- Email: [email protected]
Detection of bovine herpesvirus-1 in bovine semen by a nested PCR assay
Journal of Virological Methods, 44 (1993) 129-l 40 0 1993 Elsevier Science Publishers B.V.
Journal of Virological Methods
All rights reserved / 0166-0934/93/$06.00 VIRMET 01541
Detection of bovine herpesvirus-l in bovine semen by a nested PCR assay Martin
WiedmamF, Richard Brando&‘, Pat Wagnera, Edward J. Dubovib and Carl A. Batta
“Department of Food Science Cornell University Ithaca, NY (USA) and bVeterinary Diagnostic Laboratory New York State College of Veterinary Medicine Cornell University Ithaca, NY (USA) (Accepted
14 April
1993)
Summary A nested PCR assay targeting a portion of the glycoprotein IV gene has been developed for the detection of Bovine Herpesvirus-l (BHV-I). Rapid and sensitive detection of the PCR products was achieved using a nonisotopic reverse dot-blot format with a visible color readout. Cross-reactivity of this PCR assay was not observed with the closely related BHV-3. The sensitivity of this assay when tested on a supernatant from a BHV-1 cell culture was approximately 4.5 TCID50 (50% tissue culture infectious dose). A procedure using the chelating resin Chelex 100 was used to prepare viral DNA from artificially inoculated samples of extended and raw semen for use in the PCR assay. In combination with nested PCR and reverse dot blot, this method allowed the detection of 5 x lo3 TCID per 0.5 ml of semen, which is comparable to the detection in the Cornell Semen Test. The whole procedure can be completed in approximately 8 h. This assay has therefore the potential of replacing the currently available yet time consuming and costly detection methods for BHV-1 in bovine semep. Bovine herpesvirus
Correspondence to: 255-8741.
CA.
1; Semen; Detection;
Batt, 413 Stocking
Polymerase
chain rewtion
Hall, Cornell University,
Ithaca,
NY 14853, USA. Fax: (607)
130
Introduction Infectious bovine rhinotracheitis/infectious pustular vulvovaginitis (IBR/ IPV) is an economically important disease of cattle which results from infection with bovine herpesvirus-l (BHV-1). BHV-1 infection may induce abortion in pregnant cows and severe illness in calves (Probst et al., 1985). Transmission of BHV-1 is generally considered to be by aerosol entry via the mucous membranes of the respiratory tract. However, transmission can also occur via the genital mucous membranes through physical contact as well as by BHV1 contaminated semen (Straub, 1991). The risk of transmission by semen is increased through the use of artificial insemination, where a single virus laden ejaculate may be diluted and inseminated in many susceptible females (Drew et al., 1987). It is important to note that the virus can survive in semen storage containers below --WC, where it can also contaminate virus free semen. Despite a pronounced immune response, BHV-1 is not eliminated from the host following infection. The virus can remain latent in infected, but clinically normal, animals (Pastoret et al., 1984). It is harbored for long periods in ganglia and may be re-excreted in the respiratory and/or genital tract at intervals with, or without, clinical signs of the disease. Vaccines, although capable of preventing clinical disease, are unable to prevent the establishment of latency. Diagnosis of BE-IV-1 infection in a herd is usually based on serum neutralization tests, but many other diagnostic tests have been applied (for review see Straub, 1990). Tests used to detect the presence of BHV-1 in semen include virus isolation techniques (Sheffy et al., 1974; Darcel et al., 1977; Kahrs et al., 1977) as well as the ‘Cornell Semen Test’, in which pooled samples of semen are inoculates into susceptible calves or sheep (Schultz et al., 1982). Subsequent serologiCa testing of the inoculated animals can reveal the types of pathogens that were present in the semen sample. This method has several disadvantages. First, it is not possible to recognize which specific sample(s) is/ are contaminated, Since usually more than 100 semen samples are pooled together. Second, animal isolation facilities are required and subsequently the overall costs of this test are fairly high. Third, seroconversion of the animals inoculated with semen takes up to 3 wk (Schultz et al., 1982). Detection of virus in semen by cell culture techniques has proven to be difficult due to the natural cytotoxicity of seminal plasma (Kahrs et al., 1977; Schultz et al., 1982). Clearly there is a need for fast and inexpensive diagnostic tests for the detection of viral pathogens in bovine semen. The development of a nested PCR assay is described for the detection of BHV-1 together with a reverse dot-blot for the specific detection of the PCR products. This assay was tested on supernatant from cell cultures as well as on artificially inoculated bovine semen. The assay format has the potential of replacing conventional virus detection methods for bovine semen.
131
Materials and Methods Viral strains BHV- 1 strain Colorado was grown for 24 h in MDBK cells previously shown to be free of mycoplasma and BVDV contamination. Following a single freezethaw cycle, the supernatant and cells were separated by low speed centrifugation and the supernatant was used in the assays. The 50% tissue culture infectious dose (TCIDSO) of the supernatant was determined in MDBK cells using a standard microtiter methodology. Aliquots of the supernatant were stored at - 80°C until used in the detection assay. Tenfold serial dilutions of the supernatant were prepared in PBS prior to use in the PCR assay. Bovine Herpesvirus(BHV-3) strain DN-599 was grown in secondary bovine testes cells and the supernatant harvested as described above. This strain together with Movar type agents of cattle has previously been designated as BHV-4. Both have recently been reclassified BHV-3 since Malignant Catarrhal Fever (MCF) herpesviruses, which were originally designated BHV-3, were removed from the bovine category (Dinter and Moreiti, 1990). Design of PCR primers and PCR conditions Nested PCR primers were designed to amplify part of the BHV-1 glycoprotein IV gene (Tikoo et al., 1990). The sequence of the two external primers BHVI-4F-EXT and BHVl-4R-EXT are S’GCTGTGGGAAGCGGTACG 3’ (nt 351-368) and SGTCGACTATGGCCTTGTGTGC 3’ (nt 817-796), respectively; the sequence for the two internal primers BHV1-4bFINT and BHVlAbR-INT are S’ACGGTCATATGGTACAAGATCGAGAGCG 3’ (nt 394-422) and S’CCAAAGGTGTACCCGCGAGCC 3’ (nt 716-696), respectively. Both pairs of primers were used simultaneously in a single-tube nested PCR format. The two pairs of primers have different melting temperatures (TM) with the external primers having a TM of around 63°C and the internal primers having a T M of around 70°C. This difference makes it possible to raise the annealing temperature after 10 cycles from 60°C to 65°C for the next 30 cycles, therefore allowing primarily the internal primers to participate in the amplification in the latter cycles. The PCR reactions were performed in 25 ~1 containing 2.5 nmol each of dATP, dCTP, dGTP and dTTP, 8% dimethylsulfoxide (DMSO), 2.5 pmol primers BHV1-4F-EXT and BHVI4R-EXT, 25 pmol of BHVlAbF-INT and BHVldbR-INT and 1.5 units of Taq polymerase (Gibco BRL, Gaithersburg, MD) in 1 x PCR buffer (20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgQ). To label the PCR product with digoxigenin, 0.25 nmol digoxigenin-labeled dUTP (Boehringer Mannheim, Indianapolis, IN) was included in the reaction mix. Amplifications were performed in an air-cooled HybaidTM thermal reactor (National Labnet Co., Woodbridge, NJ) with the amplification cycles consisting of an initial denaturation of 4 min at 92”C, followed by 10 cycles of 1 min at 94”C, 1
132
min at 60°C and 1 min at 72°C followed by 30 cycles of 1 min at 94°C 1 min at 65°C and 1 min at 72°C with a final extension step of 6 min at 72°C. Reactions were performed using a ‘hot-start’ procedure by withholding the polymerase until the first denaturation step was completed (Erlich et al., 1991). The amplification products were analyzed by 2.5% agarose gel electrophoresis in TBE (89 mM Tris-borate, 2 mM EDTA, pH 8.2) buffer. Reverse Dot-boot assay
