128.13, 121.67, 121.53, 119.49, 119.30, 116.06, 114.12, 111.89, 70.40, 55.58, 42.10, 21.22, 20.92, 20.07. HRMS (ESI) m/z: 434.2074 [MþH]þ, calcd for C25H27N3O4: 434.2074. 4.1.5.2. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(3-hydroxyphenyl)acrylamide (compound 3c). Yellow powder, m.p.: 190.6e191.2
C, yield: 67.24%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 9.63 (s, 1H, -OH), 8.57 (s, 1H, -NH), 7.42 (d, J ¼ 15.7 Hz, 1H), 7.26 (t, J ¼ 7.6 Hz, 1H), 7.10 (d, J ¼ 8.1 Hz, 1H), 7.03 (d, J ¼ 7.6 Hz, 1H), 6.89e6.81 (m, 2H), 6.65 (d, J ¼ 15.7 Hz, 1H), 5.15 (s, 2H, -CH2), 4.38 (d, J ¼ 5.0 Hz, 2H, -CH2), 3.79 (s, 3H, -OCH3), 2.55 (s, 3H, -CH3), 2.50 (s, 6H, 2* -CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 164.84, 157.69, 150.92, 149.56, 149.21, 148.16, 146.73, 145.57, 139.06, 136.16, 132.62, 129.93, 121.86, 119.55, 118.73, 116.68, 114.07, 113.68, 111.89, 70.38, 55.56, 42.16, 21.24, 20.95, 20.12. HRMS (ESI) m/z: 434.2066 [MþH]þ, calcd for C25H27N3O4: 434.2074. 4.1.5.3. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(4-hydroxyphenyl)acrylamide (compound 4c). White powder, m.p.: 138.6e139.6
C, yield: 59.62%. 1H NMR (400 MHz, DMSO‑d6) d (ppm): 9.88 (s, 1H, -OH), 8.45 (s, 1H, -NH),

