- Email: [email protected]
Detection of enterohaemorrhagic Escherichia coli in patients attending hospital in Melbourne, Australia
Pathology (August 2004) 36(4), pp. 345–351
MICROBIOLOGY
Detection of enterohaemorrhagic Escherichia coli in patients attending hospital in Melbourne, Australia VICKI R. BENNETT-WOOD*, JACINTA RUSSELL*, ANNE-MARIE BORDUN*, PAUL D. R. JOHNSON{ AND ROY M. ROBINS-BROWNE* *Department of Microbiology and Immunology, University of Melbourne, and Royal Children’s Hospital and Murdoch Childrens Research Institute, Parkville and {Department of Infectious Diseases, Austin Hospital, Heidelberg, Victoria, Australia
Summary Aims: The objectives of this study were (i) to determine the prevalence of enterohaemorrhagic Escherichia coli (EHEC) in adults and children with diarrhoea attending hospital in Melbourne, and (ii) to evaluate diagnostic assays for the detection of EHEC. Methods: EHEC were sought in 860 faecal samples (655 from children) using direct plating, a cytotoxicity assay and an enzyme immunoassay for Shiga toxin (Stx), and PCR for virulence-associated genes of EHEC. Results: EHEC were isolated from 14 of 858 (1.6%) faecal samples (excluding repeat isolates from one patient). Isolation rates in children (1.7%) and adults (1.5%) were similar. EHEC was detected 2.5 times more frequently in samples that contained blood, but this was not statistically significant. EHEC isolates were heterogeneous in terms of serotype and virulence profile, although all produced EHEC haemolysin. Of the screening assays used, direct plating on EHEC agar, assays for Stx in MacConkey broth inoculated with faeces, and detection of the genes for Stx and EHEC haemolysin were highly sensitive and specific. Conclusions: EHEC are an infrequent cause of diarrhoea in Melbourne. EHEC can readily be isolated from faeces by screening enrichment broth cultures for Stx using PCR or enzyme immunoassay, followed by isolation of the bacteria on EHEC agar. Key words: Diagnostic tests, diarrhoea, diarrhea, Escherichia coli, enterohaemorrhagic E. coli, enterohemorrhagic E. coli, Shiga toxin. Received 23 January, revised and accepted 31 March 2004
INTRODUCTION Enterohaemorrhagic strains of Escherichia coli (EHEC) are important emerging food-borne pathogens. These bacteria were first recognised as the cause of outbreaks of haemorrhagic colitis associated with the consumption of undercooked hamburgers from fast food restaurants in the USA.1 Identification of E. coli as the cause of these outbreaks was facilitated by the fact that the aetiological agents belonged to a rare serotype, namely, O157:H7. Shortly after this seminal discovery, Karmali et al.2 reported an association between infection with cytotoxin-producing strains of E. coli (subsequently shown to be EHEC) and the development of the haemolytic uraemic syndrome
(HUS). Today, EHEC are recognised as the leading cause of haemorrhagic colitis and HUS, and an important cause of non-specific diarrhoea in many industrialised countries worldwide.3 The cytotoxin which characterises EHEC was first identified in E. coli by Konowalchuk et al.,4 and is termed Verotoxin (VT), because of its toxicity for Vero (African green monkey kidney) tissue culture cells. One variety of VT, namely VT-1, is nearly identical to Shiga toxin (Stx), which is the cytotoxin, enterotoxin and neurotoxin produced by strains of Shigella dysenteriae type I,5 and evidently is responsible for the high virulence of these bacteria compared with other varieties of Shigella species. In EHEC, VT-1/Stx-1 is encoded by a lysogenic, lambdoid bacteriophage.6 The toxin binds to globoceremides on the surface of susceptible cells, mainly endothelial cells of small blood vessels supplying the intestine, kidney, pancreas, heart and brain, to induce intravascular coagulation, haemolysis, the consumption of platelets, and end organ damage.7,8 VT-2/Stx-2 is approximately 55% homologous to Stx-1 and shares its mechanism of action, although it is antigenically distinct. These toxins are the key factors required by EHEC to cause haemorrhagic colitis and HUS. In addition to Stx, typical strains of EHEC carry one or more accessory virulence determinant. Amongst these is a chromosomal locus for enterocyte effacement, which encodes a number of factors that facilitate bacterial adhesion to the intestinal mucosa.9 One of these adhesins is an outer membrane protein termed intimin, which is encoded by the eae gene. Many EHEC strains also carry a large plasmid that encodes, amongst other things, a characteristic haemolysin known as enterohaemolysin or EHEC haemolysin.10 This toxin is distinguished from the far more prevalent a-haemolysin that is expressed by many commensal strains of E. coli by the facts that activity of EHEC haemolysin in vitro is inhibited by serum and its haemolytic action is slower than that of a-haemolysin.11 The detection of EHEC in faeces poses a challenge for clinical microbiology laboratories. Key issues concerning their detection include the need to distinguish EHEC from commensal varieties of E. coli, and the fact that the number of EHEC in faeces tends to fall steadily from the commencement of the illness,12,13 so that by the time a patient develops HUS, fewer than 1% of E. coli isolated from faeces may be EHEC.14 Many laboratories employ
ISSN 0031-3025 printed/ISSN 1465–3931 # 2004 Royal College of Pathologists of Australasia DOI: 10.1080/00313020410001721591
346
Pathology (2004), 36(4), August
BENNETT-WOOD et al.
sorbitol MacConkey agar (SMAC) as a selective and indicator medium for the primary isolation of EHEC from faeces. This medium takes advantage of the fact that most clinical isolates of E. coli O157 (but generally not other O-serogroups) do not ferment sorbitol.15 Accordingly, SMAC is not useful for the detection of non-O157 strains. This limitation of SMAC is particularly important in Australia where most isolates of EHEC from cases of HUS belong to serogroups other than O157,16 and are indistinguishable from commensal strains of E. coli when grown on SMAC. Another distinctive biochemical feature of EHEC O157 is the inability to produce b-D-glucuronidase.17 This property has spawned a variety of diagnostic media containing chromogenic substrates for this enzyme, but these suffer from the same limitations as SMAC. On the other hand, enterohaemolysin agar, also known as EHEC agar, is a medium which relies on the ability of most EHEC strains to produce EHEC haemolysin and hence is not specific for O157 strains.18 However, EHEC agar is likely to be less sensitive and less specific than SMAC and similar media because it lacks their selective properties and because of potential difficulties in distinguishing bacteria which produce EHEC haemolysin from those that secrete a-haemolysin. Other methods to detect EHEC in faeces include direct detection of Stx by enzyme immunoassay or, more laboriously, by direct examination of faeces for the presence of specific cytotoxins.19 The presence of EHEC can also be inferred by using PCR amplification to detect the genes which encode Stx, together with those for accessory virulence-associated determinants, such as intimin and EHEC haemolysin.20 To determine the prevalence of EHEC in Melbourne, and to evaluate the relative merits of the diagnostic techniques for EHEC in a clinical setting, we utilised direct plating, a cytotoxicity assay and a commercial enzyme immunoassay (EIA) for Stx, and PCR to investigate the prevalence of EHEC in patients attending two hospitals in Melbourne.
MATERIALS AND METHODS Study design Two separate studies were performed. Study 1 was conducted at the Royal Children’s Hospital, Melbourne, for 12 months from mid-February 1997. Faecal samples from children that were submitted to the hospital’s diagnostic laboratory were investigated for the presence of EHEC if the specimen was received on a weekday morning, was obviously loose and contained red blood cells on macroscopic or microscopic examination. The reasons for applying these selection criteria were to limit the samples to a number that could reasonably be examined by one person during the course of this study, and to increase the chances of finding EHEC, which are reported to be more common in faecal samples which contain blood.21 Study 2 was undertaken for 12 months starting in August 1998, and included specimens from both the Royal Children’s Hospital and the Monash Medical Centre. The latter is a tertiary general hospital which caters mostly for adult patients. The selection criteria for this study were similar to those for Study 1 except that for each sample containing blood, a matching diarrhoeic sample that was free of blood and received in the laboratory around the same time as the blood-containing sample was also examined for EHEC.