Detection of PCR products labeled with digoxigenin was achieved using a modified reverse dot-blot format as described previously (Bsat and Batt, 1993). For this purpose, a capture probe (5” GCTTCCTGGCGGGCTTCGCCTACC 3’) was designed that is complementary to a sequence between the two internal nested PCR primers. Poly-dT tailing of the capture probe as well as the reverse dot-blot were performed as described previously. Detection of the digoxigenin labeled PCR products was performed using LumiphosTM530 (Boehringer Mannheim) or Nitroblue Tetrazolium Salt (NET) and X-phosphate. Detection of BHV-I
in artificially
inoculated semen
Samples of extended (in whole milk extender) and raw semen were obtained from Eastern Artificial Insemination, Inc. (Ithaca, NY). Aliquots from these semen samples were spiked with serial dilutions of the virus culture supernatant and directly used for the DNA preparation described below. In addition, spiked raw semen samples were centrifuged at 10 000 x g to remove spermatozoa; the supernatant was used for the following manipulations. Viral DNA was prepared by a procedure using Chelex 100 (Walsh et al,, 1991). An aliquot of semen (either 3 ~1, 6 ,ul or 12 111)was incubated at 56°C for 30 min in 220 $1 of a solution containing 5% Chelex 100, 0.5 mg/ml proteinase K and 30 mM DTT. After centrifuging the solution for 10 set, the tubes were placed in a boiling waterbath for 8 min and subsequently spun for 3 min. A 10 ~1 aliquot of the supernatant was used in the PCR reaction. Results PCR
The external primers amplified a 468 bp product and the internal primers a 325 bp fragment of the BHV-1 glycoprotein IV gene. These product sizes were predicted based upon the published gene sequence. After 40 PCR cycles, a predominant 325 bp PCR fragment was visible on an ethidium-bromide stained agarose gel. When high template concentrations (more than 500 TCIDsa) were used, additional bands of the size expected for amplification with the outer primers (468 bp) as well as intermediate products were observed (see lane N,
133
ABCDEF
GHXJKLMNOP
Fig. 1. Detection of BHV-1 in raw (lane A to G) and extended (lane I to M) semen by nested PCR with detection of the PCR products using agarose gel electrophoresis. Lane H and P shows the migration of marker fragments of Hinf I digested Xl74 (Molecular weights [in bp] of: 1353; 1078; 872; 603; 310; 281; 271; 234; 194; 118; 72). Quantities of BHV-1 particles (in TCID,, per 0.5 ml semen) added to the semen were as follows: lane A: 5 x IO’; lane B: 1 x 105;lane C and I: 5 x 104;Lane D and J: 1 x 104; lane E and K: 5 x 10”; lane F and L: 1 x 103; lane G and M: no virus added; Lane N: 500 TCID,, directly added to the PCR; Lane 0: water directly added to the PCR. The arrow marks the size of the PCR fragment expected for ampii~cation with the internal primers.
Fig. 1). The sensitivity of the PCR assay was optimized using DMSO concentrations between 0 and 10% in PCR reactions with 50 to 5000 TCIDse of virus. DMSO at concentrations up to 4% gave a 10 to 100 fold lower sensitivity relative to the sensitivity which was obtained with a DMSO concentration of 8% as judged by ethidium-bromide stained agarose gel electrophoresis (data not shown). The MgCi2 concentration was optimized between 1.5 and 4.5 mM; while 1.5 mM was optimal, higher concentrations produced more non-specific amplification (data not shown). The optimized PCR assay consistently detected at least 45 TCIDse when tested on virus from tissue culture supernatants. The specificity of this assay was tested with approximately 1 x lo2 TCIDJJO BHV-3 from tissue culture supernatant. No PCR product was obtained with this target. Reverse dot-blot hybridization To increase the sensitivity and user-friendliness of this PCR assay, a reversedot-blot format was applied, with the readout being the development of a visual color. For this purpose, 10 PM of digoxigenin-labeled dUTP (at a ratio of 1~10 to dTTP) was included in the PCR reaction so that one PCR product was labeled with about 5 digoxigenin molecules. This format was optimized with regards to dNTP and digoxigenin-dUTP concentrations used in the PCR reaction. Optimal signal to noise ratio was obtained with a dNTP
134
concentration of 2.5 nmol and a digoxigenin-dUTP concentration of 0.25 nmo1/25 ~1 PCR reaction (data not shown). Compared to ethidium-bromide stained agarose gels the reverse dot blot detection method improved the sensitivity of the assay about lo-fold to a detection limit of 4.5 TCIDSO on cell culture supernatant. The color reaction using NBT and X-phosphate needed an incubation time of 6 h to achieve this level of sensitivity. The time needed for completion of the color reaction can be reduced to 1 h through the use of the chemiluminescent substrate LumiPhos (data not shown). A 30 min exposure of the membrane to X-ray film resulted in the same sensitivity as a 6-h incubation of a NBT/X-phosphate color reaction. Detection of BHV-I
in artificially
inoculated extended or raw semen
The applicability of this assay was tested first on extended semen artificially inoculated with BHV-1. Viral DNA from the inoculated semen was prepared by a procedure using Chelex 100 and a 10 ~1 aliquot of this preparation was used in a 25 ~1 PCR reaction. Preliminary experiments showed that 12 ~1 extended semen can be used in the Chelex preparation without causing inhibition in the PCR; this amount of semen was therefore used in the following tests. In the first series of experiments, the sensitivity of this assay was determined on ethidium-bromide stained agarose gels. We were able to detect 1 x lo4 TCIDSO BHV-1 per 0.5 ml extended semen. Since only the equivalent of approximately 0.5 ~1 semen was used in the PCR reaction, this corresy 3nds to a sensitivity of about 10 TCIDso per PCR reaction. Typical results of a nested PCR with detection of the PCR products on an ethidium-bromide stained agarose gel are shown in lanes I to M of Fig. 1. Two bands of PCR amplified DNA in the range of 600 to 800 bp which are consistently present, even in the PCR from uninoculated extended semen, seem to be non-specific amplification products from spermatozoa present in the samples. These non-specific products did not interfere with the subsequent reverse dot-blot. The sensitivity of this assay was improved approximately 2 fold when the PCR products were detected using the reverse dot-blot procedure described above. Therefore, the detection limit was lowered to 5 x lo3 TCID per 0.5 ml extended semen. Fig. 2 shows, in squares B4 to C4, representative results of a reverse dot-blot on a nested PCR with artificially inoculated extended semen samples. A dark spot, which represents a ositive result, is clearly visible for semen samples inoculated with 5 x 10I? to 5 x lo4 TCIDso BHV-1 per 0.5 ml (B4 to C2) while no background is detectable with the uninoculated semen (C4). We also investigated the application of the Chelex procedure and this nested PCR assay for the detection of BHV-1 in artificially inoculated raw semen. Results using raw semen showed that a maximum of 3 ,ul can be used in the Chelex preparation with subsequent use of 5 ~1 of this DNA in the PCR without experiencing PCR inhibition. Consequently, we removed spermatozoa from the raw semen by centrifugation prior to the DNA preparation. This allowed the use of 6 ~1 of the supernatant for the Chelex preparation and 10 ~1
135
A
B
c
D Fig. 2. Detection of BHV-1 in raw (Al to B3) and extended (B4 to C4) semen by nested PCR; detection of the PCR product in a reverse dot-blot format with X-phosphate and NBT as color substrate. Quantities of BHV-I particles (in TCID,, per 0.5 ml semen) added to the semen were as follows: Al: 5 x 105;A2: 1 x IO’; A3 and B4: 5 x 104;A4 and Cl: 1 x 104; Bl and C2: 5 x 103;B2 and C3: 1 x 1tJ3;B3 and C4: no virus added; Dl: water directly added to the PCR; D4: no PCR product spotted on filter.