13

7.43 (t, J ¼ 10.9 Hz, 3H), 7.09 (d, J ¼ 8.1 Hz, 1H), 6.99 (s, 1H), 6.85 (d, J ¼ 8.1 Hz, 3H), 6.52 (d, J ¼ 15.7 Hz, 1H), 5.14 (s, 2H, -CH2), 4.37 (d, J ¼ 5.0 Hz, 2H, -CH2), 3.78 (s, 3H, -OCH3), 2.54 (s, 3H, -CH3), 2.50 (s, 6H, 2* -CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.27, 158.83, 150.89, 149.54, 149.19, 148.13, 146.67, 145.56, 138.94, 132.83, 129.20, 125.88, 119.47, 118.53, 115.72, 114.06, 111.84, 70.38, 55.54, 42.08, 21.22, 20.93, 20.11. HRMS (ESI) m/z: 434.2060 [MþH]þ, calcd for C25H27N3O4: 434.2074. 4.1.5.4. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(4-hydroxy-3-methoxyphenyl)acrylamide (compound 5c). Yellow powder, m.p.: 96.5e97.6
C, yield: 71.66%.1H NMR (400 MHz, DMSO‑d6) d (ppm): 9.43 (s, 1H, -OH), 8.38 (s, 1H, -NH), 7.38 (d, J ¼ 15.7 Hz, 1H), 7.13 (s, 1H), 7.03 (dd, J ¼ 16.7, 8.0 Hz, 2H), 6.94 (s, 1H), 6.81 (d, J ¼ 8.0 Hz, 2H), 6.52 (d, J ¼ 15.7 Hz, 1H), 5.10 (s, 2H, -CH2), 4.33 (d, J ¼ 4.3 Hz, 2H,-CH2), 3.81 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.28, 150.89, 149.54, 149.21, 148.28, 148.13, 147.80, 146.68, 145.56, 139.23, 132.84, 126.39, 121.50, 119.47, 118.85, 115.65, 114.07, 111.86, 110.82, 70.39, 55.57, 55.53, 42.11, 21.24, 20.94, 20.12. HRMS (ESI) m/z: 464.2190 [MþH]þ, calcd for C26H29N3O5: 464.2180. 4.1.5.5. (E)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)-3-(3-hydroxy-4-methoxyphenyl)acrylamide (compound 6c). White powder, m.p.: 158.3e159.1
C, yield: 68.43%.1H NMR (400 MHz, DMSO‑d6) d (ppm): 9.19 (s, 1H, -OH), 8.44 (s, 1H, -NH), 7.33 (d, J ¼ 15.7 Hz, 1H), 7.05 (d, J ¼ 8.0 Hz, 1H), 7.02e6.89 (m, 4H), 6.81 (d, J ¼ 8.0 Hz, 1H), 6.46 (d, J ¼ 15.7 Hz, 1H), 5.10 (s, 2H, -CH2), 4.33 (d, J ¼ 4.8 Hz, 2H, -CH2), 3.80 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3), 2.50 (s, 3H, -CH3), 2.45 (s, 6H, 2* -CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.13, 150.89, 149.54, 149.20, 149.18, 148.14, 146.68, 145.56, 139.00, 132.77, 127.76, 120.27, 119.50, 119.39, 114.07, 113.31, 112.07, 111.86, 70.38, 55.58, 55.55, 42.10, 21.23, 20.93, 20.11. HRMS (ESI) m/z: 464.2187 [MþH]þ, calcd for C26H29N3O5: 464.2180. 4.1.6. General synthesis of compounds 2d-6d The synthesis of compounds 2d-6d was similar to that of 1c, 7c16c. To a mixture of 2a-6a (1.0 equiv.) and anhydrous K2CO3 (2.0 equiv.) in anhydrous DMF, the TMP (2.5 equiv.) was added. The mixture was stirred at 85
C for 6 h. As indicated by TLC, the reagent was extracted with ethyl acetate 3 times after completion of the reaction. And then anhydrous Na2SO4 and saturated NaCl were used to dry the organic layer over. After evaporating the solvent under vacuum, purification of the crude products was performed by flash chromatography. 4.1.6.1. (E)-3-(2-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-methoxybenzyl)acrylamide (compound 2d). White powder, m.p.: 163.8e164.4
C, yield: 50.19%. 1H NMR (400 MHz,DMSO‑d6) d (ppm): 8.51 (s, 1H, -NH), 7.80e7.65 (m, 1H), 7.55 (d, J ¼ 6.3 Hz, 1H), 7.44e7.29 (m, 1H), 7.24 (d, J ¼ 8.4 Hz, 1H), 7.03 (t, J ¼ 7.1 Hz, 2H), 6.93 (s, 1H), 6.80 (d, J ¼ 8.4 Hz, 1H), 6.73e6.62 (m, 1H), 5.43e5.23 (m, 2H, -CH2), 5.22e5.06 (m, 2H, -CH2), 4.31 (s, 2H, -CH2), 3.73 (s, 3H, -OCH3), 2.76e2.26 (m, 18H, 6* -CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.02, 156.35, 151.13, 150.86, 149.52, 149.33, 149.19, 148.34, 148.12, 146.68, 145.55, 145.15, 133.25, 132.66, 130.78, 127.07, 123.69, 122.29, 121.17, 119.49, 114.06, 113.15, 111.84, 70.37, 69.83, 55.53, 42.11, 20.93, 20.49, 20.11. HRMS (ESI) m/z: 568.2912 [MþH]þ, calcd for C33H37N5O4: 568.2918. 4.1.6.2. (E)-3-(3-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-methoxybenzyl)

