Detection of major food-borne pathogens in raw milk samples from dairy bovine and ovine herds in Iran

Accepted Manuscript Title: Detection of major food-borne pathogens in raw milk samples from dairy bovine and ovine herds in Iran Author: Fakhri Haghi Habib Zeighami Ghazale Naderi Ali Samei Shokoufeh Roudashti Shahin Bahari Paniz Shirmast PII: DOI: Reference:

S0921-4488(15)30043-2 http://dx.doi.org/doi:10.1016/j.smallrumres.2015.08.005 RUMIN 5010

To appear in:

Small Ruminant Research

Received date: Revised date: Accepted date:

8-7-2015 7-8-2015 9-8-2015

Please cite this article as: Haghi, Fakhri, Zeighami, Habib, Naderi, Ghazale, Samei, Ali, Roudashti, Shokoufeh, Bahari, Shahin, Shirmast, Paniz, Detection of major foodborne pathogens in raw milk samples from dairy bovine and ovine herds in Iran.Small Ruminant Research http://dx.doi.org/10.1016/j.smallrumres.2015.08.005 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Detection of major food-borne pathogens in raw milk samples from dairy bovine and ovine herds in Iran Running title: Major foodborne pathogens in raw milk samples Fakhri Haghi1 [email protected], Habib Zeighami1* [email protected], Ghazale Naderi2, Ali Samei2, Shokoufeh Roudashti2, Shahin Bahari2, Paniz Shirmast2 1

Department of Microbiology, Zanjan University of Medical Sciences, Zanjan, Iran

2

Student Research Center, Zanjan University of Medical Sciences, Zanjan, Iran

*Corresponding author: Tel: +982414240301, Fax: +982414249553.

1

Highlights

•

Consumption of homemade dairy products is a serious public health threat.

•

Brucella spp. is the most important food-borne pathogens.

•

PCR has been increasingly used for detection of foodborne pathogens.

2

Abstract

Food safety has emerged as an important global issue with international trade and public health implications. Bacterial pathogens are major etiological agents of diseases related to the consumption of dairy products and represent a major public health problem in developing countries. Fast and accurate diagnosis of food-borne pathogens using molecular methods such as polymerase chain reaction is very important for a positive outcome of eradication programs. A total of 60 individual raw milk samples were randomly collected from 4 dairy bovine and ovine herds and investigated the presence and the frequency of Listeria monocytogenes, Campylobacter jejuni, Coxiella burntii, Mycobacterium tuberculosis complex and Brucella spp. Overall, 36 (60%) milk samples were positive for the presence of at least one selected foodborne pathogens. The most prevalent pathogen in milk samples was Brucella spp. (53.3%), followed by M. tuberculosis complex (13.3%) and C. burnetii (11.6%). No L. monocytogenes and C. jejuni were detected from any of the milk samples in our study. C. burnetii was detected with slightly higher frequency in bovine samples (8.3%) than in ovine milk samples (3.3%). Moreover, nine (14.9%) bovine milk samples were contained simultaneously more than one pathogen. These evidences reinforce the need to optimize quality programs of dairy products, to intensify the sanitary inspection of these products and the necessity of further studies on the presence of these pathogens in milk and milk products.

Keywords: Food-borne Pathogen; Raw Milk; Bovine; Ovine; PCR

3

Introduction The traditional consumption of homemade dairy products composed of raw milk poses a serious public health threat (Di Pinto et al., 2006). Bacterial pathogens are major etiological agents of diseases related to the consumption of dairy products, accounting for 90% of all cases (Marília Masello Junqueira et al., 2013). Among the bacterial pathogens, Brucella spp., Listeria monocytogenes, Campylobacter jejuni, Coxiella burntii, Staphylococcus aureus, Salmonella spp. and Mycobacterium tuberculosis complex are the most important food-borne pathogens and represent a major public health problem worldwide. Although, governmental surveillance of milk pasteurization and sanitation in dairy processing plants was performed in Iran for many years, direct sale of unpasteurized milk and dairy products from producers to the consumer is not uncommon in many regions including Zanjan province. Therefore, it is essential to gather information about microbial risk factors and hazards associated with raw milk production. Risk assessment and microbial monitoring will continue to play important role in quality assurance of milk and milk-related products (Xiaofeng et al., 2007; Konosonoka et al., 2012). The culture based approaches for diagnosis of these pathogens are quite laborious and many times remain inconclusive (Singh et al., 2012). However, PCR has been increasingly used for the rapid, sensitive, direct and specific detection of foodborne pathogens (Khan et al., 2013). Brucellosis is the most widespread zoonotic disease transmitted from animals by direct contact with animal products or through consumption of unpasteurized milk and milk products (Tina et al., 2013; Gupta et al., 2006; Kamal et al., 2013). Brucellosis causes infertility and abortion in bovines and undulant fever in humans (Mukherjee et al., 2007). Although eradication programs are being applied in several countries, brucellosis remains a public health problem with severe economic consequences in developing countries (Jafar et al., 2014). 4