of this in the PCR without experiencing inhibition. As determined by agarose gel electrophoresis, the sensitivity of the nested PCR was 1 x 105 TCIDse per 0.5 ml raw semen without centrifugation in the DNA preparation, and 5 x lo4 TCID50 if a first centrifugation step was applied. Lanes A to G of Fig. 1 show the results of such a PCR, the positive results for 5 x IO4 TCIDse are represented by a very faint band of 325 bp molecular weight (lane C). In conjunction with a reverse dot-blot format it was possible to improve the sensitivity approximately lo-fold so that 5 x lo3 TCIDSO per 0.5 ml raw semen could be detected (see square Bl in Fig. 2). This level of sensitivity was only reached when the first centrifugation step was included in the DNA preparation. The presence of spermatozoa in the PCR gave rise to a significant amount of non-specific amplification products, which were seen as a smear on ethidium-bromide stained agarose gels. High background was observed when
136
these PCR products were used in the reverse dot-blot, while the small amount of non-specific product in PCR using extended semen did not interfere.
Discussion The transmission of BHV-1 by bovine semen poses a major threat to the artificial insemination industry and to dairy and beef farming. Currently available detection methods for BHV-1 in bovine semen are less than totally satisfactory with regards to sensitivity, time and cost efficiency. PCR based detection systems for BHV-1 have been described by Vilcek (1993) and by Israel et al. (1992). Neither report describes the application of their PCR assay on semen samples and both rely on agarose gel electrophoresis for the detection of the PCR products. The sensitivit of these assays is either not described (Vilcek, 1993) or in the order of 10Y PFU (plaque forming units) per ml in spiked nasal secretions (Israel et al., 1992). We describe here the use of a PCR assay for the detection of BHV-1 in bovine semen. A set of nested primers were designed to target a sequence in the BHV-1 glycoprotein IV gene. The primers were designed so that they would not hybridize to the pseudorabies virus gp50 (Petrovskis et al., 1986) or the herpes simplex virus type 1 gD (Watson et al., 1982) gene. A genebank search revealed that these two are the most related genes to the BHV-1 glycoprotein IV in the herpesvirus group. We have also demonstrated that these primers show no cross hybridization with the closely related BHV-3. The PCR assay was optimized with respect to concentrations of DMSO, MgQ, primers, dNTPs and digoxigenin-dUTP used, to reach the highest possible sensitivity together with a high signal-to-noise ratio. While the contribution of most of these components to PCR performance is well known, the role of DMSO is not completely clear. Masoud et al. (1992) suggest that the effects of DMSO on PCR performance might be related in part to a destabilizing effect on double-stranded DNA, particularly in G + C rich targets. The target region for the PCR described herein has a G + C content of 64% which might explain the beneficial effects of DMSO in the PCR reactions. A sensitivity of 4.5 TCIDsa was achieved when the reverse dot-blot PCR assay was performed on culture supernatant. The modified reverse dot-blot assay allowed a 10 fold increase in sensitivity compared to detection methods using ethidium-bromide stained agarose gels as well as providing a fast, user friendly and cost-efficient format (Bsat and Batt, 1993). We demonstrated the use of a nested PCR assay in conjunction with a fast DNA preparation method utilizing Chelex 100 for the detection of BHV-1 in bovine semen. Previously described methods for the isolation of viral DNA from human semen are time consuming and/or involve the-use of hazardous chemicals and sophisticated equipment (Green et al., 1991; Mermin et al., 1991). The procedure using Chelex 100 was described originally for the preparation of chromosomal DNA from sperm cells (Walsh et al., 1991). These authors found that DNA prepared with this procedure yielded PCR products
137
comparable to that obtained with phenol/chloroform purified DNA, while DNA prepared with water instead of Chelex resulted in less efficient amplification. In our hands this method proved useful as a fast and easy method for the isolation of viral DNA from extended semen samples. This method also prevented PCR inhibition that was observed when semen samples were directly used in a PCR (data not shown). Primary removal of spermatozoa by centrifugation proved necessary when spiked raw semen was used in this DNA preparation method. Direct use of raw semen led to decreased sensitivity in the PCR as well as high background in the reverse dot-blot detection. The disadvantage of the Chelex 100 DNA preparation is that it involves some dilution of the semen sample, therefore allowing only the use of a small equivalent of the original sample in the PCR reaction. Nevertheless, the ease of use and the rapidity of the DNA preparation makes this method an interesting alternative to current costly and laborious procedures. Also the Chelex preparation described now provided in our hands a higher sensitivity for the PCR assay as compared to a previously described preparation method using guanidinium thiocyanate (Boom et al., 1990) (data not shown). The sensitivity of the nested PCR assay described herein is 5 x 10’ TCIDso per 0.5 ml of extended or raw semen. The current ‘gold standard’ for the detection of BHV-I in semen is the Cornell Semen Test that has a sensitivity of 5 x lo3 to 2.5 x lo4 TCIDSO per 0.5 ml semen (Schultz et al., 1982). The combined sensitivity, rapidity and cost effectiveness makes this nested PCR assay an excellent alternative to the Cornell Semen Test for the detection of BHV-1 in semen samples. The PCR test, including DNA preparation and reverse dot-blot, can be completed in about 8 h, while the Cornell Semen Test takes 3 to 5 weeks for serological confirmation. The Cornell Semen Test can be used to screen for a variety of different viral pathogens in bovine semen. These include Bovine Viral Diarrhea Virus (BVDV), Bluetongue-Virus (BTV), Bovine Herpes Mammillitis Virus (BHMV) and Bovine Leukosis Virus (BLV). It might be possible to include PCR primers for the detection of these viruses in a multiplex PCR assay in conjunction with a reverse dot-blot format. Future efforts will also be directed towards increased sensitivity of this method, e.g., through an initial enrichment step using immunomagnetic separation (IMS). The combination of PCR and IMS has already proven useful in some clinical diagnostic assays (Brown and Robertson, 1990; Muir et al., 1993) and also may be promising for the application on semen samples. If such an assay will be applied for routine diagnosis, e.g. tests for imported or exported semen, a suitable control has to be incorporated to exclude false negative results, e.g., due to PCR inhibition. Such a control could involve the spiking of an aliquot of the sample with the lowest detectable amount of pure DNA and subsequently run in parallel with the unspiked sample. Such a test would then have the potential to completely replace the Cornell Semen Test for the detection of viral pathogens in bovine semen. The tests described were carried out on semen samples that were artificially inoculated with BHV- 1. Artilicially inoculated semen is a good model for the
138
situation found usually occurs plasma (Kahrs infected semen procedure.