14

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

acrylamide (compound 3d). White powder, m.p.: 163.3e164.4
C, yield: 51.22%.1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.53 (s, 1H, -NH), 7.44 (d, J ¼ 15.7 Hz, 1H), 7.34 (t, J ¼ 7.6 Hz, 1H), 7.26 (s, 1H), 7.17 (d, J ¼ 7.3 Hz, 1H), 7.05 (d, J ¼ 8.0 Hz, 2H), 6.95 (s, 1H), 6.82 (d, J ¼ 8.0 Hz, 1H), 6.70 (d, J ¼ 15.7 Hz, 1H), 5.19 (s, 2H, -CH2), 5.10 (s, 2H, -CH2), 4.34 (d, J ¼ 3.8 Hz, 2H, -CH2), 3.74 (s, 3H, -OCH3), 2.50 (s, 6H, 2* -CH3), 2.46 (s, 12H, 4* -CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.24, 159.17, 151.51, 151.39, 150.03, 149.83, 149.68, 148.76, 148.62, 147.20, 146.04, 145.74, 139.14, 136.89, 133.08, 130.50, 123.07, 120.74, 119.99, 116.42, 114.53, 114.16, 112.35, 70.85, 69.83, 56.03, 42.65, 21.73, 21.44, 21.42, 20.65, 20.60. HRMS (ESI) m/z: 568.2925 [MþH]þ, calcd for C33H37N5O4: 568.2918. 4.1.6.3. (E)-3-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)phenyl)-N(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3-methoxybenzyl)acrylamide (compound 4d). Yellow powder, m.p.: 156.4e157.3
C, yield: 50.43%.1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.46 (s, 1H, -NH), 7.52 (d, J ¼ 8.0 Hz, 2H), 7.43 (d, J ¼ 15.7 Hz, 1H), 7.19e7.01 (m, 3H), 6.95 (s, 1H), 6.82 (d, J ¼ 8.0 Hz, 1H), 6.56 (d, J ¼ 15.7 Hz, 1H), 5.20 (s, 2H, -CH2), 5.10 (s, 2H, -CH2), 4.34 (d, J ¼ 4.5 Hz, 2H, -CH2), 3.74 (s, 3H, -OCH3), 2.50 (s, 6H, 2* -CH3), 2.46 (s, 12H, 4* -CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.10, 159.39, 151.06, 150.90, 149.55, 149.32, 149.21, 148.31, 148.15, 146.70, 145.57, 145.16, 138.46, 132.75, 129.08, 127.90, 119.87, 119.51, 115.17, 114.07, 111.87, 70.38, 69.39, 55.55, 42.13, 21.25, 20.96, 20.93, 20.15, 20.12. HRMS (ESI) m/z: 568.2907 [MþH]þ, calcd for C33H37N5O4: 568.2918. 4.1.6.4. (E)-3-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxyphenyl)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)acrylamide (compound 5d). Yellow powder, m.p.: 150.5e151.6
C, yield: 53.71%.1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.41 (s, 1H, -NH), 7.40 (d, J ¼ 15.7 Hz, 1H), 7.18 (s, 1H), 7.16e7.09 (m, 2H), 7.05 (d, J ¼ 7.6 Hz, 1H), 6.94 (s, 1H), 6.81 (d, J ¼ 8.1 Hz, 1H), 6.58 (d, J ¼ 15.7 Hz, 1H), 5.16 (s, 2H, -CH2), 5.10 (s, 2H, -CH2), 4.33 (d, J ¼ 4.5 Hz, 2H, -CH2), 3.78 (s, 3H, -OCH3), 3.74 (s, 3H, -OCH3), 2.50 (s, 6H, 2* -CH3), 2.45 (s, 12H, 4* -CH3).13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.05, 151.00, 150.84, 149.48, 149.29, 149.21, 148.98, 148.22, 148.11, 146.68, 145.56, 145.24, 138.72, 132.75, 128.40, 121.10, 120.20, 119.48, 114.11, 113.74, 111.89, 110.43, 70.39, 70.09, 55.58, 55.52, 55.46, 42.11, 21.17, 20.87, 20.10. HRMS (ESI) m/z: 598.3033 [MþH]þ, calcd for C34H39N5O5: 598.3024. 4.1.6.5. (E)-3-(3-((3,5,6-trimethylpyrazin-2-yl)methoxy)-4methoxyphenyl)-N-(4-((3,5,6-trimethylpyrazin-2-yl)methoxy)-3methoxybenzyl)acrylamide (compound 6d). White powder, m.p.: 162.7e163.1
C, yield: 54.22%.1H NMR (400 MHz, DMSO‑d6) d (ppm): 8.43 (s, 1H, -NH), 7.38 (d, J ¼ 16.9 Hz, 1H), 7.14 (d, J ¼ 8.2 Hz, 1H), 7.02 (dd, J ¼ 15.5, 8.2 Hz, 1H), 6.94 (s, 1H), 6.80 (d, J ¼ 7.8 Hz, 1H), 6.57 (d, J ¼ 15.5 Hz, 1H), 5.16 (s, 2H, -CH2), 5.09 (s, 2H, -CH2), 4.32 (s, 2H, -CH2), 3.76 (s, 3H, -OCH3), 3.73 (s, 3H, -OCH3), 2.50 (s, 6H, 2* -CH3), 2.44 (s, 12H, 4* -CH3). 13C NMR (100 MHz, DMSO‑d6) d (ppm): 165.61, 151.54, 151.37, 151.02, 150.09, 150.03, 149.70, 148.71, 148.62, 148.29, 147.18, 146.05, 145.78, 139.25, 133.29, 128.17, 122.43, 120.49, 119.96, 114.57, 113.02, 112.64, 112.36, 70.89, 70.65, 56.15, 56.07, 42.62, 21.74, 21.43, 21.39, 20.62. HRMS (ESI) m/z: 598.3031 [MþH]þ, calcd for C34H39N5O5: 598.3024. 4.2. Bio-evaluation methods 4.2.1. Cell culture SH-SY5Y (Human neuroblastoma cells), HBMEC-2 (Human brain microvascular endothelial cells) were obtained from the Chinese Academy of Medical Sciences & Peking Union Medical College. Cultures were maintained in DMEM/ECM supplemented with 1% (v/v) penicillin/streptomycin and 10% (v/v) fetal bovine serum (FBS;