Processing of samples In Study 1, a sample of faeces was examined for Stx using a cytotoxicity assay and a commercial EIA, as described below. A portion of faeces was also plated on MacConkey and enterohaemolysin agar (EHEC agar) plates (Oxoid, UK). After overnight incubation of the MacConkey agar plate in air at 37‡C, a sterile cotton swab was used to transfer the growth from each plate into Luria broth containing 30% (v/v) glycerol, which was then frozen at 270‡C until required. Whenever a faecal sample gave a positive result in the cytotoxicity assay or the EIA, the corresponding stored sample was subcultured up to five times on agar so that individual Stx-producing strains of E. coli (STEC) could be isolated and characterised. Samples from which STEC were not isolated were deemed to be negative for EHEC. For the purposes of statistical analysis, only the results of the initial plating were taken into account. EHEC agar plates inoculated with the original faecal sample were incubated in air overnight at 37‡C and examined for the presence of haemolytic colonies, which were then picked off and plated onto fresh EHEC agar plates. The latter were incubated at 37‡C and examined for haemolytic colonies after 3 and 24 h. Individual haemolytic colonies were examined for the production of Stx in the cytotoxicity assay and EIA. Isolates that were positive in this assay, and all those which showed delayed haemolysis (negative at 3 h and positive at 24 h) were also investigated by PCR for the presence of genes encoding Stx (stx), intimin (eae) and EHEC haemolysin (ehxA) after subculture in broth as described below. For Study 2, samples were plated on EHEC and MacConkey agar as for Study 1, but instead of assaying for Stx in faeces directly, a sample of faeces was inoculated into 5 mL MacConkey broth (Oxoid). The broth was incubated with shaking at 37‡C overnight, after which a portion of the culture was assayed for Stx in cell culture and by EIA. Bacteria which grew in the MacConkey broth were also examined by PCR for stx, eae, and hlxA. In both studies, E. coli strains that produced Stx and were positive for either eae or hlxA were classified as EHEC, whereas strains that were positive for Stx and negative for both eae and hlxA were classified as nonEHEC STEC. Serotyping of EHEC isolates obtained during the course of both studies was performed by Dr K. A. Bettelheim, Microbiological Diagnostic Unit, Department of Microbiology and Immunology, University of Melbourne.22 Assays for Stx Stx was assayed in an Stx-susceptible line of HeLa cells (kindly provided by Professor A. D. O’Brien, Uniformed Services University of the Health Services, Bethesda, MD, USA23) and by using a commercially available assay (Premier EHEC; Meridian Diagnostics, USA) in accordance with the manufacturer’s directions. Premier EHEC is an EIA which utilises monoclonal anti-Stx antibodies adsorbed to microtitre wells to capture Stx and a polyclonal anti-Stx antibody to detect bound toxin. For the HeLa cell assay, a portion of the test sample was mixed in an equal volume of phosphate-buffered saline (PBS), pH 7.4, and clarified by centrifugation and filtration through a 0.45-mm pore-size filter (Millipore, USA). For the Stx assay on pure cultures of E. coli, bacteria were grown in Penassay broth (Antibiotic Medium no. 3; Difco Laboratories, USA) with shaking at 37‡C overnight, and then pelleted by centrifugation and filtration. Forty mL of each test sample were added to 160 mL of minimal Eagle’s medium (MEM; Invitrogen, USA) in duplicate wells of a 96-well, flat-bottomed microtitre tray (Nunc, Denmark), containing a semiconfluent layer of HeLa cells. This was incubated for 40 min, after which the medium was replaced with fresh MEM and incubated at 37‡C in air supplemented with 5% CO2. Cells were observed daily for up to 4 days for evidence of characteristic cytotoxic damage. PCR methods One mL of MacConkey broth (from Study 2), or pure bacterial culture in Luria broth, was centrifuged for 5 min to pellet the bacteria. The supernatant was removed and the pellet was washed in 1 mL of PBS, resuspended in 200 mL sterile distilled water, and heated for 10 min at
ENTEROHAEMORRHAGIC E. COLI
100‡C. Samples were then placed on ice for 5 min and re-centrifuged for 5 min in a microcentrifuge at 12 0006g. Twenty-mL aliquots of the supernatant were diluted 1:10 in 180 mL distilled water. PCR amplifications were performed in a Gene Amp PCR System 9700 thermal cycler (Applied Biosystems, USA) with AmpliTaq Gold polymerase (Applied Biosystems), in a reaction volume of 50 mL, using the primers listed in Table 1. The conditions for the stx1/stx2 duplex PCR involved denaturation of template DNA for 10 min at 95‡C, followed by 35 cycles of 30 s at 95‡C, 1 min at 52‡C and 1 min at 72‡C, and a final extension period of 8 min at 72‡C. The conditions for eae/ehxA PCR involved denaturation of template DNA for 10 min at 95‡C, followed by 30 cycles of 30 s at 95‡C, 90 s at 54‡C and 90 s at 72‡C, and a final extension period of 8 min at 72‡C. At the conclusion of both PCRs, 10 mL of the reaction mixture were electrophoresed on 2.5% (w/v) agarose gels. Gels were stained with ethidium bromide, visualised on a UV transilluminator and photographed. A portion of the PCR product was retained for Southern blotting which was performed using capillary transfer of separated DNA fragments onto positively charged nylon membranes (Roche Diagnostics, UK).24 Digoxigenin-labelled DNA probes were prepared by PCR (Roche Diagnostics) from EHEC control strain, EDL933,25 using the PCR primers listed in Table 1. The integrity of the probes was determined by nucleotide sequencing, using an ABI PRISM Big Dye Terminators v3.0 Cycle Sequencing Kit and an ABI PRISM 377 DNA sequencer (Applied Biosystems). Probes were hybridised overnight under conditions of high stringency at 65‡C and detected using chemiluminescence as recommended by the manufacturer (Roche Diagnostics). Statistical analysis Statistical analysis of quantitative and qualitative data was performed using InStat version 3.0 (GraphPad Software Inc., USA).
RESULTS Isolation of EHEC During the 12-month period from mid-February 1997 to mid-February 1998 (Study 1), 203 samples from children were investigated, nine (4.4%) of which yielded EHEC. Two of the EHEC-positive patients were diagnosed with HUS; in the others the primary diagnosis was diarrhoea. During Study 2, 657 samples were examined, 452 of which were from children. Seven (1.1%) of the 657 samples were positive for EHEC, including four from children. Three of the paediatric samples were from the same patient. There were 330 samples (226 from children) which contained blood on macroscopic or microscopic examination. Five (1.5%) of these yielded EHEC, compared with two (0.6%) from the 327 samples without blood (relative rate, 2.5; 95% confidence interval [CI], 0.5–12.7), but the difference
TABLE 1 Characteristics of the PCR primers used to detect EHEC (adapted from Paton and Paton20) Gene or virulence factor Primer* eae ehxA stx1 stx2
1a 2a 1a 2a 1b 2b 1b 2b
Primer sequence (5’ to 3’)
Product size (bp)
GACCCGGCACAAGCATAAGC CCACCTGCAGCAACAAGAGG GCATCATCAAGCGTACGTTCC AATGAGCCAAGCTGGTTAAGCT ATAAATCGCCATTCGTTGACTAC AGAACGCCCACTGAGATCATC GGCACTGTCTGAAACTGCTCC TCGCCAGTTATCTGACATTCTG
*Primers with the same superscript were detected in duplex PCRs.
384 534 180 255
347
between the two groups was not significant (Pw0.4, Fisher’s exact test). Characteristics of EHEC isolates The characteristics of the 14 unique EHEC strains isolated during the course of both studies are summarised in Table 2. Seven produced both Stx-1 and Stx-2, four produced only Stx-1 and three produced only Stx-2. All 14 strains were positive for EHEC haemolysin, but only 11 carried the eae gene. The O-serogroups of the isolates also varied and included five that were O157, four of serogroup O26, two of O111, and one each of O1 and O113. In addition, one strain was O-non-typable indicating that it did not react with any of the available O-typing sera (O1– O181). All five of the O157 strains were non-motile.
Evaluation of methods to detect EHEC Direct plating on EHEC agar In Study 1, 65 of 203 (32%) samples yielded haemolytic colonies on EHEC agar after overnight incubation. Of these, eight (12%) exhibited delayed haemolysis indicative of EHEC haemolysin. All eight of these isolates were positive in the PCR for ehxA and stx, and hence met the criteria for classification as EHEC. One of the 57 isolates that showed rapid haemolysis (haemolysis after 3 hours) also produced Stx and carried ehxA. This strain was negative in a PCR for a-haemolysin (data not shown), and was regarded as a ‘false-negative’ result for the purposes of statistical analysis. In Study 2, all seven EHEC isolates were identified by two-step plating on EHEC agar. Three other samples yielded colonies which showed delayed haemolysis, but were negative in the PCR for ehxA and stx, and in the cytotoxicity assay for Stx. These three isolates were regarded as ‘false-positive’ results. One isolate that showed delayed haemolysis on EHEC agar was positive in the PCR for ehxA and eae, but was negative in all tests for Stx, and hence was not EHEC.
TABLE 2 study
Characteristics of the 14 EHEC isolates identified in this
Presence of virulence-associated factors Month and year of isolation Source Serotype May 1997 Sep 1997 Oct 1997 Oct 1997 Dec 1997 Dec 1997 Dec 1997 Jan 1998 Feb 1998 Feb 1999 Feb 1999 Mar 1999 Mar 1999 Mar 1999
C, C, C, C, C, C, C, C, C, C, A, A, C, A,
D H D H D D D D D D D D D D
O157:H– Ont:H7 O157:H– O113:H21 O26:H11 O111:H– O26:H11 O26:H11 O26:H11 O111:H– O157:H– O157:H– O1:H7 O157:H–
Stx-1
Stx-2
Intimin
EHEC haemolysin
z 2 z 2 z z z z z z z z 2 z
z z z z 2 z 2 2 2 z z z z z
z 2 z 2 z z z z z z z z 2 z
z z z z z z z z z z z z z z
A, adult; C, child; D, diarrhoea; H, haemolytic ureamic syndrome; Ont, O non-typable (O1–O181); z, present; 2, absent.
348
Pathology (2004), 36(4), August
BENNETT-WOOD et al.