C. jejuni is a leading cause of acute bacterial gastrointestinal infection worldwide (Feizabadi et al., 2007). Campylobacter associated gastroenteritis is thought to occur through zoonotic transmission, being acquired from exposure to tainted food and/or contaminated drinking water. Several food-borne outbreaks have been associated with the consumption of unpasteurized milk (Josiane da et al., 2012). L. monocytogenes is an important agent of food-borne diseases and listeriosis is associated with the highest case mortality rate of 30% approximately, unlike infection with other common foodborne pathogens, such as Salmonella, which rarely results in fatalities (Khan et al., 2013). Milk plays important role in L. monocytogenes epidemiology (Konosonoka et al., 2012). C. burnetii is the causative agent of Q fever, an important zoonotic disease with worldwide distribution. Cats and farm animals (cattle, sheep and goat) are identified as sources of human infection (Rahimi et al., 2010). C. burnetii is mainly shed during and after parturition or abortion in birth products but shedding also occurs in urine, faeces, vaginal mucus and milk (van den Brom et al., 2013). Humans are usually infected by inhalation of aerosol and dust containing C. burnetii in a contaminated environment. Unpasteurized milk or milk products may contain virulent C. burnetii and Q fever can be transmitted through consumption of these products (Khalili et al., 2015). Tuberculosis in cattle, the most important known source of human food-borne tuberculosis is predominantly associated with M. tuberculosis complex (Messelhäusser et al., 2011). These microorganisms are highly able to survive in milk and transmitted by milk and dairy products (Marília Masello Junqueira et al., 2013).

5

The objective of the present study was to investigate the presence and the frequency of major food-borne pathogens L. monocytogenes, C. jejuni, C. burntii, M. tuberculosis complex and Brucella spp in raw milk samples collected from 4 dairy herds in Zanjan, Iran. 1. Materials and Methods

1.1.

Collection of milk samples

In this cross-sectional study, a total of 60 individual unpasteurized milk samples (one sample per animal) including 38 bovine and 22 ovine samples were collected from 4 dairy farms in different rural areas in Zanjan, Iran from Jun to August 2014. The animals whose milk samples collected for this study were clinically healthy and the milk samples showed physical (color, pH, and density) consistency. Milk samples were taken under forceful hygienic conditions and immediately transported to the laboratory in a cooler with ice packs and stored at -20°C.

1.2.

Reference strains

The following reference strains were used as positive controls: Listeria monocytogenes ATCC 7644, Campylobacter jejuni ATCC 27853, Bacillus Calmette-Guerin (BCG) strain ATCC 27289, Coxiella burnetii Nine Mile phase I/ RSA 493 and Brucella abortus 544 (ATCC23448). 1.3.

