- Email: [email protected]
Detection of congenital cytomegalovirus infection by using chorionic villi of the early pregnancy and polymerase chain reaction
Int J Gynecol
Obstet,
International
Federation
1994, 44: 229-231
of Gynecology
229 and Obstetrics
Detection of congenital cytomegalovirus infection by using chorionic villi of the early pregnancy and polymerase chain reaction Z.-W. Dong, C. Yan, W. Yi and Y.-Q. Cui Department
of Genetics,
National
(Received July 2lst, 1993) (Revised and accepted December
Research
Institute
for
Family
Beding
(China)
12th, 1993)
Abstract OBJECTI VE: To detect congenital cytomegalovirus (CMV) infection of chorionic villi in early pregnancy. METHODS: Extraction of DNA of chorionic villi and amplifïcation of the gene of major immediate-early (MIE) antigen of CMV using a polymerase chain reaction (PCR). RESULTS: Sixty-eight specimens of chorionic villi and 16 specimens were positive for CMV infection by PCR. The incidence of congenital CMV infection in theJirst trimester of pregnancy was 23.5% CONCL USIONS: The risk of transmission of CM Vfrom mother to fetus in early pregnancy is very high and potential CMV carriers may transmit CMV to their fetus in early pregnancy.
Keywords: Cytomegalovirus; Chorionic villi; Prenatal reaction; chain Polymerase diagnosis. Introduction Cytomegalovirus (CMV) infection has been found to be the most common congenital virus infection and an important cause of abnormalities [ll. The incidence of congenital CMV infection varies widely, from 0.20% to 2.0% of al1 infants [2]. The risk of transmis0020-7292/94/$07.00 0 1994 International Federation Printed and Published in Ireland
Planning,
sion from mother to fetus is about 30-40% [3]. There were some cases of prenatal diagnosis of congenital CMV infection [4,5] but the incidence of congenital CMV infection early in pregnancy is not clear. Stagno et al. [6] reported that fetuses exposed to CMV in the tïrst half of pregnancy develop significant abnormalities. These results reveal that CMV infection in early pregnancy may be critical for fetal development. We report the results of congenital CMV infection in the first trimester of pregnancy by using chorionic villi sampling and polymerase chain reaction (PCR). Materials and methods Collection of chorionic villi
Specimens of chorionic villi were collected from women attending the antenatal clinic for artitïcial abortion. The gestational ages of these pregnancies were within the fïrst trimester of pregnancy. The specimens of chorionic villi were stored at -20°C. Extraction of DNA of chorionic villi
The protocol of Goosens et al. [7] was modified to extract DNA of chorionic villi. The tissues of chorionic villi were placed in 0.5 ml of TES buffer (15 mmol/l sodium chloride, 15 mmol/l Tris, 15 mmol/l EDTA, pH 8.0), and Article
of Gynecology
and Obstetrics
230
Dong et al.
AB
homogenized at room temperature. The cel1 lysate was digested at 56°C for 3 h with 10 ~1 of 10% SDS and 100 ~1 proteinase K (1 mg/ml stock in distilled water). An equal volume of phenol/chloroform (1: 1) was used to extract DNA. The DNA was precipitated by the addition of 100 ~1 of 3 M sodium acetate and 1 ml of 100% ethanol, and washed with 70% ethanol. The DNA was dried and suspended in TE buffer for gene amplilïcation. Polymerase chain reaction
Oligonucleotide primers (25 mer) were chosen from published sequences [8]. The primers (upstream 5 ’ CCAAGCGGCCTCTGATAACCAAGCC 3 ‘; downstream 5’ CAGCACCATCCTCTTCCTCTGG 3’) were designed to amplify a 435 bp sequence of CMV DNA encoding a portion of the major immediate-early (MIE) antigen of CMV. Gene amplification was done by a thermal cycler (Techne, THC 2). Al1 reactions were performed in 100 ~1 volume with 1 ~1 of Taq DNA polymerase (Promega). Cycling consisted of denaturing at 94°C for 1 min, annealing at 56°C for 30 s, and extension at 70°C for 2 min. Analysis of amplijìcation products
Ten microliters of 6 x gel-loading buffer was added to 10 ~1 aliquots of products of amplification, and gel electrophoresis was performed with 1.5% agarose gel (Sigma) at a current of 100 mA. The DNA was visualized by UV fluorescente after staining with ethidium bromide. pGEM DNA was used as the DNA marker of molecular weight and was included in each gel. A 435 bp band was seen when a positive sample was amplifïed using the MIE primers (Fig. 1). Results and discussion Sixty-eight specimens of chorionic villi were obtained for DNA extraction and gene amplifïcation. Sixteen cases were found to have a specific 435 bp band in the gel of amplifïcation products. The results revealed Int J Gynecol Obstet 44
C
D
E
435bp
Fig. 1. Gel electrophoresis of the amplifïcation products obtained from four samples of chorionic villi. Lane A is a DNA pGEM as size standard. Lanes B and C are two negative samples of chorionic villi. Lanes D and E are two positive samples of chorionic villi. The 43%bp is the CMV amplitïcation product.