Detection of Stx EIA In Study 1, where faeces were assayed for Stx directly, 13 of 203 samples gave a positive or equivocal result in the EIA. These samples included seven that were subsequently confirmed to contain EHEC, and six that did not. One of the latter was positive when investigated in a PCR for stx1, indicating that the EIA result was probably correct, although EHEC was not isolated from this sample and PCRs for stx2, eae and ehxA were all negative. Five EIA-positive samples were negative in the HeLa cell assay and in PCRs for stx1, stx2, eae and ehxA, and were classified as ‘false-positives’. Two samples which yielded EHEC on culture were negative in the EIA screen that was performed on faeces. However, individual EHEC colonies from these samples were positive when re-tested in the same assay. In Study 2, where samples were pre-enriched by growth in MacConkey broth before being assayed for Stx, all seven samples which subsequently yielded EHEC were positive in the EIA. Another six samples that were positive when first tested with this assay, were negative when retested, and were also negative in the PCR for stx and the HeLa cell assay for Stx. An additional sample that was positive in the EIA screen was positive in the PCR for stx and assay for Stx, but no EHEC were isolated from this sample. The PCR on this sample for eae and ehxA was negative, indicating that it probably contained an Stx-producing strain that was not a typical EHEC (i.e., positive for either eae or ehxA). As the strain was not cultured, however, this could not be confirmed. Cytotoxicity assay In Study 1, five of nine samples which subsequently yielded EHEC were positive in the screening assay for Stx, using toxicity for HeLa cells as the read out. One ‘false-positive’ reaction was obtained. In Study 2, all seven samples which ultimately yielded EHEC were positive in the screening assay for Stx. Three samples from which EHEC were not isolated were also positive in the screening assay. One of these was also positive in the EIA for Stx (as indicated above), but the other two were negative in all other assays.
TABLE 3
Screening of samples by PCR In Study 2, where PCR was used to screen samples, seven positive results were obtained for stx. All of these were confirmed by Southern blotting and in the HeLa cell assay for Stx. Twelve positive results were obtained in the PCR for eae. Six of these were also positive for stx and confirmed as EHEC. Of eight samples that were positive in the PCR for ehxA, seven were confirmed as EHEC, and one was identified as ehxA and eae positive but was negative for Stx, and therefore was classified as a ‘falsepositive’ result in terms of EHEC detection. A comparison of the sensitivity and specificity of the various screening assays is provided in Table 3.
DISCUSSION EHEC is a major food-borne pathogen in the industrialised countries of the Northern Hemisphere and an emerging cause of diarrhoea and HUS in some less developed countries. Nevertheless, data pertaining to the burden of disease attributable to EHEC are unreliable, largely because the frequency of EHEC diagnosis is influenced by a considerable number of variables, including the likelihood of patients seeking medical attention for diarrhoea, the probability that an appropriate sample will be collected and submitted for laboratory examination, and the fact that many laboratories do not include diagnosis of EHEC in their standard procedures, or if they do, they may use insensitive techniques. For these reasons, intensive studies of outbreaks of food poisoning, and occasional surveys of the prevalence of EHEC in patients with endemic diarrhoea or HUS are likely to provide the best indication of the contribution of EHEC to the overall burden of disease. Studies of the prevalence of EHEC that have been undertaken to date have shown that rates of infection with EHEC vary considerably in different countries and even in different patient groups in the same country. For example, in Buenos Aires, Argentina, which has the highest reported incidence of HUS in the world, infections with STEC were diagnosed in 21% of children with watery diarrhoea and in 39% of those with grossly bloody diarrhoea.26 In the USA, in contrast, examination of more than 30 000 stool samples for E. coli O157 from 1990 to 1992, revealed that only
Sensitivity and specificity of tests to detect the presence of EHEC in faecal samples relative to the isolation of EHEC from the sample
Assay A. Plating on EHEC agar B. Assays for Shiga toxin using: Enzyme immunoassay On faecal samples After enrichment HeLa cell toxicity On faecal samples After enrichment C. PCR for: stx1, stx2 ehxA eae
Sensitivity % (95%CI)
Specificity % (95%CI)
Positive predictive value % (95%CI)
Negative predictive value % (95%CI)
94 (70–100)*
100 (99–100)
79 (54–94)
100 (99–100)
78 (40–97) 100 (59–100)
97 (93–99) 100 (99–100)
54 (25–81) 88 (47–100)
99 (96–100) 100 (99–100)
56 (21–86) 100 (59–100)
99 (97–100) 99 (99–100)
83 (36–100) 70 (35–93)
98 (95–99) 100 (99–100)
100 (59–100) 100 (59–100) 86 (42–100)
100 (99–100) 100 (99–100) 99 (98–100)
88 (47–100) 78 (40–97) 50 (21–79)
100 (99–100) 100 (99–100) 100 (99–100)
*Values were determined using InStat version 3.0 (GraphPad Software, USA).
ENTEROHAEMORRHAGIC E. COLI
0.4% were positive.21 In samples that contained visible blood, however, E. coli O157:H7 was found in 7.8%. In continental Europe, the proportion of diarrhoeic patients infected with STEC ranges from 9.3% in Germany to less than 1% in Italy and Serbia.27 In Australia, the incidence of infections with EHEC appears to be comparatively low.28 In a previous study of children with diarrhoea attending the Royal Children’s Hospital in Melbourne, we found STEC in approximately 1% of samples in which no other pathogen was identified.28 Interestingly, only 24% of the isolates were serogroup O157. Similar results were obtained in Sydney,29 and in South Australia, where during 2002, 38 (2.3%) STEC were identified in 1665 bloody stools investigated by PCR (Dr B. Combs, personal communication). In the present study, 11 of 653 (1.7%) samples from children (excluding repeat samples from the same patient) and three of 205 (1.5%) samples from adults with diarrhoea yielded EHEC. Although faecal samples which contained macroscopic or microscopic blood were 2.5 times more likely to yield EHEC than those without blood, this difference was not statistically significant, probably because of the small number of positive samples overall (type II statistical error). In contrast to EHEC isolates from Australian patients with HUS, where O111 strains have predominated,16 the most frequent serogroup in this study was O157, which comprised 36% of unique isolates, followed by serogroup O26. These findings reflect the distribution of EHEC serogroups in Australia on the whole; of 55 STEC obtained during 2001 and 2002, serogroups O157 and O26 accounted for 56 and 20% of serotyped isolates, respectively.30 The reasons underlying the differences in the prevalence of STEC in different countries are not entirely known. Because the principal reservoir of EHEC in industrialised countries is beef cattle, many human cases arise from ingestion of food or water that has been contaminated with bovine faeces. For this reason, rates of infection can be influenced by the extent of carriage of EHEC by food animals, differences in the methods used for animal husbandry, slaughtering, and food handling, levels of consumer education and compliance, and differences in the virulence of EHEC strains. In this regard it is of interest that all of the O157 strains identified in this study, and the vast majority of O157 isolated from Australian patients overall, were non-motile,28 whereas those in high prevalence countries tend to be O157:H7. This suggests that Australian EHEC O157 strains may represent a distinct clone of reduced virulence. Other indicators that Australian EHEC may be less virulent than overseas strains are that infections with EHEC in this study were not significantly associated with bloody diarrhoea and were attributable to a wide variety of strains in terms of serotype and virulence profile. In view of the low prevalence of EHEC in Melbourne, the relative difficulty in identifying them (given that most cannot be identified on convenient media such as sorbitol MacConkey agar), and the fact that specific treatment of EHEC-associated diarrhoea is not warranted (and may even be contraindicated because of a possibly increased risk of HUS31), we believe that routine examination of faecal samples for these bacteria using currently available methods is unlikely to be cost effective. On the other hand, it is important to understand the epidemiology of EHEC
349
infections as a guide for public health officers and managers of food supplies to allow prioritisation of strategies to control EHEC. In addition, it is essential to be able to identify EHEC as quickly as possible in the event of a suspected outbreak. Rapid diagnosis will also be essential when specific treatment for EHEC becomes available, based on materials which bind Stx in the intestine, because these treatments will need to be administered early in the course of infection to be effective.32 For these reasons, we evaluated different techniques for the detection of EHEC in the faeces of patients with diarrhoea. The results we obtained need to be considered in the light of the low number of positive results. In addition, by using bacterial isolation (a relatively insensitive technique) as the ‘gold standard’, we may have biased the results against more sensitive diagnostic methods. For this reason, the methods we used to isolate EHEC were far more rigorous and intensive than would be performed routinely. The use of bacterial isolation as a gold standard was justified by the observation in Study 2 that the PCRs for stx and ehxA, which emerged as the only diagnostic methods that were 100% sensitive and 100% specific, were invariably confirmed by culture. In this study, detection of EHEC in faecal samples preenriched in MacConkey broth was far more reliable than attempts to detect EHEC directly in faeces. Of the methods used for direct detection, plating on EHEC agar gave the best results. The high sensitivity and specificity of direct plating on EHEC agar and the PCR for ehxA reflects the fact that all 14 unique EHEC strains isolated during the course of this study produced EHEC haemolysin. This is not true of all EHEC strains, however, including some that have been associated with HUS.16,33 For these reasons, assays which rely primarily on the detection of EHEC haemolysin should not be relied upon for the primary isolation of EHEC. Moreover, the technique of two-step plating on EHEC agar which was used in this study, although sensitive, is likely to prove too inconvenient for adoption in most diagnostic laboratories. Interestingly, one EHEC strain of serotype O113:H21, which was obtained from a child with HUS, was not identified on EHEC agar because it showed haemolysis after 3 hours, even though it did not produce ahaemolysin. The prevalence of such rapidly haemolytic EHEC strains is not known, but their existence provides another cautionary note for those who would use EHEC agar as a primary means for isolating EHEC from clinical samples. Although the PCR for ehxA was highly reliable, one false-positive result was obtained in this assay. The strain in question also carried eae but was negative for Stx, suggesting that it may have been an EHEC strain that had spontaneously lost the stx-encoding bacteriophage in vivo or during passage in the laboratory. In the present study, we found that use of a commercial EIA to detect Stx directly in stool samples was unreliable. On the other hand, tests for Stx using EIA or for the stxencoding gene using PCR on samples incubated in MacConkey broth were highly sensitive and specific. The high specificity of the EIA, which confirms the findings of other investigators,34 reflects the fact that no STEC were isolated that were not also typical EHEC (i.e., also positive for either eae or ehxA). Although two samples may have
350
BENNETT-WOOD et al.