Thermo Technologies, New York, NY, USA) under a humidified atmosphere containing 5% CO2 at 37
C. 4.2.2. The establishment of H2O2-induced injury model of HBMEC2/SH-SY5Y cells The cells were plated onto 96-well plates 100 mL per well at a density of 3.5*104 cells/mL, which were incubated at 37
C, 5% CO2. After 24 h, 100 mL cell culture medium was added to each well. Then 40 mL H2O2 dissolved in DMEM medium were added at various concentrations (1.8 mM, 3.6 mM, 5.4 mM, 7.2 m M, 9.0 mM) to injury group at a final concentration of 0.3 mM, 0.6 mM, 0.9 mM, 1.2 mM, 1.5 mM. At the mean time 40 mL cell culture medium was added to the control group. After 4 h of incubation, removing the liquid and washing with PBS twice. 200 mL phosphate buffered saline (PBS) and 20 mL MTT (5 mg/mL) were then added per well. After 4 h of incubation, MTT solution was discard and 150 mL DMSO was added to dissolve the MTT formazan. The optical density (OD) was measured at a wavelength of 550 nm. The cell viability (%) at different concentrations were calculated in the following Equation (1). %Survival rate¼(Injury group OD/Control group OD)*100%

(1)

4.2.3. Neuroprotection assay against H2O2-induced cell death in HBMEC-2/SH-SY5Y cells The cells were seeded in 96-well plates 100 mL/well at a density of 3.5*104 cells/mL, which were incubated at 37
C, 5%CO2 for 24 h. Then the tested drugs at various concentrations (0.78 mM, 1.56 mM, 3.13 mM, 6.25 mM, 12.5 mM) were added. Each plate contained blank group, control group, model group and drug group. After 24 h, 40 mL H2O2 solution (4.8 mM) were added to the model group and drug group. MTT assay were then performed as described in 4.2.2. The cell proliferation rate (%) at different concentrations were calculated in the following Equation (2). The EC50 values were defined as the concentration of compounds that produced a 50% proliferation of surviving cells and calculated using the following equation (3). % Proliferation rate¼(Drug group OD - Injury group OD)/(Control group - Injury group OD)*100% (2) P -pEC50 ¼ log Cmax - log 2  ( P - 0.75 þ 0.25Pmax þ 0.25Pmin), P Where Cmax ¼ maximum concentration, P ¼ sum of proliferation rates, Pmax ¼ maximum value of proliferation rate and Pmin ¼ minimum value of proliferation rate (3)

4.2.4. Morphological analysis using DAPI staining and Gimesa staining The SH-SY5Y and HBMEC-2 cells were plated onto 24-well plates 100 mL per well at a density of 3.5*104 cells/mL, which were incubated at 37
C, 5%CO2. Then the compound 14a at various concentrations (1.56 mM, 3.13 mM, 6.25 mM) were added and incubated for further 24 h.40 mL H2O2 solution (4.8 mM) were then added to the model group and drug group. After 4 h, the cell culture medium was discarded and the cells were washed with PBS twice. Fixing with 4% paraformaldehyde/70% cold ethanol for 10 min respectively, Gimesa (6%)/DAPI (1 mg/mL) staining was then performed for 5 min away from light. The excess dye was washed away with PBS, and the cell morphological changes were observed under fluorescence microscope (200  ) and was randomly selected and photographed.