that the DNA of CMV was present in these chorionic villi. In this study, the incidence of congenital CMV infection in the lïrst trimester of pregnancy was 23.5%. The result was much higher than the incidence of congenital CMV infection in newborns [9- 111. The findings were close to our previous results [ 121. Kriel et al. [ 131 reported a study of CMV isolation associated with pregnancy wastage and found 5 cases of CMV infections in 59 tissues of pregnancy wastage. Griffrths and Baboonian also pointed out that fetal loss occurred in 4/26 (15%) of early CMV infections [ 141. Our results demonstrated that the risk of transmission of CMV from mother to fetus in early pregnancy is very high. Transmission of CMV is possibly similar to the transmission of HIV-1 in 8-week fetuses [15] and mother-tofetus transmission of hepatitis B virus [ 161. In general, only primary maternal CMV infection is likely to be transmitted to fetuses [9-111. Our Iïndings suggested that potential CMV carriers may transmit CMV virus to their fetus in early pregnancy. Stanier et al.
Detection
[ 171 found persistente of CMV in mononuclear cells in peripheral blood from blood donors and high positive for CMV (25 positive/30 samples) by PCR. These results showed a high rate of potential CMV infection in the population. In our study, the rate of CMV Ig-M is 5.6%, but the incidence of congenital CMV infection of chorionic villi in early pregnancy was 23.5%. There may be some potential CMV carriers whose CMV Ig-M were not detectable. The technique of PCR is a very sensitive and rapid method for the detection of CMV and it could be developed as a suitable method for prenatal diagnosis of congenital CMV infection in the first trimester of pregnancy by chorionic villus samplng.
7
infection
231
cytomegalovirus infection in pregnancy : lncidence, transmission to fetus, and clinical outcome. J Am Med Assoc 256: 1904, 1986. Goosens M, Dumez Y, Kaplan L, Lupker M, Chabret C, Henrion R, Rose J: Prenatal diagnosis of sickle cel1 anemia in the Iïrst trimester of pregnancy. N Eng J Med 309: 831, 1983. Demmler GJ, Buffone GJ, Schimbor CM, May RA: Detection of cytomegalovirus in urine from newborn by using polymerase chain reaction DNA amplilïcation. J Infect Dis 158: 1177, 1988.
9
Nankervis GA, Kumar ML, Cox FE, Gold E: A prospective study of maternal cytomegalovirus infection and its effect on the fetus. Am J Obstet Gynecol 149: 435, 1984. Griffiths PD, Baboonian C, Rutter D, Peckham C: Congenital and maternal cytomegalovirus infection in a London population. Br J Obstet Gynecol 98: 145, 1991. He-yu Hi, yong-nan Zhang, Yun-zhe Gong: Detection of active cytomegalovirus infection in pregnant women. J Microbiol Virol (China) 2: 116, 1990. Zhao-wen Dong, Ying-qi Cui, and Yu-lan Long: A study on the congenital cytomegalovirus infection by using chorionic villi of the early pregnancy. Hereditas (Beijing)
10
11
Acknowledgment 13
14
References 15 Yow MD: Congenital cytomegalovirus disease: A now problem. J Infect Dis 159: 163, 1989. Peckham CS, Coleman JC, Hurley R, Chin KS, Henderson K, Preece PM: Cytomegalovirus infection in pregnancy: Preliminary lïndings from a prospective study. Lancet i: 1352, 1983. Yow MD, Daniel WW, Leroy JL, Peter T, Rell MW, Bethann FW, Jerry WL, Howard RS, Griffiths PD: Epidemiologic characteristics of cytomegalovirus infection in mothers and their infants. Am J Obstet Gynecol 158: 1189, 1988. Hohlfeid P, Vial Y, Maillard-Brignon C, Vaudaux B, Fawer C: Cytomegalovirus fetal infection: Prenatal diagnosis. Obstet Gynecol 78: 615, 1992. Lamy ME, Mulongo KN. Gadisseux J-F, Lyon G, Gaudy V, Lierde MV: Prenatal diagnosis of fetal cytomegalovirus infection. Am J Obstet Gynecol 166: 91, 1992. Stagno S, Pass RF, Cloud G, Britt WJ, Henderson RE, Watton PD, Vern DA, Page F, Alford CA: Primary
cytomegalovirus
8
12
We thank the Institute of Virology, Academia of Medicine of China for providing the CMV strain.