contained such strains, as evidenced by results obtained with the EIA and cytotoxicity assays for Stx, both of these samples were culture negative. The pathogenic potential of strains of STEC that lack eae and ehxA is controversial. Although such strains may cause diarrhoea, they are seldom isolated from patients with bloody diarrhoea or HUS, indicating that their capacity to cause these diseases is limited. The relatively low sensitivity and positive predictive value of the PCR for eae observed in this study was not surprising because the locus for enterocyte effacement, which contains eae, is not restricted to EHEC but is also present in EPEC, which is a common cause of diarrhoea in Melbourne (Robins-Browne R, et al., submitted for publication). Another reason for not relying on the PCR for eae as the principal means to detect EHEC is that some EHEC clones, e.g., serotype O113:H21, are intrinsically negative for eae but are regularly associated with bloody diarrhoea and HUS.16 In summary, two separate surveys for EHEC in patients with diarrhoea yielded 14 unique strains of EHEC from 860 faecal samples. The EHEC isolates were variable in terms of serotype and virulence profile, except that all were positive for EHEC haemolysin. Of the diagnostic methods evaluated, assays for Stx in MacConkey broth that had been inoculated with faeces were highly sensitive and specific. PCR for stx and ehxA was also sensitive and specific and is recommended for laboratories that can perform assays of this type. Direct plating of faeces on EHEC agar was more sensitive and specific than methods used to detect Stx in faeces, but was too impractical for use as a screening test. On the basis of these findings, we conclude that EHEC are best detected in enrichment broth of faeces by using EIA or PCR to screen for Stx or Stxencoding genes, respectively, followed by the plating of samples that give a positive result on EHEC agar to isolate individual EHEC colonies. ACKNOWLEDGEMENTS We are grateful to Oxoid Australia Pty Ltd for the generous gifts of EHEC agar and the Premier EHEC assay kits that were used in this study. We also thank Dr Karl Bettelheim, Microbiological Diagnostic Unit, Department of Microbiology and Immunology, University of Melbourne, for serotyping the bacterial isolates, and the staff of the microbiology diagnostic laboratories at the Royal Children’s Hospital and Monash Medical Centre for their assistance with the collection and identification of clinical samples that were used in this study. This study was supported by research grants from the Australian National Health and Medical Research Council, The Murdoch Children’s Research Institute, and the Victorian Department of Human Services. Address for correspondence: Professor R. M. Robins-Browne, Department of Microbiology and Immunology, University of Melbourne, Vic 3010, Australia. E-mail: [email protected]
References 1. Riley LW, Remis RS, Helgerson SD, et al. Hemorrhagic colitis associated with a rare Escherichia coli serotype. New Engl J Med 1983; 308: 681–5. 2. Karmali MA, Petric M, Lim C, et al. The association between idiopathic hemolytic uremic syndrome and infection by Verotoxinproducing Escherichia coli. J Infect Dis 1985; 151: 775–82.
Pathology (2004), 36(4), August 3. Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev 1998; 11: 142–201. 4. Konowalchuk J, Speirs JI, Stavric S. Vero response to a cytotoxin of Escherichia coli. Infect Immunol 1977; 18: 775–9. 5. Eiklid K, Olsnes S. Animal toxicity of Shigella dysenteriae cytotoxin: evidence that the neurotoxic, enterotoxic, and cytotoxic activities are due to one toxin. J Immunol 1983; 130: 380–4. 6. O’Brien AD, Newland JW, Miller SF, et al. Shiga-like toxinconverting phages from Escherichia coli strains that cause hemorrhagic colitis or infantile diarrhea. Science 1984; 226: 694–6. 7. O’Brien AD, Tesh VL, Donohue-Rolfe A, et al. Shiga toxin: biochemistry, genetics, mode of action, and role in pathogenesis. Curr Top Microbiol Immunol 1992; 180: 65–94. 8. O’Loughlin E, Robins-Browne RM. Effect of Shiga toxins on eukaryotic cells. Microbes Infect 2001; 3: 493–507. 9. Frankel G, Phillips AD, Rosenshine I, et al. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol Microbiol 1998; 30: 911–21. 10. Schmidt H, Beutin L, Karch H. Molecular analysis of the plasmidencoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect Immunol 1995; 63: 1055–61. 11. Beutin L, Montenegro MA, Orskov I, et al. Close association of verotoxin (Shiga-like toxin) production with enterohemolysin production in strains of Escherichia coli. J Clin Microbiol 1989; 27: 2559–64. 12. Tarr PI, Neill MA, Clausen CR, et al. Escherichia coli O157:H7 and the hemolytic uremic syndrome: importance of early cultures in establishing the etiology. J Infect Dis 1990; 162: 553–6. 13. Wells JG, Davis BR, Wachsmuth IK, et al. Laboratory investigation of hemorrhagic colitis outbreaks associated with a rare Escherichia coli serotype. J Clin Microbiol 1983; 18: 512–20. 14. Smith HR, Rowe B, Gross RJ, Fry NK, Scotland SM. Haemorrhagic colitis and Verocytotoxin-producing Escherichia coli in England and Wales. Lancet 1987; i: 1062–5. 15. Farmer JJ, III, Davis BR. H7 antiserum-sorbitol fermentation medium: a single tube screening medium for detecting Escherichia coli O157:H7 associated with hemorrhagic colitis. J Clin Microbiol 1985; 22: 620–5. 16. Elliott EJ, Robins-Browne RM, O’Loughlin EV, et al. Nationwide study of haemolytic uraemic syndrome: clinical, microbiological, and epidemiological features. Arch Dis Child 2001; 85: 125–31. 17. Ratnam S, March SB, Ahmed R, Bezanson GS, Kasatiya S. Characterization of Escherichia coli serotype O157:H7. J Clin Microbiol 1988; 26: 2006–12. 18. Beutin L, Zimmermann S, Gleier K. Rapid detection and isolation of Shiga-like toxin (Verocytotoxin)-producing Escherichia coli by direct testing of individual enterohemolytic colonies from washed sheep blood agar plates in the VTEC-RPLA assay. J Clin Microbiol 1996; 34: 2812–4. 19. Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxinproducing Escherichia coli infections. Clin Microbiol Rev 1998; 11: 450–79. 20. Paton AW, Paton JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol 1998; 36: 598–602. 21. Slutsker L, Ries AA, Greene KD, et al. Escherichia coli O157:H7 diarrhea in the United States: clinical and epidemiologic features. Ann Intern Med 1997; 126: 505–13. 22. Bettelheim KA, Thompson CJ. New method of serotyping Escherichia coli: implementation and verification. J Clin Microbiol 1987; 25: 781–6. 23. Marques LRM, Moore MA, Wells JG, Wachsmuth IK, O’Brien AD. Production of Shiga-like toxin by Escherichia coli. J Infect Dis 1986; 154: 338–41. 24. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989. 25. Perna NT, Plunkett G, Burland V, et al. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 2001; 409: 529–33. 26. Lo´pez EL, Contrini MM, De Rosa MF. Epidemiology of shiga toxinproducing Escherichia coli in South America. In: Kaper JB, O’Brien AD, editors. E. coli O157:H7 and Other Shiga Toxin-Producing E. coli Strains. Washington, DC: American Society for Microbiology, 1998; 30–7. 27. Caprioli A, Tozzi AE. Epidemiology of shiga toxin-producing Escherichia coli infections in continental Europe. In: Kaper JB,
ENTEROHAEMORRHAGIC E. COLI
O’Brien AD, editors. E. coli O157:H7 and Other Shiga ToxinProducing E. coli Strains. Washington, DC: American Society for Microbiology, 1998; 38–48. 28. Robins-Browne RM, Elliott E, Desmarchelier P. Shiga toxin-producing Escherichia coli in Australia. In: Kaper JB, O’Brien AD, editors. E. coli O157:H7 and Other Shiga Toxin-Producing E. coli Strains. Washington, DC: American Society for Microbiology, 1998; 66–72. 29. Ong J, Zhe L, Robins-Browne R, Gapes M, O’Loughlin EV. Prevalence of verocytotoxigenic Escherichia coli serotype O157:H7 in children with diarrhoea attending a Sydney hospital. J Paediatr Child Health 1993; 29: 185–7. 30. The OzFoodNet Working Group. Foodborne disease in Australia: incidence, notifications and outbreaks. Annual report of the OzFoodNet network, 2002. Communicable Diseases Intelligence 2003; 27: 209–43.
351
31. Wong CS, Jelacic S, Habeeb RL, Watkins SL, Tarr PI. The risk of the hemolytic-uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 infections. New Engl J Med 2000; 342: 1930–6. 32. Paton JC, Rogers TJ, Morona R, Paton AW. Oral administration of formaldehyde-killed recombinant bacteria expressing a mimic of the Shiga toxin receptor protects mice from fatal challenge with Shigatoxigenic Escherichia coli. Infect Immunol 2001; 69: 1389–93. 33. Boerlin P, McEwen SA, Boerlin-Petzold F, et al. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J Clin Microbiol 1999; 37: 497–503. 34. Mackenzie AM, Lebel P, Orrbine E, et al. Sensitivities and specificities of premier E. coli O157 and premier EHEC enzyme immunoassays for diagnosis of infection with verotxin (Shiga-like toxin)-producing Escherichia coli. The SYNSORB Pk Study investigators. J Clin Microbiol 1998; 36: 1608–11.