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

4.2.5. Inhibition of apoptosis analysis using annexin V-FITC/PI staining The SH-SY5Y and HBMEC-2 cells were plated onto 6-well plates 100 mL per well at a density of 3.5*104 cells/mL, which were incubated at 37
C, 5%CO2. Then the compound 14a at various concentrations (1.56 mM, 3.13 mM, 6.25 mM) were added and incubated for further 24 h. 40 mL H2O2 solution (4.8 mM) were then added to the model group and drug group. After 4 h, the cells were collected respectively, washed with cold PBS, resuspended in 200 ml annexinbinding buffer and stained with 5 ml annexin V-FITC for 10 min and then 5 ml PI for 5 min per sample in dark. After that, the samples were analyzed by flow cytometry. 4.2.6. Measurement of mitochondrial membrane potential (MMP) The cells were seeded in 96-well plates 100 mL/well at a density of 3.5*104 cells/mL, which were incubated at 37
C, 5%CO2 for 24 h. Then the compound 14a at various concentrations (1.56 mM, 3.13 mM, 6.25 mM) were added and incubated. After 24 h, 40 mL H2O2 solution (4.8 mM) were added to the model group and drug group for further 4 h. The cell culture medium was then discarded, and Rh123 at a final concentration of 10 mg/mL was added for 30 min at 37
C. After washed twice with cold PBS, cells were immediately observed by inverted light microscope. 4.2.7. CAM assay in vivo The eggs were placed in the incubator for 7 days with the temperature of 37
C and the humidity of 60%. Then the compound 14a at various concentrations (0.5 mg/mL, 1 mg/mL, 2 mg/mL) was prepared. A small hole was opened at one end of the chamber, then a drop of sterile saline was added to the membrane, so that the distribution of blood vessels on the allantoic membrane was clearly seen. Then the drug solution was applied onto the small window of allantoic membrane. PBS was applied in control group. After 48 h of incubation, the membrane was separated from the eggshell, then was observed and photographed with a dissecting microscope. 4.2.8. Effects of 14a on the expression of VEGF mRNA Total RNA of chick embryo (1 mg/mL administration group) was extracted using Trizol Max Kit, the M-MLV kit was used for reverse transcription, and then 20 mL loading system was configured for Real-Time PCR detection, which containing 5 mL cDNA, 7 mL dd H2O, 10 mL SYBRmix, 0.5 mL upstream primer, 0.5 mL downstream. The primers were synthesized by Shanghai Sangon Biotech. The sequence was as follows. VEGFR2: 134 bp Forward primer 50 - AGCATAGACAGCCCTTTGGT -30 Reverse primer 50 - CACAATCTCTGCTGGTGCAA -30 Actin: 123 bp Forward primer 50 - CTGGCACCTAGCACAATGAA -30 Reverse primer 50 - CTGCTTGCTGATCCACATCT -30 The PCR program was set as follows: 94
C 2 min; (94
C 15 s, 60
C 35 s)  40; 72
C 10 min. The results were analyzed by a relative quantitative 2DDCT method, and then the expression of mRNA in each group was calculated and compared. Author contributions Ideas and experiment design: Wen-Xi Zhang, Peng-Long Wang and Hai-Min Lei; Chemistry and Biology: Wen-Xi Zhang, Hui Wang, He-Rong Cui, Fei Zhou, De-Sheng Cai; Analysis and interpretation of data: Wen-Bo Guo, Xiao-Hui Jia, Xue-Mei Huang, Yu-Qin Yang, Hong-Shan Chen, Jin-Chai Qi, Bing-Xu; Writing and review of the manuscript: All the authors; Study supervision: Hai-Min Lei, Peng-