in naturally infected semen, since natural infection of the semen during ejaculation which results in free virus in the seminal tests on naturally et al., 1977; Straub, 1991). Nevertheless, will have to be performed to prove the effectiveness of this
Acknowledgements This work was supported by grants from the National Association of Animal Breeders (NAAB) and the Cornell Center for Advanced Technology (CAT) in Biotechnology which is sponsored by the New York State Science and Technology Foundation (a consortium of industries, the U.S. Army Research Office and the National Science Foundation), Eastern Artificial Insemination (Ithaca, NY) and Idetek Inc. (Sunnyvale, Ca.) M.W. was supported by a stipend of the Gottlieb Daimler- and Carl Benz-Stiftung (2.92.04). The authors wish to thank Nada*.Bsat and Herb Rycroft (Eastern AI.) for their help.
References Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen, C.L., Wertheim-van Dillen, P.M.E. and van der Noordaa, J. (1990) Rapid and simple method for purification of nucleic acids. J. Clin. Microbial. 28, 4955503. Brown, V.K. and Robertson, B.H. (1990) Immunoselection of clinical specimens containing virus followed by polymerase chain reactor amplification and rapid direct sequencing. BioTechniques 8, 262-264. Bsat, N. and Batt, C.A. (1993) A combined modified reverse dot blot and nested PCR assay for the specific nonradioactive detection of Listeria monocytogenes. Mol. Cell. Probes 17, 1999207. Darcel, C. le Q., Yates, W.D.G. and Mitchell, D. (1977) A technique for the isolation of bovine herpesvirus 1 from bull semen using microtiter plates. Proc. 20th An. Meet. Am. Assoc. Vet. Lab. Diagnost. 2099214. Dinter, Z. and Morein, B. (1990) Virus Infections of Ruminants. Elsevier Science Publishers. Amsterdam. pp. 69970. Drew, T.W., Hewitt-Taylor, C., Watson, L. and Edwards, S. (1987) Effect of storage conditions and culture technique on the isolation of infectious bovine rhinotracheitis virus from bovine semen. Vet. Rec. 121, 5477548. Erlich, H.A., Gelfand D. and Sninsky J.J. (1991) Recent advances in the polymerase chain reaction. Science 252, 1643-l 650. Green, J., Monteiro, E., Bolton, V.N., Sanders, P. and Gibson, P.E. (1991) Detection of human papillomavirus DNA by PCR in semen from patients with and without penile warts. Genitourin. Med. 67, 2077210. Israel, B.A., Herber, R., Gao, Y. and Letchworth III, G.J. (1992) Induction of a mucosal barrier to bovine herpesvirus 1 replication in cattle. Virology 188, 2566264. Kahrs, R.F., Johnson, M.E. and Bender, G.M. (1977) Studies on the detection of infectious bovine rhinotracheitis (IBR) virus in bovine semen. Proc. 20th An. Meet. Am. Assoc. Vet. Lab. Diagnost. 187-208. Masoud, S.A., Johnson, L.B. and White, F.F. (1992) The sequence within two primers influences the optimum concentration of dimethyl sulfoxide in the PCR. PCR Methods Applications 2, 89-90. Mermin, J.H., Holodniy, M., Katzenstein, D.A. and Merigan, T.C. (1991) Detection of the human
139 immunodeliciency virus DNA and RNA in semen by the polymerase chain reaction. J. Infect. Dis. 164, 7699112. Muir, P., Nicholson, F., Jhetam, M., Neogi, S. and Banatvala, J.E. (1993) Rapid diagnosis of enterovirus infection by magnetic bead extraction and polymerase chain reaction detection of enterovirus RNA in clinical specimens. J. Clin. Microbial. 31, 3 I-38. Pastoret, P.-P., Thiery, E., Brochier, B., Derboven, G. and Vindevogel, H. (1984) The role of latency in the epizootiology of infectious bovine rhinotracheitis. In: G. Wittmann, R. Gaskell and H.-J. Rizha (Eds), Latent Herpes Virus Infections in Veterinary Medicine, ed. Martinus Nijhoff Publishers, The Hague, pp. 211-228. Petrovskis, E.A., Timmins, J.G., Armentrout, M.A., Marchioli, CC., Yancey, R.J. Jr. and Post L.E. (1986) DNA sequence of the gene for pseudorabies virus gp50, a glycoprotein without N-linked glycosylation. J. Virol. 59, 216-223. Probst, U., Whyler, R., Khim, U., Ackermann, M., Bruckner, L., Mueller, H.K. and Ehrensperger, F. (1985) Zur IBR-Virus-Ausscheidung experimentell inlizierter Kuehe insbesondere in der Milch. Schweiz. Arch. Tierheilk. 127, 723-733. Schultz, R.D., Adams, L.S., Letchworth, G., Sheffy, B.E., Manning, T. and Bean, B. (1982) A method to test large numbers of bovine semen samples for viral contamination and results of a study using this method. Theriogenol. 17, 115-123. Sheffy, B.E. and Krinsky, M. (1974) IBR in extended bovine semen. Proc. 77th Ann. Meet. US Anim. Health Assoc. 1973, 131-137. Straub, O.C. (1990) Infectious bovine rhinotracheitis virus. In: Z. Dinter and B. Morein (Eds), Virus Infections of Ruminants, Elsevier Science Publishers, Amsterdam, pp. 71-108. Straub, O.C. (1991) BHVI infections: relevance and spread in Eur. Comp. Immunol. Microbial. infect. Dis. 14, 175186. Tikoo, S.K., Fitzpatrick, D.R., Babiuk, L.A. and Zamb, T.J. (1990) Molecular cloning, sequencing, and expression of functional bovine herpesvirus 1 glycoprotein gIV in transfected bovine cells. J. Virol. 64, 5132-5142. Vilcek, S. (1993) Detection of the bovine herpesvirus-l (BHV-I) genome by PCR. J. Virol. Methods 41, 2455248. Walsh, P.S., Metzger, D.A. and Higuchi, R. (1991) Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques IO, 506-513. Watson, R.J., Weis, J.H., Salstrom, J.S. and Enquist, L.W. (1982) Herpes simplex virus type-l glycoprotein D gene: nucleotide sequence and expression in Escherichia coli. Science 218, 381l 384.