MICROBIOLOGY
Detection of enterohaemorrhagic Escherichia coli in patients attending hospital in Melbourne, Australia VICKI R. BENNETT-WOOD*, JACINTA RUSSELL*, ANNE-MARIE BORDUN*, PAUL D. R. JOHNSON{ AND ROY M. ROBINS-BROWNE* *Department of Microbiology and Immunology, University of Melbourne, and Royal Children’s Hospital and Murdoch Childrens Research Institute, Parkville and {Department of Infectious Diseases, Austin Hospital, Heidelberg, Victoria, Australia
Summary Aims: The objectives of this study were (i) to determine the prevalence of enterohaemorrhagic Escherichia coli (EHEC) in adults and children with diarrhoea attending hospital in Melbourne, and (ii) to evaluate diagnostic assays for the detection of EHEC. Methods: EHEC were sought in 860 faecal samples (655 from children) using direct plating, a cytotoxicity assay and an enzyme immunoassay for Shiga toxin (Stx), and PCR for virulence-associated genes of EHEC. Results: EHEC were isolated from 14 of 858 (1.6%) faecal samples (excluding repeat isolates from one patient). Isolation rates in children (1.7%) and adults (1.5%) were similar. EHEC was detected 2.5 times more frequently in samples that contained blood, but this was not statistically significant. EHEC isolates were heterogeneous in terms of serotype and virulence profile, although all produced EHEC haemolysin. Of the screening assays used, direct plating on EHEC agar, assays for Stx in MacConkey broth inoculated with faeces, and detection of the genes for Stx and EHEC haemolysin were highly sensitive and specific. Conclusions: EHEC are an infrequent cause of diarrhoea in Melbourne. EHEC can readily be isolated from faeces by screening enrichment broth cultures for Stx using PCR or enzyme immunoassay, followed by isolation of the bacteria on EHEC agar. Key words: Diagnostic tests, diarrhoea, diarrhea, Escherichia coli, enterohaemorrhagic E. coli, enterohemorrhagic E. coli, Shiga toxin. Received 23 January, revised and accepted 31 March 2004
INTRODUCTION Enterohaemorrhagic strains of Escherichia coli (EHEC) are important emerging food-borne pathogens. These bacteria were first recognised as the cause of outbreaks of haemorrhagic colitis associated with the consumption of undercooked hamburgers from fast food restaurants in the USA.1 Identification of E. coli as the cause of these outbreaks was facilitated by the fact that the aetiological agents belonged to a rare serotype, namely, O157:H7. Shortly after this seminal discovery, Karmali et al.2 reported an association between infection with cytotoxin-producing strains of E. coli (subsequently shown to be EHEC) and the development of the haemolytic uraemic syndrome
(HUS). Today, EHEC are recognised as the leading cause of haemorrhagic colitis and HUS, and an important cause of non-specific diarrhoea in many industrialised countries worldwide.3 The cytotoxin which characterises EHEC was first identified in E. coli by Konowalchuk et al.,4 and is termed Verotoxin (VT), because of its toxicity for Vero (African green monkey kidney) tissue culture cells. One variety of VT, namely VT-1, is nearly identical to Shiga toxin (Stx), which is the cytotoxin, enterotoxin and neurotoxin produced by strains of Shigella dysenteriae type I,5 and evidently is responsible for the high virulence of these bacteria compared with other varieties of Shigella species. In EHEC, VT-1/Stx-1 is encoded by a lysogenic, lambdoid bacteriophage.6 The toxin binds to globoceremides on the surface of susceptible cells, mainly endothelial cells of small blood vessels supplying the intestine, kidney, pancreas, heart and brain, to induce intravascular coagulation, haemolysis, the consumption of platelets, and end organ damage.7,8 VT-2/Stx-2 is approximately 55% homologous to Stx-1 and shares its mechanism of action, although it is antigenically distinct. These toxins are the key factors required by EHEC to cause haemorrhagic colitis and HUS. In addition to Stx, typical strains of EHEC carry one or more accessory virulence determinant. Amongst these is a chromosomal locus for enterocyte effacement, which encodes a number of factors that facilitate bacterial adhesion to the intestinal mucosa.9 One of these adhesins is an outer membrane protein termed intimin, which is encoded by the eae gene. Many EHEC strains also carry a large plasmid that encodes, amongst other things, a characteristic haemolysin known as enterohaemolysin or EHEC haemolysin.10 This toxin is distinguished from the far more prevalent a-haemolysin that is expressed by many commensal strains of E. coli by the facts that activity of EHEC haemolysin in vitro is inhibited by serum and its haemolytic action is slower than that of a-haemolysin.11 The detection of EHEC in faeces poses a challenge for clinical microbiology laboratories. Key issues concerning their detection include the need to distinguish EHEC from commensal varieties of E. coli, and the fact that the number of EHEC in faeces tends to fall steadily from the commencement of the illness,12,13 so that by the time a patient develops HUS, fewer than 1% of E. coli isolated from faeces may be EHEC.14 Many laboratories employ
ISSN 0031-3025 printed/ISSN 1465–3931 # 2004 Royal College of Pathologists of Australasia DOI: 10.1080/00313020410001721591
346
Pathology (2004), 36(4), August
BENNETT-WOOD et al.
sorbitol MacConkey agar (SMAC) as a selective and indicator medium for the primary isolation of EHEC from faeces. This medium takes advantage of the fact that most clinical isolates of E. coli O157 (but generally not other O-serogroups) do not ferment sorbitol.15 Accordingly, SMAC is not useful for the detection of non-O157 strains. This limitation of SMAC is particularly important in Australia where most isolates of EHEC from cases of HUS belong to serogroups other than O157,16 and are indistinguishable from commensal strains of E. coli when grown on SMAC. Another distinctive biochemical feature of EHEC O157 is the inability to produce b-D-glucuronidase.17 This property has spawned a variety of diagnostic media containing chromogenic substrates for this enzyme, but these suffer from the same limitations as SMAC. On the other hand, enterohaemolysin agar, also known as EHEC agar, is a medium which relies on the ability of most EHEC strains to produce EHEC haemolysin and hence is not specific for O157 strains.18 However, EHEC agar is likely to be less sensitive and less specific than SMAC and similar media because it lacks their selective properties and because of potential difficulties in distinguishing bacteria which produce EHEC haemolysin from those that secrete a-haemolysin. Other methods to detect EHEC in faeces include direct detection of Stx by enzyme immunoassay or, more laboriously, by direct examination of faeces for the presence of specific cytotoxins.19 The presence of EHEC can also be inferred by using PCR amplification to detect the genes which encode Stx, together with those for accessory virulence-associated determinants, such as intimin and EHEC haemolysin.20 To determine the prevalence of EHEC in Melbourne, and to evaluate the relative merits of the diagnostic techniques for EHEC in a clinical setting, we utilised direct plating, a cytotoxicity assay and a commercial enzyme immunoassay (EIA) for Stx, and PCR to investigate the prevalence of EHEC in patients attending two hospitals in Melbourne.
MATERIALS AND METHODS Study design Two separate studies were performed. Study 1 was conducted at the Royal Children’s Hospital, Melbourne, for 12 months from mid-February 1997. Faecal samples from children that were submitted to the hospital’s diagnostic laboratory were investigated for the presence of EHEC if the specimen was received on a weekday morning, was obviously loose and contained red blood cells on macroscopic or microscopic examination. The reasons for applying these selection criteria were to limit the samples to a number that could reasonably be examined by one person during the course of this study, and to increase the chances of finding EHEC, which are reported to be more common in faecal samples which contain blood.21 Study 2 was undertaken for 12 months starting in August 1998, and included specimens from both the Royal Children’s Hospital and the Monash Medical Centre. The latter is a tertiary general hospital which caters mostly for adult patients. The selection criteria for this study were similar to those for Study 1 except that for each sample containing blood, a matching diarrhoeic sample that was free of blood and received in the laboratory around the same time as the blood-containing sample was also examined for EHEC.