15

Long Wang. Conflicts of interest The authors declare no conflict of interest. Acknowledgments This study was funded by the National Natural Science Foundation of China (No.81603256), project of China Association of Chinese Medicine (CACM-2018-QNRC2-B08), the Fundamental Research Funds for the Central Universities (BUCM-2019-JCRC002, 2019-JYB-TD005, and BUCM-2018-2020), Beijing “high-grade, precision and advanced” project, Beijing Key Laboratory for Basic and Development Research on Chinese Medicine (Beijing, 100102). References [1] C.J. Sommer, Ischemic stroke: experimental models and reality, Acta Neuropathol. 133 (2017) 245e261. [2] V.L. Feigin, C.M.M. Lawes, D.A. Bennett, C.S. Anderson, Stroke epidemiology: a review of population-based studies of incidence, prevalence, and case-fatality in the late 20th century, Lancet Neurol. 2 (2003) 43e53. [3] S.E. Khoshnam, W. Winlow, M. Farzaneh, Y. Farbood, H.F. Moghaddam1, Pathogenic mechanisms following ischemic stroke, Neurol. Sci. 38 (2017) 1167e1186. ndez-Gajardo, R. Gutie rrez, J.M. Matamala, R. Carrasco, [4] R. Rodrigo, R. Ferna A. Miranda-Merchak, W. Feuerhake, Oxidative stress and pathophysiology of ischemic stroke: novel therapeutic opportunities, CNS Neurol. Disord. - Drug Targets 12 (2013) 698e714. [5] J. Pei, Inflammation in the pathogenesis of ischemic stroke, Front. Biosci. 20 (2015) 772e783. [6] Y. Sun, H. Gui, Q. Li, Z.M. Luo, M.J. Zheng, J.L. Duan, X. Liu, MicroRNA-124 protects neurons against apoptosis in cerebral ischemic stroke, CNS Neurosci. Ther. 19 (2013) 813e819. [7] X. Geng, P. Sweena, X.M. Li, C.Y. Peng, X.M. Ji, T. Chakraborty, A.L. William, H. Du, X. Tan, F. Ling, G. Murali, A.R. Jose, Y. Ding, Reduced apoptosis by combining normobaric oxygenation with ethanol in transient ischemic stroke, Brain Res. 1531 (2013) 17e24. [8] E.T. Chouchani, V.R. Pell, E. Gaude, D. Aksentijevi, S.Y. Sundier, E.L. Robb, A. Logan, S.M. Nadtochiy, E.N.J. Ord, A.C. Smith, F. Eyassu, R. Shirley, C.H. Hu, A.J. Dare, A.M. James, S. Rogatti, R.C. Hartley, S. Eaton, A.S.H. Costa, P.S. Brookes, S.M. Davidson, M.R. Duchen, K. Saeb-Parsy, M.J. Shattock, A.J. Robinson, L.M. Work, C. Frezza, T. Krieg, M.P. Murphy, Ischaemic accumulation of succinate controls reperfusion injury through mitochondrial ROS, Nature 515 (2014) 431. [9] Y. Sun, R. Zhu, H. Ye, K. Tang, J. Zhao, Y. Chen, Q. Liu, Z. Cao, Towards a bioinformatics analysis of anti-Alzheimer's herbal medicines from a target network perspective, Briefings Bioinf. 14 (2013) 327e343. [10] Y. Fan, G.Y. Yang, Therapeutic angiogenesis for brain ischemia: a brief review, J. Neuroimmune Pharmacol. 2 (2007) 284e289, https://doi.org/10.1007/ s11481-007-9073-3. [11] C.F. Xia, H. Yin, Y.Y. Yao, C.V. Borlongan, L. Chao, J. Chao, Kallikrein protects against ischemic stroke by inhibiting apoptosis and inflammation and promoting angiogenesis and neurogenesis, Hum. Gene Ther. 17 (2006) 206e219. valos, The role of angiogenesis in [12] J.F. Arenillas, T. Sobrino, J. Castillo, A. Da damage and recovery from ischemic stroke, Curr. Treat. Options Cardiovasc. Med. 9 (2007) 205e212. [13] Y. Li, Z. Lu, C.L. Keogh, S.P. Yu, L. Wei, Erythropoietin-induced neurovascular protection, angiogenesis, and cerebral blood flow restoration after focal ischemia in mice, J. Cereb. Blood Flow Metab. 27 (2016) 116e119. [14] K.H. Heike Beck, Angiogenesis after cerebral ischemia, Acta Neuropathol. 117 (2009) 481e496. [15] J. John, F. Sheila, B. Armin, S. Thomas Carmichae, A neurovascular niche for neurogenesis after stroke, Neuroscience 26 (2006) 13007e13016. [16] J. Chen, M. Chopp, Neurorestorative treatment of stroke: cell and pharmacological approaches, NeuroRx 3 (2006) 466e473. r, [17] S. Daniel, D. Jamin, N. Kai, C. Englund, I. Mahmud, R. Hevner, Z. Molna Neurovascular congruence during cerebral cortical development, Cerebr. Cortex 19 (2009) 32e41. [18] B. Lee, D. Clarke, A. Ahmad, M. Kahle, C. Parham, L. Auckland, C. Shaw, M. Fidanboylu, A.W. Orr, O. Ogunshola, A. Fertala, S.A. Thomas, G.J. Bix, Perlecan domain V is neuroprotective and proangiogenic following ischemic stroke in rodents, J. Clin. Investig. 121 (2011) 3005. [19] C. Carsten, J. Vera, K. Wolfram, T. Serge, P. Nikolaus, K. Josef, Combination therapy in ischemic stroke: synergistic neuroprotective effects of memantine and clenbuterol, Stroke 35 (2004) 1197e1202. [20] J.V. Ly, J.A. Zavala, G.A. Donnan, Neuroprotection and thrombolysis: combination therapy in acute ischaemic stroke, Expert Opin. Pharmacother. 7