of congenital
16
17
2: 40, 1992. Kriel RL, Gates GA, Wulff H, Powell N, Poland JD, Chin TY: Cytomegalovirus isolation associated with pregnancy wastage. Am J Obstet Gynecol 106: 885, 1970. Griffiths PD, Baboonian C: A prospective study of primary cytomegalovirus infection during pregnancy: fmal report. Br J Obstet Gynecol 91: 307, 1992. Lewis SH, Reynlds-Kohler C, Fox HE, Nelson JA: HIV-I in trophoblastic and villous hofbauer cells, and hematological precursors in eight-week fetuses. Lancet ic 565, 1990. Lee AKY, i.p. HMH, Wong VCW: Mechanism of maternal-fetal transmission of hepatitis B virus. J Infect Dis 136: 668, 1978. Stanier P, Taylor DL, Kitchen AD, Wales N, Tryhorn Y, Tyms AS: Persistente of cytomegalovirus in mononuclear cells in peripheral blood from blood donors. B Med J 299: 897, 1989.
Address for reprints: GW.
Dong
Department of Genetics National Research Institute for Family Planning No. 12 Dahiusi Reijing China
Article
Obstet,
International
Federation
1994, 44: 229-231
of Gynecology
229 and Obstetrics
Detection of congenital cytomegalovirus infection by using chorionic villi of the early pregnancy and polymerase chain reaction Z.-W. Dong, C. Yan, W. Yi and Y.-Q. Cui Department
of Genetics,
National
(Received July 2lst, 1993) (Revised and accepted December
Research
Institute
for
Family
Beding
(China)
12th, 1993)
Abstract OBJECTI VE: To detect congenital cytomegalovirus (CMV) infection of chorionic villi in early pregnancy. METHODS: Extraction of DNA of chorionic villi and amplifïcation of the gene of major immediate-early (MIE) antigen of CMV using a polymerase chain reaction (PCR). RESULTS: Sixty-eight specimens of chorionic villi and 16 specimens were positive for CMV infection by PCR. The incidence of congenital CMV infection in theJirst trimester of pregnancy was 23.5% CONCL USIONS: The risk of transmission of CM Vfrom mother to fetus in early pregnancy is very high and potential CMV carriers may transmit CMV to their fetus in early pregnancy.
Keywords: Cytomegalovirus; Chorionic villi; Prenatal reaction; chain Polymerase diagnosis. Introduction Cytomegalovirus (CMV) infection has been found to be the most common congenital virus infection and an important cause of abnormalities [ll. The incidence of congenital CMV infection varies widely, from 0.20% to 2.0% of al1 infants [2]. The risk of transmis0020-7292/94/$07.00 0 1994 International Federation Printed and Published in Ireland
Planning,
sion from mother to fetus is about 30-40% [3]. There were some cases of prenatal diagnosis of congenital CMV infection [4,5] but the incidence of congenital CMV infection early in pregnancy is not clear. Stagno et al. [6] reported that fetuses exposed to CMV in the tïrst half of pregnancy develop significant abnormalities. These results reveal that CMV infection in early pregnancy may be critical for fetal development. We report the results of congenital CMV infection in the first trimester of pregnancy by using chorionic villi sampling and polymerase chain reaction (PCR). Materials and methods Collection of chorionic villi
Specimens of chorionic villi were collected from women attending the antenatal clinic for artitïcial abortion. The gestational ages of these pregnancies were within the fïrst trimester of pregnancy. The specimens of chorionic villi were stored at -20°C. Extraction of DNA of chorionic villi
The protocol of Goosens et al. [7] was modified to extract DNA of chorionic villi. The tissues of chorionic villi were placed in 0.5 ml of TES buffer (15 mmol/l sodium chloride, 15 mmol/l Tris, 15 mmol/l EDTA, pH 8.0), and Article
of Gynecology
and Obstetrics
230
Dong et al.