Processing of samples In Study 1, a sample of faeces was examined for Stx using a cytotoxicity assay and a commercial EIA, as described below. A portion of faeces was also plated on MacConkey and enterohaemolysin agar (EHEC agar) plates (Oxoid, UK). After overnight incubation of the MacConkey agar plate in air at 37‡C, a sterile cotton swab was used to transfer the growth from each plate into Luria broth containing 30% (v/v) glycerol, which was then frozen at 270‡C until required. Whenever a faecal sample gave a positive result in the cytotoxicity assay or the EIA, the corresponding stored sample was subcultured up to five times on agar so that individual Stx-producing strains of E. coli (STEC) could be isolated and characterised. Samples from which STEC were not isolated were deemed to be negative for EHEC. For the purposes of statistical analysis, only the results of the initial plating were taken into account. EHEC agar plates inoculated with the original faecal sample were incubated in air overnight at 37‡C and examined for the presence of haemolytic colonies, which were then picked off and plated onto fresh EHEC agar plates. The latter were incubated at 37‡C and examined for haemolytic colonies after 3 and 24 h. Individual haemolytic colonies were examined for the production of Stx in the cytotoxicity assay and EIA. Isolates that were positive in this assay, and all those which showed delayed haemolysis (negative at 3 h and positive at 24 h) were also investigated by PCR for the presence of genes encoding Stx (stx), intimin (eae) and EHEC haemolysin (ehxA) after subculture in broth as described below. For Study 2, samples were plated on EHEC and MacConkey agar as for Study 1, but instead of assaying for Stx in faeces directly, a sample of faeces was inoculated into 5 mL MacConkey broth (Oxoid). The broth was incubated with shaking at 37‡C overnight, after which a portion of the culture was assayed for Stx in cell culture and by EIA. Bacteria which grew in the MacConkey broth were also examined by PCR for stx, eae, and hlxA. In both studies, E. coli strains that produced Stx and were positive for either eae or hlxA were classified as EHEC, whereas strains that were positive for Stx and negative for both eae and hlxA were classified as nonEHEC STEC. Serotyping of EHEC isolates obtained during the course of both studies was performed by Dr K. A. Bettelheim, Microbiological Diagnostic Unit, Department of Microbiology and Immunology, University of Melbourne.22 Assays for Stx Stx was assayed in an Stx-susceptible line of HeLa cells (kindly provided by Professor A. D. O’Brien, Uniformed Services University of the Health Services, Bethesda, MD, USA23) and by using a commercially available assay (Premier EHEC; Meridian Diagnostics, USA) in accordance with the manufacturer’s directions. Premier EHEC is an EIA which utilises monoclonal anti-Stx antibodies adsorbed to microtitre wells to capture Stx and a polyclonal anti-Stx antibody to detect bound toxin. For the HeLa cell assay, a portion of the test sample was mixed in an equal volume of phosphate-buffered saline (PBS), pH 7.4, and clarified by centrifugation and filtration through a 0.45-mm pore-size filter (Millipore, USA). For the Stx assay on pure cultures of E. coli, bacteria were grown in Penassay broth (Antibiotic Medium no. 3; Difco Laboratories, USA) with shaking at 37‡C overnight, and then pelleted by centrifugation and filtration. Forty mL of each test sample were added to 160 mL of minimal Eagle’s medium (MEM; Invitrogen, USA) in duplicate wells of a 96-well, flat-bottomed microtitre tray (Nunc, Denmark), containing a semiconfluent layer of HeLa cells. This was incubated for 40 min, after which the medium was replaced with fresh MEM and incubated at 37‡C in air supplemented with 5% CO2. Cells were observed daily for up to 4 days for evidence of characteristic cytotoxic damage. PCR methods One mL of MacConkey broth (from Study 2), or pure bacterial culture in Luria broth, was centrifuged for 5 min to pellet the bacteria. The supernatant was removed and the pellet was washed in 1 mL of PBS, resuspended in 200 mL sterile distilled water, and heated for 10 min at
ENTEROHAEMORRHAGIC E. COLI
100‡C. Samples were then placed on ice for 5 min and re-centrifuged for 5 min in a microcentrifuge at 12 0006g. Twenty-mL aliquots of the supernatant were diluted 1:10 in 180 mL distilled water. PCR amplifications were performed in a Gene Amp PCR System 9700 thermal cycler (Applied Biosystems, USA) with AmpliTaq Gold polymerase (Applied Biosystems), in a reaction volume of 50 mL, using the primers listed in Table 1. The conditions for the stx1/stx2 duplex PCR involved denaturation of template DNA for 10 min at 95‡C, followed by 35 cycles of 30 s at 95‡C, 1 min at 52‡C and 1 min at 72‡C, and a final extension period of 8 min at 72‡C. The conditions for eae/ehxA PCR involved denaturation of template DNA for 10 min at 95‡C, followed by 30 cycles of 30 s at 95‡C, 90 s at 54‡C and 90 s at 72‡C, and a final extension period of 8 min at 72‡C. At the conclusion of both PCRs, 10 mL of the reaction mixture were electrophoresed on 2.5% (w/v) agarose gels. Gels were stained with ethidium bromide, visualised on a UV transilluminator and photographed. A portion of the PCR product was retained for Southern blotting which was performed using capillary transfer of separated DNA fragments onto positively charged nylon membranes (Roche Diagnostics, UK).24 Digoxigenin-labelled DNA probes were prepared by PCR (Roche Diagnostics) from EHEC control strain, EDL933,25 using the PCR primers listed in Table 1. The integrity of the probes was determined by nucleotide sequencing, using an ABI PRISM Big Dye Terminators v3.0 Cycle Sequencing Kit and an ABI PRISM 377 DNA sequencer (Applied Biosystems). Probes were hybridised overnight under conditions of high stringency at 65‡C and detected using chemiluminescence as recommended by the manufacturer (Roche Diagnostics). Statistical analysis Statistical analysis of quantitative and qualitative data was performed using InStat version 3.0 (GraphPad Software Inc., USA).
RESULTS Isolation of EHEC During the 12-month period from mid-February 1997 to mid-February 1998 (Study 1), 203 samples from children were investigated, nine (4.4%) of which yielded EHEC. Two of the EHEC-positive patients were diagnosed with HUS; in the others the primary diagnosis was diarrhoea. During Study 2, 657 samples were examined, 452 of which were from children. Seven (1.1%) of the 657 samples were positive for EHEC, including four from children. Three of the paediatric samples were from the same patient. There were 330 samples (226 from children) which contained blood on macroscopic or microscopic examination. Five (1.5%) of these yielded EHEC, compared with two (0.6%) from the 327 samples without blood (relative rate, 2.5; 95% confidence interval [CI], 0.5–12.7), but the difference
TABLE 1 Characteristics of the PCR primers used to detect EHEC (adapted from Paton and Paton20) Gene or virulence factor Primer* eae ehxA stx1 stx2
1a 2a 1a 2a 1b 2b 1b 2b
Primer sequence (5’ to 3’)
Product size (bp)
GACCCGGCACAAGCATAAGC CCACCTGCAGCAACAAGAGG GCATCATCAAGCGTACGTTCC AATGAGCCAAGCTGGTTAAGCT ATAAATCGCCATTCGTTGACTAC AGAACGCCCACTGAGATCATC GGCACTGTCTGAAACTGCTCC TCGCCAGTTATCTGACATTCTG
*Primers with the same superscript were detected in duplex PCRs.
384 534 180 255
347
between the two groups was not significant (Pw0.4, Fisher’s exact test). Characteristics of EHEC isolates The characteristics of the 14 unique EHEC strains isolated during the course of both studies are summarised in Table 2. Seven produced both Stx-1 and Stx-2, four produced only Stx-1 and three produced only Stx-2. All 14 strains were positive for EHEC haemolysin, but only 11 carried the eae gene. The O-serogroups of the isolates also varied and included five that were O157, four of serogroup O26, two of O111, and one each of O1 and O113. In addition, one strain was O-non-typable indicating that it did not react with any of the available O-typing sera (O1– O181). All five of the O157 strains were non-motile.
Evaluation of methods to detect EHEC Direct plating on EHEC agar In Study 1, 65 of 203 (32%) samples yielded haemolytic colonies on EHEC agar after overnight incubation. Of these, eight (12%) exhibited delayed haemolysis indicative of EHEC haemolysin. All eight of these isolates were positive in the PCR for ehxA and stx, and hence met the criteria for classification as EHEC. One of the 57 isolates that showed rapid haemolysis (haemolysis after 3 hours) also produced Stx and carried ehxA. This strain was negative in a PCR for a-haemolysin (data not shown), and was regarded as a ‘false-negative’ result for the purposes of statistical analysis. In Study 2, all seven EHEC isolates were identified by two-step plating on EHEC agar. Three other samples yielded colonies which showed delayed haemolysis, but were negative in the PCR for ehxA and stx, and in the cytotoxicity assay for Stx. These three isolates were regarded as ‘false-positive’ results. One isolate that showed delayed haemolysis on EHEC agar was positive in the PCR for ehxA and eae, but was negative in all tests for Stx, and hence was not EHEC.
TABLE 2 study
Characteristics of the 14 EHEC isolates identified in this
Presence of virulence-associated factors Month and year of isolation Source Serotype May 1997 Sep 1997 Oct 1997 Oct 1997 Dec 1997 Dec 1997 Dec 1997 Jan 1998 Feb 1998 Feb 1999 Feb 1999 Mar 1999 Mar 1999 Mar 1999
C, C, C, C, C, C, C, C, C, C, A, A, C, A,
D H D H D D D D D D D D D D
O157:H– Ont:H7 O157:H– O113:H21 O26:H11 O111:H– O26:H11 O26:H11 O26:H11 O111:H– O157:H– O157:H– O1:H7 O157:H–
Stx-1
Stx-2
Intimin
EHEC haemolysin
z 2 z 2 z z z z z z z z 2 z
z z z z 2 z 2 2 2 z z z z z
z 2 z 2 z z z z z z z z 2 z
z z z z z z z z z z z z z z
A, adult; C, child; D, diarrhoea; H, haemolytic ureamic syndrome; Ont, O non-typable (O1–O181); z, present; 2, absent.
348
Pathology (2004), 36(4), August
BENNETT-WOOD et al.