16

W.-X. Zhang et al. / European Journal of Medicinal Chemistry 183 (2019) 111695

(2006) 1571e1581. [21] P.A. Lapchak, Emerging therapies: pleiotropic multi-target drugs to treat stroke victims, Transl. Stroke Res. 2 (2011) 129e135. [22] Y. Takabatake, E. Uno, K. Wakamatsu, N. Yamazaki, N. Hashimoto, Y. Tsuchiya, The clinical effect of combination therapy with edaravone and sodium ozagrel for acute cerebral infarction, Brain Nerve 55 (2003) 589e593. [23] J.B. Wang, L.L. Huang, C. Cheng, G. Li, J.W. Xie, M.Y. Shen, Q. Chen, W.L. Li, W.F. He, P.H. Qiu, J.Z. Wu, Design, synthesis and biological evaluation of chalcone analogues with novel dual antioxidant mechanisms as potential anti-ischemic stroke agents, Acta Pharm. Sin. B 9 (2019) 145e160. [24] X. Zhang, J. Wang, C. Hong, W. Luo, C.J. Wang, Design, synthesis and evaluation of genistein-polyamine conjugates as multi-functional anti-Alzheimer agents, Acta Pharm. Sin. B 5 (2015) 67e73. [25] P.L. Wang, R. Zhao, W. Yan, X. Zhang, H. Zhang, B. Xu, F. Chu, Y. Han, G. Li, W. Liu, Y. Zhang, H.M. Lei, Neuroprotection by new ligustrazine-cinnamon acid derivatives on CoCl2-induced apoptosis in differentiated PC12 cells, Bioorg. Chem. 77 (2018) 360e369. [26] C. Zhang, W. Yan, R. Zhao, B. Xu, X. Fang, M. Yan, Design, synthesis and evaluation of new ligustrazine derivatives as potential plasma-stable neuroprotective agents, MedChemComm 8 (2017) 652e656. [27] G. Li, Y. Tian, Y. Zhang, Y. Hong, Y. Hao, C. Chen, A novel ligustrazine derivative T-VA prevents neurotoxicity in differentiated PC12 cells and protects the brain against ischemia injury in MCAO rats, Int. J. Mol. Sci. 16 (2015) 21759e21774. [28] X. Zhang, R. Zhao, M. Chen, T. Ma, G. Wu, N. Xue, G. Li, H. Wang, K. Fang, W. Zhang, P.L. Wang, H.M. Lei, Novel neuroprotective lead compound ligustrazine derivative mass spectrometry fragmentation rule and metabolites in rats by LC/LTQ-Orbitrap MS, Molecules 23 (2018) 1154. [29] F. Zhou, G. Wu, D. Cai, B. Xu, M. Yan, T. Ma, W. Guo, W. Zhang, X. Huang, X. Jia, Yu Yang, F. Gao, P.L. Wang, H.M. Lei, Synthesis and biological activity of glycyrrhetinic acid derivatives as antitumor agents, Eur. J. Med. Chem. 6 (2019) 178. [30] Y. Gu, J. Chen, J. Shen, Herbal medicines for ischemic stroke: combating inflammation as therapeutic targets, J. Neuroimmune Pharmacol. 9 (2014) 313e339. [31] A. Gaspar A, E.M. Garrido, E. M ario, Q. Elias, M. Nuno, G. Jorge, B. Fernanda, New insights into the antioxidant activity of hydroxycinnamic acids: synthesis and physicochemical characterization of novel halogenated derivatives, Eur. J. Med. Chem. 44 (2009) 2092e2099. [32] X. Zhang, X. He, Q. Chen, J. Lu, S. Rapposelli, R. Pi, A review on the hybrids of hydroxycinnamic acid as multi-target-directed ligands against Alzheimer's disease, Bioorg. Med. Chem. 26 (2017) 543e550. [33] D.Y. Choi, Y.H. Baek, J.E. Huh, J.M. Ko, H.S. Woo, J.D. Lee, D.S. Park, Stimulatory effect of Cinnamomum cassia and cinnamic acid on angiogenesis through upregulation of VEGF and Flk-1/KDR expression, Int. Immunopharmacol. 9 (2009) 967. [34] S.H. Buck, T.F. Burks, The neuropharmacology of capsaicin: review of some recent observations, Pharmacol. Rev. 38 (1986) 179. [35] S. Pegorini, D. Braida, C. Verzoni, C. Guerini-Rocco, G.G. Consalez, L. Croci, M. Sala, Capsaicin exhibits neuroprotective effects in a model of transient global cerebral ischemia in Mongolian gerbils, Br. J. Pharmacol. 144 (2005) 727e735. [36] M. Huang, G. Cheng, H. Tan, R. Qin, Y. Zou, Y. Wang, Y. Zhang, Capsaicin protects cortical neurons against ischemia/reperfusion injury via downregulating NMDA receptors, Exp. Neurol. 295 (2017) 66e76. [37] C.S.J. Walpole, S. Bevan, G. Bloomfield, R. Breckenridge, I.F. James, T. Ritchie, A. Szallasi, J. Winter, R. Wrigglesworth, Similarities and differences in the structure-activity relationships of capsaicin and resiniferatoxin analogues[J], J. Med. Chem. 39 (1996) 2939e2952.