Journal of Virological Methods
All rights reserved / 0166-0934/93/$06.00 VIRMET 01541
Detection of bovine herpesvirus-l in bovine semen by a nested PCR assay Martin
WiedmamF, Richard Brando&‘, Pat Wagnera, Edward J. Dubovib and Carl A. Batta
“Department of Food Science Cornell University Ithaca, NY (USA) and bVeterinary Diagnostic Laboratory New York State College of Veterinary Medicine Cornell University Ithaca, NY (USA) (Accepted
14 April
1993)
Summary A nested PCR assay targeting a portion of the glycoprotein IV gene has been developed for the detection of Bovine Herpesvirus-l (BHV-I). Rapid and sensitive detection of the PCR products was achieved using a nonisotopic reverse dot-blot format with a visible color readout. Cross-reactivity of this PCR assay was not observed with the closely related BHV-3. The sensitivity of this assay when tested on a supernatant from a BHV-1 cell culture was approximately 4.5 TCID50 (50% tissue culture infectious dose). A procedure using the chelating resin Chelex 100 was used to prepare viral DNA from artificially inoculated samples of extended and raw semen for use in the PCR assay. In combination with nested PCR and reverse dot blot, this method allowed the detection of 5 x lo3 TCID per 0.5 ml of semen, which is comparable to the detection in the Cornell Semen Test. The whole procedure can be completed in approximately 8 h. This assay has therefore the potential of replacing the currently available yet time consuming and costly detection methods for BHV-1 in bovine semep. Bovine herpesvirus
Correspondence to: 255-8741.
CA.
1; Semen; Detection;
Batt, 413 Stocking
Polymerase
chain rewtion
Hall, Cornell University,
Ithaca,
NY 14853, USA. Fax: (607)
130
Introduction Infectious bovine rhinotracheitis/infectious pustular vulvovaginitis (IBR/ IPV) is an economically important disease of cattle which results from infection with bovine herpesvirus-l (BHV-1). BHV-1 infection may induce abortion in pregnant cows and severe illness in calves (Probst et al., 1985). Transmission of BHV-1 is generally considered to be by aerosol entry via the mucous membranes of the respiratory tract. However, transmission can also occur via the genital mucous membranes through physical contact as well as by BHV1 contaminated semen (Straub, 1991). The risk of transmission by semen is increased through the use of artificial insemination, where a single virus laden ejaculate may be diluted and inseminated in many susceptible females (Drew et al., 1987). It is important to note that the virus can survive in semen storage containers below --WC, where it can also contaminate virus free semen. Despite a pronounced immune response, BHV-1 is not eliminated from the host following infection. The virus can remain latent in infected, but clinically normal, animals (Pastoret et al., 1984). It is harbored for long periods in ganglia and may be re-excreted in the respiratory and/or genital tract at intervals with, or without, clinical signs of the disease. Vaccines, although capable of preventing clinical disease, are unable to prevent the establishment of latency. Diagnosis of BE-IV-1 infection in a herd is usually based on serum neutralization tests, but many other diagnostic tests have been applied (for review see Straub, 1990). Tests used to detect the presence of BHV-1 in semen include virus isolation techniques (Sheffy et al., 1974; Darcel et al., 1977; Kahrs et al., 1977) as well as the ‘Cornell Semen Test’, in which pooled samples of semen are inoculates into susceptible calves or sheep (Schultz et al., 1982). Subsequent serologiCa testing of the inoculated animals can reveal the types of pathogens that were present in the semen sample. This method has several disadvantages. First, it is not possible to recognize which specific sample(s) is/ are contaminated, Since usually more than 100 semen samples are pooled together. Second, animal isolation facilities are required and subsequently the overall costs of this test are fairly high. Third, seroconversion of the animals inoculated with semen takes up to 3 wk (Schultz et al., 1982). Detection of virus in semen by cell culture techniques has proven to be difficult due to the natural cytotoxicity of seminal plasma (Kahrs et al., 1977; Schultz et al., 1982). Clearly there is a need for fast and inexpensive diagnostic tests for the detection of viral pathogens in bovine semen. The development of a nested PCR assay is described for the detection of BHV-1 together with a reverse dot-blot for the specific detection of the PCR products. This assay was tested on supernatant from cell cultures as well as on artificially inoculated bovine semen. The assay format has the potential of replacing conventional virus detection methods for bovine semen.
131
Materials and Methods Viral strains BHV- 1 strain Colorado was grown for 24 h in MDBK cells previously shown to be free of mycoplasma and BVDV contamination. Following a single freezethaw cycle, the supernatant and cells were separated by low speed centrifugation and the supernatant was used in the assays. The 50% tissue culture infectious dose (TCIDSO) of the supernatant was determined in MDBK cells using a standard microtiter methodology. Aliquots of the supernatant were stored at - 80°C until used in the detection assay. Tenfold serial dilutions of the supernatant were prepared in PBS prior to use in the PCR assay. Bovine Herpesvirus(BHV-3) strain DN-599 was grown in secondary bovine testes cells and the supernatant harvested as described above. This strain together with Movar type agents of cattle has previously been designated as BHV-4. Both have recently been reclassified BHV-3 since Malignant Catarrhal Fever (MCF) herpesviruses, which were originally designated BHV-3, were removed from the bovine category (Dinter and Moreiti, 1990). Design of PCR primers and PCR conditions Nested PCR primers were designed to amplify part of the BHV-1 glycoprotein IV gene (Tikoo et al., 1990). The sequence of the two external primers BHVI-4F-EXT and BHVl-4R-EXT are S’GCTGTGGGAAGCGGTACG 3’ (nt 351-368) and SGTCGACTATGGCCTTGTGTGC 3’ (nt 817-796), respectively; the sequence for the two internal primers BHV1-4bFINT and BHVlAbR-INT are S’ACGGTCATATGGTACAAGATCGAGAGCG 3’ (nt 394-422) and S’CCAAAGGTGTACCCGCGAGCC 3’ (nt 716-696), respectively. Both pairs of primers were used simultaneously in a single-tube nested PCR format. The two pairs of primers have different melting temperatures (TM) with the external primers having a TM of around 63°C and the internal primers having a T M of around 70°C. This difference makes it possible to raise the annealing temperature after 10 cycles from 60°C to 65°C for the next 30 cycles, therefore allowing primarily the internal primers to participate in the amplification in the latter cycles. The PCR reactions were performed in 25 ~1 containing 2.5 nmol each of dATP, dCTP, dGTP and dTTP, 8% dimethylsulfoxide (DMSO), 2.5 pmol primers BHV1-4F-EXT and BHVI4R-EXT, 25 pmol of BHVlAbF-INT and BHVldbR-INT and 1.5 units of Taq polymerase (Gibco BRL, Gaithersburg, MD) in 1 x PCR buffer (20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgQ). To label the PCR product with digoxigenin, 0.25 nmol digoxigenin-labeled dUTP (Boehringer Mannheim, Indianapolis, IN) was included in the reaction mix. Amplifications were performed in an air-cooled HybaidTM thermal reactor (National Labnet Co., Woodbridge, NJ) with the amplification cycles consisting of an initial denaturation of 4 min at 92”C, followed by 10 cycles of 1 min at 94”C, 1
132
min at 60°C and 1 min at 72°C followed by 30 cycles of 1 min at 94°C 1 min at 65°C and 1 min at 72°C with a final extension step of 6 min at 72°C. Reactions were performed using a ‘hot-start’ procedure by withholding the polymerase until the first denaturation step was completed (Erlich et al., 1991). The amplification products were analyzed by 2.5% agarose gel electrophoresis in TBE (89 mM Tris-borate, 2 mM EDTA, pH 8.2) buffer. Reverse Dot-boot assay