Detection of Stx EIA In Study 1, where faeces were assayed for Stx directly, 13 of 203 samples gave a positive or equivocal result in the EIA. These samples included seven that were subsequently confirmed to contain EHEC, and six that did not. One of the latter was positive when investigated in a PCR for stx1, indicating that the EIA result was probably correct, although EHEC was not isolated from this sample and PCRs for stx2, eae and ehxA were all negative. Five EIA-positive samples were negative in the HeLa cell assay and in PCRs for stx1, stx2, eae and ehxA, and were classified as ‘false-positives’. Two samples which yielded EHEC on culture were negative in the EIA screen that was performed on faeces. However, individual EHEC colonies from these samples were positive when re-tested in the same assay. In Study 2, where samples were pre-enriched by growth in MacConkey broth before being assayed for Stx, all seven samples which subsequently yielded EHEC were positive in the EIA. Another six samples that were positive when first tested with this assay, were negative when retested, and were also negative in the PCR for stx and the HeLa cell assay for Stx. An additional sample that was positive in the EIA screen was positive in the PCR for stx and assay for Stx, but no EHEC were isolated from this sample. The PCR on this sample for eae and ehxA was negative, indicating that it probably contained an Stx-producing strain that was not a typical EHEC (i.e., positive for either eae or ehxA). As the strain was not cultured, however, this could not be confirmed. Cytotoxicity assay In Study 1, five of nine samples which subsequently yielded EHEC were positive in the screening assay for Stx, using toxicity for HeLa cells as the read out. One ‘false-positive’ reaction was obtained. In Study 2, all seven samples which ultimately yielded EHEC were positive in the screening assay for Stx. Three samples from which EHEC were not isolated were also positive in the screening assay. One of these was also positive in the EIA for Stx (as indicated above), but the other two were negative in all other assays.
TABLE 3
Screening of samples by PCR In Study 2, where PCR was used to screen samples, seven positive results were obtained for stx. All of these were confirmed by Southern blotting and in the HeLa cell assay for Stx. Twelve positive results were obtained in the PCR for eae. Six of these were also positive for stx and confirmed as EHEC. Of eight samples that were positive in the PCR for ehxA, seven were confirmed as EHEC, and one was identified as ehxA and eae positive but was negative for Stx, and therefore was classified as a ‘falsepositive’ result in terms of EHEC detection. A comparison of the sensitivity and specificity of the various screening assays is provided in Table 3.
DISCUSSION EHEC is a major food-borne pathogen in the industrialised countries of the Northern Hemisphere and an emerging cause of diarrhoea and HUS in some less developed countries. Nevertheless, data pertaining to the burden of disease attributable to EHEC are unreliable, largely because the frequency of EHEC diagnosis is influenced by a considerable number of variables, including the likelihood of patients seeking medical attention for diarrhoea, the probability that an appropriate sample will be collected and submitted for laboratory examination, and the fact that many laboratories do not include diagnosis of EHEC in their standard procedures, or if they do, they may use insensitive techniques. For these reasons, intensive studies of outbreaks of food poisoning, and occasional surveys of the prevalence of EHEC in patients with endemic diarrhoea or HUS are likely to provide the best indication of the contribution of EHEC to the overall burden of disease. Studies of the prevalence of EHEC that have been undertaken to date have shown that rates of infection with EHEC vary considerably in different countries and even in different patient groups in the same country. For example, in Buenos Aires, Argentina, which has the highest reported incidence of HUS in the world, infections with STEC were diagnosed in 21% of children with watery diarrhoea and in 39% of those with grossly bloody diarrhoea.26 In the USA, in contrast, examination of more than 30 000 stool samples for E. coli O157 from 1990 to 1992, revealed that only
Sensitivity and specificity of tests to detect the presence of EHEC in faecal samples relative to the isolation of EHEC from the sample
Assay A. Plating on EHEC agar B. Assays for Shiga toxin using: Enzyme immunoassay On faecal samples After enrichment HeLa cell toxicity On faecal samples After enrichment C. PCR for: stx1, stx2 ehxA eae
Sensitivity % (95%CI)
Specificity % (95%CI)
Positive predictive value % (95%CI)
Negative predictive value % (95%CI)
94 (70–100)*
100 (99–100)
79 (54–94)
100 (99–100)
78 (40–97) 100 (59–100)
97 (93–99) 100 (99–100)
54 (25–81) 88 (47–100)
99 (96–100) 100 (99–100)
56 (21–86) 100 (59–100)
99 (97–100) 99 (99–100)
83 (36–100) 70 (35–93)
98 (95–99) 100 (99–100)
100 (59–100) 100 (59–100) 86 (42–100)
100 (99–100) 100 (99–100) 99 (98–100)
88 (47–100) 78 (40–97) 50 (21–79)
100 (99–100) 100 (99–100) 100 (99–100)
*Values were determined using InStat version 3.0 (GraphPad Software, USA).
ENTEROHAEMORRHAGIC E. COLI
0.4% were positive.21 In samples that contained visible blood, however, E. coli O157:H7 was found in 7.8%. In continental Europe, the proportion of diarrhoeic patients infected with STEC ranges from 9.3% in Germany to less than 1% in Italy and Serbia.27 In Australia, the incidence of infections with EHEC appears to be comparatively low.28 In a previous study of children with diarrhoea attending the Royal Children’s Hospital in Melbourne, we found STEC in approximately 1% of samples in which no other pathogen was identified.28 Interestingly, only 24% of the isolates were serogroup O157. Similar results were obtained in Sydney,29 and in South Australia, where during 2002, 38 (2.3%) STEC were identified in 1665 bloody stools investigated by PCR (Dr B. Combs, personal communication). In the present study, 11 of 653 (1.7%) samples from children (excluding repeat samples from the same patient) and three of 205 (1.5%) samples from adults with diarrhoea yielded EHEC. Although faecal samples which contained macroscopic or microscopic blood were 2.5 times more likely to yield EHEC than those without blood, this difference was not statistically significant, probably because of the small number of positive samples overall (type II statistical error). In contrast to EHEC isolates from Australian patients with HUS, where O111 strains have predominated,16 the most frequent serogroup in this study was O157, which comprised 36% of unique isolates, followed by serogroup O26. These findings reflect the distribution of EHEC serogroups in Australia on the whole; of 55 STEC obtained during 2001 and 2002, serogroups O157 and O26 accounted for 56 and 20% of serotyped isolates, respectively.30 The reasons underlying the differences in the prevalence of STEC in different countries are not entirely known. Because the principal reservoir of EHEC in industrialised countries is beef cattle, many human cases arise from ingestion of food or water that has been contaminated with bovine faeces. For this reason, rates of infection can be influenced by the extent of carriage of EHEC by food animals, differences in the methods used for animal husbandry, slaughtering, and food handling, levels of consumer education and compliance, and differences in the virulence of EHEC strains. In this regard it is of interest that all of the O157 strains identified in this study, and the vast majority of O157 isolated from Australian patients overall, were non-motile,28 whereas those in high prevalence countries tend to be O157:H7. This suggests that Australian EHEC O157 strains may represent a distinct clone of reduced virulence. Other indicators that Australian EHEC may be less virulent than overseas strains are that infections with EHEC in this study were not significantly associated with bloody diarrhoea and were attributable to a wide variety of strains in terms of serotype and virulence profile. In view of the low prevalence of EHEC in Melbourne, the relative difficulty in identifying them (given that most cannot be identified on convenient media such as sorbitol MacConkey agar), and the fact that specific treatment of EHEC-associated diarrhoea is not warranted (and may even be contraindicated because of a possibly increased risk of HUS31), we believe that routine examination of faecal samples for these bacteria using currently available methods is unlikely to be cost effective. On the other hand, it is important to understand the epidemiology of EHEC
349
infections as a guide for public health officers and managers of food supplies to allow prioritisation of strategies to control EHEC. In addition, it is essential to be able to identify EHEC as quickly as possible in the event of a suspected outbreak. Rapid diagnosis will also be essential when specific treatment for EHEC becomes available, based on materials which bind Stx in the intestine, because these treatments will need to be administered early in the course of infection to be effective.32 For these reasons, we evaluated different techniques for the detection of EHEC in the faeces of patients with diarrhoea. The results we obtained need to be considered in the light of the low number of positive results. In addition, by using bacterial isolation (a relatively insensitive technique) as the ‘gold standard’, we may have biased the results against more sensitive diagnostic methods. For this reason, the methods we used to isolate EHEC were far more rigorous and intensive than would be performed routinely. The use of bacterial isolation as a gold standard was justified by the observation in Study 2 that the PCRs for stx and ehxA, which emerged as the only diagnostic methods that were 100% sensitive and 100% specific, were invariably confirmed by culture. In this study, detection of EHEC in faecal samples preenriched in MacConkey broth was far more reliable than attempts to detect EHEC directly in faeces. Of the methods used for direct detection, plating on EHEC agar gave the best results. The high sensitivity and specificity of direct plating on EHEC agar and the PCR for ehxA reflects the fact that all 14 unique EHEC strains isolated during the course of this study produced EHEC haemolysin. This is not true of all EHEC strains, however, including some that have been associated with HUS.16,33 For these reasons, assays which rely primarily on the detection of EHEC haemolysin should not be relied upon for the primary isolation of EHEC. Moreover, the technique of two-step plating on EHEC agar which was used in this study, although sensitive, is likely to prove too inconvenient for adoption in most diagnostic laboratories. Interestingly, one EHEC strain of serotype O113:H21, which was obtained from a child with HUS, was not identified on EHEC agar because it showed haemolysis after 3 hours, even though it did not produce ahaemolysin. The prevalence of such rapidly haemolytic EHEC strains is not known, but their existence provides another cautionary note for those who would use EHEC agar as a primary means for isolating EHEC from clinical samples. Although the PCR for ehxA was highly reliable, one false-positive result was obtained in this assay. The strain in question also carried eae but was negative for Stx, suggesting that it may have been an EHEC strain that had spontaneously lost the stx-encoding bacteriophage in vivo or during passage in the laboratory. In the present study, we found that use of a commercial EIA to detect Stx directly in stool samples was unreliable. On the other hand, tests for Stx using EIA or for the stxencoding gene using PCR on samples incubated in MacConkey broth were highly sensitive and specific. The high specificity of the EIA, which confirms the findings of other investigators,34 reflects the fact that no STEC were isolated that were not also typical EHEC (i.e., also positive for either eae or ehxA). Although two samples may have
350
BENNETT-WOOD et al.