[38] J. Zou, P. Gao, X. Hao, et al., Recent progress in the structural modification and pharmacological activities of ligustrazine derivatives, Eur. J. Med. Chem. 147 (2018) 150e162. [39] N. Shao, F. Xin, Medium- and long-term efficacy of ligustrazine plus conventional medication on ischemic stroke: a systematic review and metaanaly-sis, Chin. J. Med. 33 (2013) 715e720. [40] G. Cai, B. Liu, W. Liu, X.H. Tan, J.H. Rong, X.M. Chen, L. Tong, J.G. Shen, Buyang Huanwu Decoction can improve recovery of neurological function, reduce infarction volume, stimulate neural proliferation and modulate VEGF and Flk1 expressions in transient focal cerebral ischaemic rat brains, J. Ethnopharmacol. 113 (2007) 0e299. [41] R.L. Wei, H.J. Teng, B. Yin, Y. Xu, Y. Du, F.P. He, K.T. Chu, B.Y. Luo, G.Q. Zheng, A systematic review and meta-analysis of Buyang Huanwu decoction in animal model of focal cerebral ischemia, Evid. Based Complement Altern. Med. 2013 (2013) 1e13. [42] R. Zhao, X.Y. Zhang, G. Wu, B. Xu, Y. Han, M. Chen, P.L. Wang, H.M. Lei, Synthesis optimization of 2-chloromethyl-3, 5, 6-trimethylpyrazine derivative as the intermediate of ligustrazine, Northwest Pharm. J. 33 (2018) 380e384. [43] S.H. Koh, S.H. Kim, Role of Oxidative Stress in Neurodegenerative Diseases and Ischemic Stroke, and Prospects of Antioxidant Therapies as a New Therapeutic Strategy, vol. 26, 2006, pp. 33e43. [44] E. Radi, P. Formichi, C. Battisti, A. Federico, Apoptosis and oxidative stress in neurodegenerative diseases, J. Alzheimers Dis. 42 (2014) S125eS152. [45] G. Sun, J. Wang, X. Guo, M. Lei, Y. Zhang, X. Wang, X. Shen, L. Hu, Design, synthesis and biological evaluation of LX2343 derivatives as neuroprotective agents for the treatment of Alzheimer's disease, Eur. J. Med. Chem. 145 (2018) 622e633. [46] Z. Jiang, W. Wang, C. Guo, Tetrahydroxy stilbene glucoside ameliorates H2O2induced human brain microvascular endothelial cell dysfunction in vitro by inhibiting oxidative stress and inflammatory responses, Mol. Med. Rep. 16 (2017) 5219e5224. [47] J. Xiang, Y.P. Tang, P. Wu, J.P. Gao, D.F. Cai, Chinese medicine Nao-Shuan-Tong attenuates cerebral ischemic injury by inhibiting apoptosis in a rat model of stroke, J. Ethnopharmacol. 131 (2010) 0e181. [48] G.Q. Hu, X. Du, Y.J. Li, X.Q. Gao, B.Q. Chen, L. Yu, Inhibition of cerebral ischemia/reperfusion injuryinduced apoptosis: nicotiflorin and JAK2/STAT3 pathway, Neural Regen. 01 (2017) 98e104. [49] T.H. Sanderson, C.A. Reynolds, R. Kumar, K. Przyklenk, Molecular mechanisms of ischemiaereperfusion injury in brain: pivotal role of the mitochondrial membrane potential in reactive oxygen species generation[J], Mol. Neurobiol. 47 (2013) 9e23. [50] N. Magdalena, K. Marciniak, J.Z. Nowak, VEGF as an angiogenic, neurotrophic, and neuroprotective factor, Poste˛ py Higieny Medycyny Doswiadczalnej 59 (2015) 573. [51] Y. Sun, K. Jin, L. Xie, J. Childs, X. Mao, A. Logvinova, D.A. Greenberg, VEGFinduced neuroprotection, neurogenesis, and angiogenesis after focal cerebral ischemia, J. Clin. Investig. 111 (2013) 1843e1851. [52] G. Cai, B. Liu, W. Liu, X. Tan, J. Rong, X. Chen, L. Tong, J. Shen, Buyang Huanwu Decoction can improve recovery of neurological function, reduce infarction volume, stimulate neural proliferation and modulate VEGF and Flk1 expressions in transient focal cerebral ischaemic rat brains, J. Ethnopharmacol. 113 (2007) 0e299. var, M. Dewerchin, P. Carmeliet, Vascular [53] C. Lange, E. Storkebaum, C.R. Almodo endothelial growth factor: a neurovascular target in neurological diseases, Nat. Rev. Neurol. 12 (2016) 439. [54] M. Oshikawa, K. Okada, N. Kaneko, K. Sawamoto, I. Ajioka, Affinity-immobilization of VEGF on laminin porous sponge enhances angiogenesis in the ischemic brain, Adv. Healthc. Mater. 6 (2017) (n/a).