AB
homogenized at room temperature. The cel1 lysate was digested at 56°C for 3 h with 10 ~1 of 10% SDS and 100 ~1 proteinase K (1 mg/ml stock in distilled water). An equal volume of phenol/chloroform (1: 1) was used to extract DNA. The DNA was precipitated by the addition of 100 ~1 of 3 M sodium acetate and 1 ml of 100% ethanol, and washed with 70% ethanol. The DNA was dried and suspended in TE buffer for gene amplilïcation. Polymerase chain reaction
Oligonucleotide primers (25 mer) were chosen from published sequences [8]. The primers (upstream 5 ’ CCAAGCGGCCTCTGATAACCAAGCC 3 ‘; downstream 5’ CAGCACCATCCTCTTCCTCTGG 3’) were designed to amplify a 435 bp sequence of CMV DNA encoding a portion of the major immediate-early (MIE) antigen of CMV. Gene amplification was done by a thermal cycler (Techne, THC 2). Al1 reactions were performed in 100 ~1 volume with 1 ~1 of Taq DNA polymerase (Promega). Cycling consisted of denaturing at 94°C for 1 min, annealing at 56°C for 30 s, and extension at 70°C for 2 min. Analysis of amplijìcation products
Ten microliters of 6 x gel-loading buffer was added to 10 ~1 aliquots of products of amplification, and gel electrophoresis was performed with 1.5% agarose gel (Sigma) at a current of 100 mA. The DNA was visualized by UV fluorescente after staining with ethidium bromide. pGEM DNA was used as the DNA marker of molecular weight and was included in each gel. A 435 bp band was seen when a positive sample was amplifïed using the MIE primers (Fig. 1). Results and discussion Sixty-eight specimens of chorionic villi were obtained for DNA extraction and gene amplifïcation. Sixteen cases were found to have a specific 435 bp band in the gel of amplifïcation products. The results revealed Int J Gynecol Obstet 44
C
D
E
435bp
Fig. 1. Gel electrophoresis of the amplifïcation products obtained from four samples of chorionic villi. Lane A is a DNA pGEM as size standard. Lanes B and C are two negative samples of chorionic villi. Lanes D and E are two positive samples of chorionic villi. The 43%bp is the CMV amplitïcation product.
that the DNA of CMV was present in these chorionic villi. In this study, the incidence of congenital CMV infection in the lïrst trimester of pregnancy was 23.5%. The result was much higher than the incidence of congenital CMV infection in newborns [9- 111. The findings were close to our previous results [ 121. Kriel et al. [ 131 reported a study of CMV isolation associated with pregnancy wastage and found 5 cases of CMV infections in 59 tissues of pregnancy wastage. Griffrths and Baboonian also pointed out that fetal loss occurred in 4/26 (15%) of early CMV infections [ 141. Our results demonstrated that the risk of transmission of CMV from mother to fetus in early pregnancy is very high. Transmission of CMV is possibly similar to the transmission of HIV-1 in 8-week fetuses [15] and mother-tofetus transmission of hepatitis B virus [ 161. In general, only primary maternal CMV infection is likely to be transmitted to fetuses [9-111. Our Iïndings suggested that potential CMV carriers may transmit CMV virus to their fetus in early pregnancy. Stanier et al.