contained such strains, as evidenced by results obtained with the EIA and cytotoxicity assays for Stx, both of these samples were culture negative. The pathogenic potential of strains of STEC that lack eae and ehxA is controversial. Although such strains may cause diarrhoea, they are seldom isolated from patients with bloody diarrhoea or HUS, indicating that their capacity to cause these diseases is limited. The relatively low sensitivity and positive predictive value of the PCR for eae observed in this study was not surprising because the locus for enterocyte effacement, which contains eae, is not restricted to EHEC but is also present in EPEC, which is a common cause of diarrhoea in Melbourne (Robins-Browne R, et al., submitted for publication). Another reason for not relying on the PCR for eae as the principal means to detect EHEC is that some EHEC clones, e.g., serotype O113:H21, are intrinsically negative for eae but are regularly associated with bloody diarrhoea and HUS.16 In summary, two separate surveys for EHEC in patients with diarrhoea yielded 14 unique strains of EHEC from 860 faecal samples. The EHEC isolates were variable in terms of serotype and virulence profile, except that all were positive for EHEC haemolysin. Of the diagnostic methods evaluated, assays for Stx in MacConkey broth that had been inoculated with faeces were highly sensitive and specific. PCR for stx and ehxA was also sensitive and specific and is recommended for laboratories that can perform assays of this type. Direct plating of faeces on EHEC agar was more sensitive and specific than methods used to detect Stx in faeces, but was too impractical for use as a screening test. On the basis of these findings, we conclude that EHEC are best detected in enrichment broth of faeces by using EIA or PCR to screen for Stx or Stxencoding genes, respectively, followed by the plating of samples that give a positive result on EHEC agar to isolate individual EHEC colonies. ACKNOWLEDGEMENTS We are grateful to Oxoid Australia Pty Ltd for the generous gifts of EHEC agar and the Premier EHEC assay kits that were used in this study. We also thank Dr Karl Bettelheim, Microbiological Diagnostic Unit, Department of Microbiology and Immunology, University of Melbourne, for serotyping the bacterial isolates, and the staff of the microbiology diagnostic laboratories at the Royal Children’s Hospital and Monash Medical Centre for their assistance with the collection and identification of clinical samples that were used in this study. This study was supported by research grants from the Australian National Health and Medical Research Council, The Murdoch Children’s Research Institute, and the Victorian Department of Human Services. Address for correspondence: Professor R. M. Robins-Browne, Department of Microbiology and Immunology, University of Melbourne, Vic 3010, Australia. E-mail: [email protected]
References 1. Riley LW, Remis RS, Helgerson SD, et al. Hemorrhagic colitis associated with a rare Escherichia coli serotype. New Engl J Med 1983; 308: 681–5. 2. Karmali MA, Petric M, Lim C, et al. The association between idiopathic hemolytic uremic syndrome and infection by Verotoxinproducing Escherichia coli. J Infect Dis 1985; 151: 775–82.
Pathology (2004), 36(4), August 3. Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev 1998; 11: 142–201. 4. Konowalchuk J, Speirs JI, Stavric S. Vero response to a cytotoxin of Escherichia coli. Infect Immunol 1977; 18: 775–9. 5. Eiklid K, Olsnes S. Animal toxicity of Shigella dysenteriae cytotoxin: evidence that the neurotoxic, enterotoxic, and cytotoxic activities are due to one toxin. J Immunol 1983; 130: 380–4. 6. O’Brien AD, Newland JW, Miller SF, et al. Shiga-like toxinconverting phages from Escherichia coli strains that cause hemorrhagic colitis or infantile diarrhea. Science 1984; 226: 694–6. 7. O’Brien AD, Tesh VL, Donohue-Rolfe A, et al. Shiga toxin: biochemistry, genetics, mode of action, and role in pathogenesis. Curr Top Microbiol Immunol 1992; 180: 65–94. 8. O’Loughlin E, Robins-Browne RM. Effect of Shiga toxins on eukaryotic cells. Microbes Infect 2001; 3: 493–507. 9. Frankel G, Phillips AD, Rosenshine I, et al. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol Microbiol 1998; 30: 911–21. 10. Schmidt H, Beutin L, Karch H. Molecular analysis of the plasmidencoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect Immunol 1995; 63: 1055–61. 11. Beutin L, Montenegro MA, Orskov I, et al. Close association of verotoxin (Shiga-like toxin) production with enterohemolysin production in strains of Escherichia coli. J Clin Microbiol 1989; 27: 2559–64. 12. Tarr PI, Neill MA, Clausen CR, et al. Escherichia coli O157:H7 and the hemolytic uremic syndrome: importance of early cultures in establishing the etiology. J Infect Dis 1990; 162: 553–6. 13. Wells JG, Davis BR, Wachsmuth IK, et al. Laboratory investigation of hemorrhagic colitis outbreaks associated with a rare Escherichia coli serotype. J Clin Microbiol 1983; 18: 512–20. 14. Smith HR, Rowe B, Gross RJ, Fry NK, Scotland SM. Haemorrhagic colitis and Verocytotoxin-producing Escherichia coli in England and Wales. Lancet 1987; i: 1062–5. 15. Farmer JJ, III, Davis BR. H7 antiserum-sorbitol fermentation medium: a single tube screening medium for detecting Escherichia coli O157:H7 associated with hemorrhagic colitis. J Clin Microbiol 1985; 22: 620–5. 16. Elliott EJ, Robins-Browne RM, O’Loughlin EV, et al. Nationwide study of haemolytic uraemic syndrome: clinical, microbiological, and epidemiological features. Arch Dis Child 2001; 85: 125–31. 17. Ratnam S, March SB, Ahmed R, Bezanson GS, Kasatiya S. Characterization of Escherichia coli serotype O157:H7. J Clin Microbiol 1988; 26: 2006–12. 18. Beutin L, Zimmermann S, Gleier K. Rapid detection and isolation of Shiga-like toxin (Verocytotoxin)-producing Escherichia coli by direct testing of individual enterohemolytic colonies from washed sheep blood agar plates in the VTEC-RPLA assay. J Clin Microbiol 1996; 34: 2812–4. 19. Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxinproducing Escherichia coli infections. Clin Microbiol Rev 1998; 11: 450–79. 20. Paton AW, Paton JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol 1998; 36: 598–602. 21. Slutsker L, Ries AA, Greene KD, et al. Escherichia coli O157:H7 diarrhea in the United States: clinical and epidemiologic features. Ann Intern Med 1997; 126: 505–13. 22. Bettelheim KA, Thompson CJ. New method of serotyping Escherichia coli: implementation and verification. J Clin Microbiol 1987; 25: 781–6. 23. Marques LRM, Moore MA, Wells JG, Wachsmuth IK, O’Brien AD. Production of Shiga-like toxin by Escherichia coli. J Infect Dis 1986; 154: 338–41. 24. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989. 25. Perna NT, Plunkett G, Burland V, et al. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 2001; 409: 529–33. 26. Lo´pez EL, Contrini MM, De Rosa MF. Epidemiology of shiga toxinproducing Escherichia coli in South America. In: Kaper JB, O’Brien AD, editors. E. coli O157:H7 and Other Shiga Toxin-Producing E. coli Strains. Washington, DC: American Society for Microbiology, 1998; 30–7. 27. Caprioli A, Tozzi AE. Epidemiology of shiga toxin-producing Escherichia coli infections in continental Europe. In: Kaper JB,
ENTEROHAEMORRHAGIC E. COLI
O’Brien AD, editors. E. coli O157:H7 and Other Shiga ToxinProducing E. coli Strains. Washington, DC: American Society for Microbiology, 1998; 38–48. 28. Robins-Browne RM, Elliott E, Desmarchelier P. Shiga toxin-producing Escherichia coli in Australia. In: Kaper JB, O’Brien AD, editors. E. coli O157:H7 and Other Shiga Toxin-Producing E. coli Strains. Washington, DC: American Society for Microbiology, 1998; 66–72. 29. Ong J, Zhe L, Robins-Browne R, Gapes M, O’Loughlin EV. Prevalence of verocytotoxigenic Escherichia coli serotype O157:H7 in children with diarrhoea attending a Sydney hospital. J Paediatr Child Health 1993; 29: 185–7. 30. The OzFoodNet Working Group. Foodborne disease in Australia: incidence, notifications and outbreaks. Annual report of the OzFoodNet network, 2002. Communicable Diseases Intelligence 2003; 27: 209–43.
351
31. Wong CS, Jelacic S, Habeeb RL, Watkins SL, Tarr PI. The risk of the hemolytic-uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 infections. New Engl J Med 2000; 342: 1930–6. 32. Paton JC, Rogers TJ, Morona R, Paton AW. Oral administration of formaldehyde-killed recombinant bacteria expressing a mimic of the Shiga toxin receptor protects mice from fatal challenge with Shigatoxigenic Escherichia coli. Infect Immunol 2001; 69: 1389–93. 33. Boerlin P, McEwen SA, Boerlin-Petzold F, et al. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J Clin Microbiol 1999; 37: 497–503. 34. Mackenzie AM, Lebel P, Orrbine E, et al. Sensitivities and specificities of premier E. coli O157 and premier EHEC enzyme immunoassays for diagnosis of infection with verotxin (Shiga-like toxin)-producing Escherichia coli. The SYNSORB Pk Study investigators. J Clin Microbiol 1998; 36: 1608–11.