Detection of PCR products labeled with digoxigenin was achieved using a modified reverse dot-blot format as described previously (Bsat and Batt, 1993). For this purpose, a capture probe (5” GCTTCCTGGCGGGCTTCGCCTACC 3’) was designed that is complementary to a sequence between the two internal nested PCR primers. Poly-dT tailing of the capture probe as well as the reverse dot-blot were performed as described previously. Detection of the digoxigenin labeled PCR products was performed using LumiphosTM530 (Boehringer Mannheim) or Nitroblue Tetrazolium Salt (NET) and X-phosphate. Detection of BHV-I
in artificially
inoculated semen
Samples of extended (in whole milk extender) and raw semen were obtained from Eastern Artificial Insemination, Inc. (Ithaca, NY). Aliquots from these semen samples were spiked with serial dilutions of the virus culture supernatant and directly used for the DNA preparation described below. In addition, spiked raw semen samples were centrifuged at 10 000 x g to remove spermatozoa; the supernatant was used for the following manipulations. Viral DNA was prepared by a procedure using Chelex 100 (Walsh et al,, 1991). An aliquot of semen (either 3 ~1, 6 ,ul or 12 111)was incubated at 56°C for 30 min in 220 $1 of a solution containing 5% Chelex 100, 0.5 mg/ml proteinase K and 30 mM DTT. After centrifuging the solution for 10 set, the tubes were placed in a boiling waterbath for 8 min and subsequently spun for 3 min. A 10 ~1 aliquot of the supernatant was used in the PCR reaction. Results PCR
The external primers amplified a 468 bp product and the internal primers a 325 bp fragment of the BHV-1 glycoprotein IV gene. These product sizes were predicted based upon the published gene sequence. After 40 PCR cycles, a predominant 325 bp PCR fragment was visible on an ethidium-bromide stained agarose gel. When high template concentrations (more than 500 TCIDsa) were used, additional bands of the size expected for amplification with the outer primers (468 bp) as well as intermediate products were observed (see lane N,
133
ABCDEF
GHXJKLMNOP
Fig. 1. Detection of BHV-1 in raw (lane A to G) and extended (lane I to M) semen by nested PCR with detection of the PCR products using agarose gel electrophoresis. Lane H and P shows the migration of marker fragments of Hinf I digested Xl74 (Molecular weights [in bp] of: 1353; 1078; 872; 603; 310; 281; 271; 234; 194; 118; 72). Quantities of BHV-1 particles (in TCID,, per 0.5 ml semen) added to the semen were as follows: lane A: 5 x IO’; lane B: 1 x 105;lane C and I: 5 x 104;Lane D and J: 1 x 104; lane E and K: 5 x 10”; lane F and L: 1 x 103; lane G and M: no virus added; Lane N: 500 TCID,, directly added to the PCR; Lane 0: water directly added to the PCR. The arrow marks the size of the PCR fragment expected for ampii~cation with the internal primers.
Fig. 1). The sensitivity of the PCR assay was optimized using DMSO concentrations between 0 and 10% in PCR reactions with 50 to 5000 TCIDse of virus. DMSO at concentrations up to 4% gave a 10 to 100 fold lower sensitivity relative to the sensitivity which was obtained with a DMSO concentration of 8% as judged by ethidium-bromide stained agarose gel electrophoresis (data not shown). The MgCi2 concentration was optimized between 1.5 and 4.5 mM; while 1.5 mM was optimal, higher concentrations produced more non-specific amplification (data not shown). The optimized PCR assay consistently detected at least 45 TCIDse when tested on virus from tissue culture supernatants. The specificity of this assay was tested with approximately 1 x lo2 TCIDJJO BHV-3 from tissue culture supernatant. No PCR product was obtained with this target. Reverse dot-blot hybridization To increase the sensitivity and user-friendliness of this PCR assay, a reversedot-blot format was applied, with the readout being the development of a visual color. For this purpose, 10 PM of digoxigenin-labeled dUTP (at a ratio of 1~10 to dTTP) was included in the PCR reaction so that one PCR product was labeled with about 5 digoxigenin molecules. This format was optimized with regards to dNTP and digoxigenin-dUTP concentrations used in the PCR reaction. Optimal signal to noise ratio was obtained with a dNTP
134
concentration of 2.5 nmol and a digoxigenin-dUTP concentration of 0.25 nmo1/25 ~1 PCR reaction (data not shown). Compared to ethidium-bromide stained agarose gels the reverse dot blot detection method improved the sensitivity of the assay about lo-fold to a detection limit of 4.5 TCIDSO on cell culture supernatant. The color reaction using NBT and X-phosphate needed an incubation time of 6 h to achieve this level of sensitivity. The time needed for completion of the color reaction can be reduced to 1 h through the use of the chemiluminescent substrate LumiPhos (data not shown). A 30 min exposure of the membrane to X-ray film resulted in the same sensitivity as a 6-h incubation of a NBT/X-phosphate color reaction. Detection of BHV-I
in artificially
inoculated extended or raw semen
The applicability of this assay was tested first on extended semen artificially inoculated with BHV-1. Viral DNA from the inoculated semen was prepared by a procedure using Chelex 100 and a 10 ~1 aliquot of this preparation was used in a 25 ~1 PCR reaction. Preliminary experiments showed that 12 ~1 extended semen can be used in the Chelex preparation without causing inhibition in the PCR; this amount of semen was therefore used in the following tests. In the first series of experiments, the sensitivity of this assay was determined on ethidium-bromide stained agarose gels. We were able to detect 1 x lo4 TCIDSO BHV-1 per 0.5 ml extended semen. Since only the equivalent of approximately 0.5 ~1 semen was used in the PCR reaction, this corresy 3nds to a sensitivity of about 10 TCIDso per PCR reaction. Typical results of a nested PCR with detection of the PCR products on an ethidium-bromide stained agarose gel are shown in lanes I to M of Fig. 1. Two bands of PCR amplified DNA in the range of 600 to 800 bp which are consistently present, even in the PCR from uninoculated extended semen, seem to be non-specific amplification products from spermatozoa present in the samples. These non-specific products did not interfere with the subsequent reverse dot-blot. The sensitivity of this assay was improved approximately 2 fold when the PCR products were detected using the reverse dot-blot procedure described above. Therefore, the detection limit was lowered to 5 x lo3 TCID per 0.5 ml extended semen. Fig. 2 shows, in squares B4 to C4, representative results of a reverse dot-blot on a nested PCR with artificially inoculated extended semen samples. A dark spot, which represents a ositive result, is clearly visible for semen samples inoculated with 5 x 10I? to 5 x lo4 TCIDso BHV-1 per 0.5 ml (B4 to C2) while no background is detectable with the uninoculated semen (C4). We also investigated the application of the Chelex procedure and this nested PCR assay for the detection of BHV-1 in artificially inoculated raw semen. Results using raw semen showed that a maximum of 3 ,ul can be used in the Chelex preparation with subsequent use of 5 ~1 of this DNA in the PCR without experiencing PCR inhibition. Consequently, we removed spermatozoa from the raw semen by centrifugation prior to the DNA preparation. This allowed the use of 6 ~1 of the supernatant for the Chelex preparation and 10 ~1
135
A
B
c
D Fig. 2. Detection of BHV-1 in raw (Al to B3) and extended (B4 to C4) semen by nested PCR; detection of the PCR product in a reverse dot-blot format with X-phosphate and NBT as color substrate. Quantities of BHV-I particles (in TCID,, per 0.5 ml semen) added to the semen were as follows: Al: 5 x 105;A2: 1 x IO’; A3 and B4: 5 x 104;A4 and Cl: 1 x 104; Bl and C2: 5 x 103;B2 and C3: 1 x 1tJ3;B3 and C4: no virus added; Dl: water directly added to the PCR; D4: no PCR product spotted on filter.