Detection
[ 171 found persistente of CMV in mononuclear cells in peripheral blood from blood donors and high positive for CMV (25 positive/30 samples) by PCR. These results showed a high rate of potential CMV infection in the population. In our study, the rate of CMV Ig-M is 5.6%, but the incidence of congenital CMV infection of chorionic villi in early pregnancy was 23.5%. There may be some potential CMV carriers whose CMV Ig-M were not detectable. The technique of PCR is a very sensitive and rapid method for the detection of CMV and it could be developed as a suitable method for prenatal diagnosis of congenital CMV infection in the first trimester of pregnancy by chorionic villus samplng.
7
infection
231
cytomegalovirus infection in pregnancy : lncidence, transmission to fetus, and clinical outcome. J Am Med Assoc 256: 1904, 1986. Goosens M, Dumez Y, Kaplan L, Lupker M, Chabret C, Henrion R, Rose J: Prenatal diagnosis of sickle cel1 anemia in the Iïrst trimester of pregnancy. N Eng J Med 309: 831, 1983. Demmler GJ, Buffone GJ, Schimbor CM, May RA: Detection of cytomegalovirus in urine from newborn by using polymerase chain reaction DNA amplilïcation. J Infect Dis 158: 1177, 1988.
9
Nankervis GA, Kumar ML, Cox FE, Gold E: A prospective study of maternal cytomegalovirus infection and its effect on the fetus. Am J Obstet Gynecol 149: 435, 1984. Griffiths PD, Baboonian C, Rutter D, Peckham C: Congenital and maternal cytomegalovirus infection in a London population. Br J Obstet Gynecol 98: 145, 1991. He-yu Hi, yong-nan Zhang, Yun-zhe Gong: Detection of active cytomegalovirus infection in pregnant women. J Microbiol Virol (China) 2: 116, 1990. Zhao-wen Dong, Ying-qi Cui, and Yu-lan Long: A study on the congenital cytomegalovirus infection by using chorionic villi of the early pregnancy. Hereditas (Beijing)
10
11
Acknowledgment 13
14
References 15 Yow MD: Congenital cytomegalovirus disease: A now problem. J Infect Dis 159: 163, 1989. Peckham CS, Coleman JC, Hurley R, Chin KS, Henderson K, Preece PM: Cytomegalovirus infection in pregnancy: Preliminary lïndings from a prospective study. Lancet i: 1352, 1983. Yow MD, Daniel WW, Leroy JL, Peter T, Rell MW, Bethann FW, Jerry WL, Howard RS, Griffiths PD: Epidemiologic characteristics of cytomegalovirus infection in mothers and their infants. Am J Obstet Gynecol 158: 1189, 1988. Hohlfeid P, Vial Y, Maillard-Brignon C, Vaudaux B, Fawer C: Cytomegalovirus fetal infection: Prenatal diagnosis. Obstet Gynecol 78: 615, 1992. Lamy ME, Mulongo KN. Gadisseux J-F, Lyon G, Gaudy V, Lierde MV: Prenatal diagnosis of fetal cytomegalovirus infection. Am J Obstet Gynecol 166: 91, 1992. Stagno S, Pass RF, Cloud G, Britt WJ, Henderson RE, Watton PD, Vern DA, Page F, Alford CA: Primary
cytomegalovirus
8
12
We thank the Institute of Virology, Academia of Medicine of China for providing the CMV strain.
of congenital
16
17
2: 40, 1992. Kriel RL, Gates GA, Wulff H, Powell N, Poland JD, Chin TY: Cytomegalovirus isolation associated with pregnancy wastage. Am J Obstet Gynecol 106: 885, 1970. Griffiths PD, Baboonian C: A prospective study of primary cytomegalovirus infection during pregnancy: fmal report. Br J Obstet Gynecol 91: 307, 1992. Lewis SH, Reynlds-Kohler C, Fox HE, Nelson JA: HIV-I in trophoblastic and villous hofbauer cells, and hematological precursors in eight-week fetuses. Lancet ic 565, 1990. Lee AKY, i.p. HMH, Wong VCW: Mechanism of maternal-fetal transmission of hepatitis B virus. J Infect Dis 136: 668, 1978. Stanier P, Taylor DL, Kitchen AD, Wales N, Tryhorn Y, Tyms AS: Persistente of cytomegalovirus in mononuclear cells in peripheral blood from blood donors. B Med J 299: 897, 1989.
Address for reprints: GW.
Dong
Department of Genetics National Research Institute for Family Planning No. 12 Dahiusi Reijing China
Article