of this in the PCR without experiencing inhibition. As determined by agarose gel electrophoresis, the sensitivity of the nested PCR was 1 x 105 TCIDse per 0.5 ml raw semen without centrifugation in the DNA preparation, and 5 x lo4 TCID50 if a first centrifugation step was applied. Lanes A to G of Fig. 1 show the results of such a PCR, the positive results for 5 x IO4 TCIDse are represented by a very faint band of 325 bp molecular weight (lane C). In conjunction with a reverse dot-blot format it was possible to improve the sensitivity approximately lo-fold so that 5 x lo3 TCIDSO per 0.5 ml raw semen could be detected (see square Bl in Fig. 2). This level of sensitivity was only reached when the first centrifugation step was included in the DNA preparation. The presence of spermatozoa in the PCR gave rise to a significant amount of non-specific amplification products, which were seen as a smear on ethidium-bromide stained agarose gels. High background was observed when
136
these PCR products were used in the reverse dot-blot, while the small amount of non-specific product in PCR using extended semen did not interfere.
Discussion The transmission of BHV-1 by bovine semen poses a major threat to the artificial insemination industry and to dairy and beef farming. Currently available detection methods for BHV-1 in bovine semen are less than totally satisfactory with regards to sensitivity, time and cost efficiency. PCR based detection systems for BHV-1 have been described by Vilcek (1993) and by Israel et al. (1992). Neither report describes the application of their PCR assay on semen samples and both rely on agarose gel electrophoresis for the detection of the PCR products. The sensitivit of these assays is either not described (Vilcek, 1993) or in the order of 10Y PFU (plaque forming units) per ml in spiked nasal secretions (Israel et al., 1992). We describe here the use of a PCR assay for the detection of BHV-1 in bovine semen. A set of nested primers were designed to target a sequence in the BHV-1 glycoprotein IV gene. The primers were designed so that they would not hybridize to the pseudorabies virus gp50 (Petrovskis et al., 1986) or the herpes simplex virus type 1 gD (Watson et al., 1982) gene. A genebank search revealed that these two are the most related genes to the BHV-1 glycoprotein IV in the herpesvirus group. We have also demonstrated that these primers show no cross hybridization with the closely related BHV-3. The PCR assay was optimized with respect to concentrations of DMSO, MgQ, primers, dNTPs and digoxigenin-dUTP used, to reach the highest possible sensitivity together with a high signal-to-noise ratio. While the contribution of most of these components to PCR performance is well known, the role of DMSO is not completely clear. Masoud et al. (1992) suggest that the effects of DMSO on PCR performance might be related in part to a destabilizing effect on double-stranded DNA, particularly in G + C rich targets. The target region for the PCR described herein has a G + C content of 64% which might explain the beneficial effects of DMSO in the PCR reactions. A sensitivity of 4.5 TCIDsa was achieved when the reverse dot-blot PCR assay was performed on culture supernatant. The modified reverse dot-blot assay allowed a 10 fold increase in sensitivity compared to detection methods using ethidium-bromide stained agarose gels as well as providing a fast, user friendly and cost-efficient format (Bsat and Batt, 1993). We demonstrated the use of a nested PCR assay in conjunction with a fast DNA preparation method utilizing Chelex 100 for the detection of BHV-1 in bovine semen. Previously described methods for the isolation of viral DNA from human semen are time consuming and/or involve the-use of hazardous chemicals and sophisticated equipment (Green et al., 1991; Mermin et al., 1991). The procedure using Chelex 100 was described originally for the preparation of chromosomal DNA from sperm cells (Walsh et al., 1991). These authors found that DNA prepared with this procedure yielded PCR products
137
comparable to that obtained with phenol/chloroform purified DNA, while DNA prepared with water instead of Chelex resulted in less efficient amplification. In our hands this method proved useful as a fast and easy method for the isolation of viral DNA from extended semen samples. This method also prevented PCR inhibition that was observed when semen samples were directly used in a PCR (data not shown). Primary removal of spermatozoa by centrifugation proved necessary when spiked raw semen was used in this DNA preparation method. Direct use of raw semen led to decreased sensitivity in the PCR as well as high background in the reverse dot-blot detection. The disadvantage of the Chelex 100 DNA preparation is that it involves some dilution of the semen sample, therefore allowing only the use of a small equivalent of the original sample in the PCR reaction. Nevertheless, the ease of use and the rapidity of the DNA preparation makes this method an interesting alternative to current costly and laborious procedures. Also the Chelex preparation described now provided in our hands a higher sensitivity for the PCR assay as compared to a previously described preparation method using guanidinium thiocyanate (Boom et al., 1990) (data not shown). The sensitivity of the nested PCR assay described herein is 5 x 10’ TCIDso per 0.5 ml of extended or raw semen. The current ‘gold standard’ for the detection of BHV-I in semen is the Cornell Semen Test that has a sensitivity of 5 x lo3 to 2.5 x lo4 TCIDSO per 0.5 ml semen (Schultz et al., 1982). The combined sensitivity, rapidity and cost effectiveness makes this nested PCR assay an excellent alternative to the Cornell Semen Test for the detection of BHV-1 in semen samples. The PCR test, including DNA preparation and reverse dot-blot, can be completed in about 8 h, while the Cornell Semen Test takes 3 to 5 weeks for serological confirmation. The Cornell Semen Test can be used to screen for a variety of different viral pathogens in bovine semen. These include Bovine Viral Diarrhea Virus (BVDV), Bluetongue-Virus (BTV), Bovine Herpes Mammillitis Virus (BHMV) and Bovine Leukosis Virus (BLV). It might be possible to include PCR primers for the detection of these viruses in a multiplex PCR assay in conjunction with a reverse dot-blot format. Future efforts will also be directed towards increased sensitivity of this method, e.g., through an initial enrichment step using immunomagnetic separation (IMS). The combination of PCR and IMS has already proven useful in some clinical diagnostic assays (Brown and Robertson, 1990; Muir et al., 1993) and also may be promising for the application on semen samples. If such an assay will be applied for routine diagnosis, e.g. tests for imported or exported semen, a suitable control has to be incorporated to exclude false negative results, e.g., due to PCR inhibition. Such a control could involve the spiking of an aliquot of the sample with the lowest detectable amount of pure DNA and subsequently run in parallel with the unspiked sample. Such a test would then have the potential to completely replace the Cornell Semen Test for the detection of viral pathogens in bovine semen. The tests described were carried out on semen samples that were artificially inoculated with BHV- 1. Artilicially inoculated semen is a good model for the
138
situation found usually occurs plasma (Kahrs infected semen procedure.
in naturally infected semen, since natural infection of the semen during ejaculation which results in free virus in the seminal tests on naturally et al., 1977; Straub, 1991). Nevertheless, will have to be performed to prove the effectiveness of this
Acknowledgements This work was supported by grants from the National Association of Animal Breeders (NAAB) and the Cornell Center for Advanced Technology (CAT) in Biotechnology which is sponsored by the New York State Science and Technology Foundation (a consortium of industries, the U.S. Army Research Office and the National Science Foundation), Eastern Artificial Insemination (Ithaca, NY) and Idetek Inc. (Sunnyvale, Ca.) M.W. was supported by a stipend of the Gottlieb Daimler- and Carl Benz-Stiftung (2.92.04). The authors wish to thank Nada*.Bsat and Herb Rycroft (Eastern AI.) for their help.
References Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen, C.L., Wertheim-van Dillen, P.M.E. and van der Noordaa, J. (1990) Rapid and simple method for purification of nucleic acids. J. Clin. Microbial. 28, 4955503. Brown, V.K. and Robertson, B.H. (1990) Immunoselection of clinical specimens containing virus followed by polymerase chain reactor amplification and rapid direct sequencing. BioTechniques 8, 262-264. Bsat, N. and Batt, C.A. (1993) A combined modified reverse dot blot and nested PCR assay for the specific nonradioactive detection of Listeria monocytogenes. Mol. Cell. Probes 17, 1999207. Darcel, C. le Q., Yates, W.D.G. and Mitchell, D. (1977) A technique for the isolation of bovine herpesvirus 1 from bull semen using microtiter plates. Proc. 20th An. Meet. Am. Assoc. Vet. Lab. Diagnost. 2099214. Dinter, Z. and Morein, B. (1990) Virus Infections of Ruminants. Elsevier Science Publishers. Amsterdam. pp. 69970. Drew, T.W., Hewitt-Taylor, C., Watson, L. and Edwards, S. (1987) Effect of storage conditions and culture technique on the isolation of infectious bovine rhinotracheitis virus from bovine semen. Vet. Rec. 121, 5477548. Erlich, H.A., Gelfand D. and Sninsky J.J. (1991) Recent advances in the polymerase chain reaction. Science 252, 1643-l 650. Green, J., Monteiro, E., Bolton, V.N., Sanders, P. and Gibson, P.E. (1991) Detection of human papillomavirus DNA by PCR in semen from patients with and without penile warts. Genitourin. Med. 67, 2077210. Israel, B.A., Herber, R., Gao, Y. and Letchworth III, G.J. (1992) Induction of a mucosal barrier to bovine herpesvirus 1 replication in cattle. Virology 188, 2566264. Kahrs, R.F., Johnson, M.E. and Bender, G.M. (1977) Studies on the detection of infectious bovine rhinotracheitis (IBR) virus in bovine semen. Proc. 20th An. Meet. Am. Assoc. Vet. Lab. Diagnost. 187-208. Masoud, S.A., Johnson, L.B. and White, F.F. (1992) The sequence within two primers influences the optimum concentration of dimethyl sulfoxide in the PCR. PCR Methods Applications 2, 89-90. Mermin, J.H., Holodniy, M., Katzenstein, D.A. and Merigan, T.C. (1991) Detection of the human
139 immunodeliciency virus DNA and RNA in semen by the polymerase chain reaction. J. Infect. Dis. 164, 7699112. Muir, P., Nicholson, F., Jhetam, M., Neogi, S. and Banatvala, J.E. (1993) Rapid diagnosis of enterovirus infection by magnetic bead extraction and polymerase chain reaction detection of enterovirus RNA in clinical specimens. J. Clin. Microbial. 31, 3 I-38. Pastoret, P.-P., Thiery, E., Brochier, B., Derboven, G. and Vindevogel, H. (1984) The role of latency in the epizootiology of infectious bovine rhinotracheitis. In: G. Wittmann, R. Gaskell and H.-J. Rizha (Eds), Latent Herpes Virus Infections in Veterinary Medicine, ed. Martinus Nijhoff Publishers, The Hague, pp. 211-228. Petrovskis, E.A., Timmins, J.G., Armentrout, M.A., Marchioli, CC., Yancey, R.J. Jr. and Post L.E. (1986) DNA sequence of the gene for pseudorabies virus gp50, a glycoprotein without N-linked glycosylation. J. Virol. 59, 216-223. Probst, U., Whyler, R., Khim, U., Ackermann, M., Bruckner, L., Mueller, H.K. and Ehrensperger, F. (1985) Zur IBR-Virus-Ausscheidung experimentell inlizierter Kuehe insbesondere in der Milch. Schweiz. Arch. Tierheilk. 127, 723-733. Schultz, R.D., Adams, L.S., Letchworth, G., Sheffy, B.E., Manning, T. and Bean, B. (1982) A method to test large numbers of bovine semen samples for viral contamination and results of a study using this method. Theriogenol. 17, 115-123. Sheffy, B.E. and Krinsky, M. (1974) IBR in extended bovine semen. Proc. 77th Ann. Meet. US Anim. Health Assoc. 1973, 131-137. Straub, O.C. (1990) Infectious bovine rhinotracheitis virus. In: Z. Dinter and B. Morein (Eds), Virus Infections of Ruminants, Elsevier Science Publishers, Amsterdam, pp. 71-108. Straub, O.C. (1991) BHVI infections: relevance and spread in Eur. Comp. Immunol. Microbial. infect. Dis. 14, 175186. Tikoo, S.K., Fitzpatrick, D.R., Babiuk, L.A. and Zamb, T.J. (1990) Molecular cloning, sequencing, and expression of functional bovine herpesvirus 1 glycoprotein gIV in transfected bovine cells. J. Virol. 64, 5132-5142. Vilcek, S. (1993) Detection of the bovine herpesvirus-l (BHV-I) genome by PCR. J. Virol. Methods 41, 2455248. Walsh, P.S., Metzger, D.A. and Higuchi, R. (1991) Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques IO, 506-513. Watson, R.J., Weis, J.H., Salstrom, J.S. and Enquist, L.W. (1982) Herpes simplex virus type-l glycoprotein D gene: nucleotide sequence and expression in Escherichia coli. Science 218, 381l 384.