Extraction of genomic DNA from milk samples

6

DNA extraction and purification was performed using the protocol described previously (Gupta et al., 2006). Briefly, 50-ml frozen milk samples were thawed at room temperature and centrifuged at 12,000 × g for 5 min. After removing the cream and milk layers, the precipitate was mixed with 100 µl of TE buffer (1 mM EDTA and 10 mM Tris-HCl; pH 7.6). To that mixture, 100 µl of 24% sodium dodecyl sulfate was added as a denaturing agent. The mixture was incubated at 100°C for 10 min and then cooled on ice. Proteinase K (650 µg/mL) was added and the mixture was kept at 37°C for 1h. The cell debris was removed by precipitation with 5 M NaCl and hexadecyltrimethylammonium bromide-NaCl (CTAB-NaCl) solution at 65°C for 10 min. Deoxyribonucleic acid was extracted by standard methods with a phenol-chloroform-isoamyl alcohol mixture (25:24:1), and then precipitated with isopropanol, washed with ethanol, and dried under vacuum. The DNA pellet was dissolved in 30 µl of sterile distilled water and stored at 20°C until further use. 2.4 Detection of pathogenic bacteria by PCR All milk samples were screened for direct detection of L. monocytogenes, C. jejuni, Brucella spp, C. burnetii and M. tuberculosis complex using the primers listed in Table 1. PCR assays were performed using the protocols described previously (Mukherjee et al., 2007; Carvalho et al., 2014; Abd El-Malek et al., 2010) for the detection of the following markers: IS6110 (specific insertion sequence of M. tuberculosis complex); bcsp31 (genus specific Brucella cell surface salt extractable protein); prfA (virulence regulator of L. monocytogenes) and hipO (hippurate hydrolase of C. jejuni). Previous studies showed that the com1 gene encoding a 27-kDa outer membrane protein (OMP) is highly conserved among C. burnetii strains isolated from a variety of clinical and geographical sources (Zhang et al., 1998). In the present study, we have 7

developed a useful nested PCR assay based on the com1 gene sequence for the detection of C. burnetii in milk samples. Single PCR was performed using DreamTaq PCR Master Mix (Fermentase), which contains Taq polymerase, dNTPs, MgCl2 and the appropriate buffer. Each PCR tube contained 25 µl reaction mixture composed of 12.5 µl of the master mix, 2.5 µl of each forward and reverse primer solution (in a final concentration of 200 nM), 3 µl of DNA and nuclease-free water to complete the final volume. PCR was performed using the Gene Atlas 322 system (ASTEC). Amplification involved an initial denaturation at 94°C, 5 min followed by 30 cycles of denaturation (94°C, 1 min), annealing (49°C, 1 min for hipO; 54°C, 1 min for prfA; 55°C, 1 min for com1 and com2; 60°C, 1 min for bcsp31; 65°C, 1 min for IS6110) and extension (72°C, 1 min), with a final extension step (72°C, 8 min). The amplified DNA was separated by submarine gel electrophoresis on 1.5% agarose, stained with ethidium bromide and visualized under UV transillumination. 2. Results and Discussion Fast and accurate diagnosis of food-borne pathogens is very important for a positive outcome of eradication programs. PCR is a promising alternative for the problematic culturing and identification of these pathogens by conventional techniques (Singh et al., 2012; Khan et al., 2013). In this study, a total of 60 individual raw milk samples including 38 bovine and 22 ovine samples were studied. Overall, 36 (60%) milk samples were positive for the presence of at least one selected food-borne pathogens: 25 of 38 (65.8%) bovine milk samples and 11 of 22 (50%) ovine milk samples were positive (Fig 1). Distribution of each food-borne pathogen in bovine and ovine milk samples is shown in Table 2. The most prevalent pathogen in milk samples was

8

Brucella spp. (53.3%), followed by M. tuberculosis complex (13.3%) and C. burnetii (11.6%). The frequency of Brucella spp. in bovine and ovine milk samples was 38.3% and 15%, respectively. Brucellosis still remains as one of the major zoonotic diseases in developing countries. Early detection of Brucella spp. in milk products is important for the effective control of the disease (Ilhan et al., 2008). In our study, the frequency of Brucella spp. in milk samples was higher than some previous studies. According to Ilhan et al (Ilhan et al., 2008), Hamdy et al (Hamdy et al., 2002) and Abbas et al (Abbas and Aldeewan., 2009), the prevalence of Brucella spp. was 7.8%, 51.4% and 14.7%, respectively. This difference in Brucella prevalence may be due to the diagnostic approaches used for detection of Brucella spp., type of specimens, the geographical region and etc. According to previous studies, the PCR based assays were detected higher number of positive milk samples than cultural methods (Ilhan., 2008). No L. monocytogenes and C. jejuni were detected from any of the milk samples in our study. As reported by previous studies, the prevalence of L. monocytogenes in bulk tank milk samples has ranged from 0 to 5% (Jami et al., 2010). Similar to our results, in a few studies conducted in other parts of Iran, the incidence of L. monocytogenes in milk and dairy products was reported 0% in center and 1.6% in west of Iran (Mahmoodi., 2010). It is assumed that Campylobacter spp. in raw milk derive most commonly from secondary fecal contamination during the milking process. Poor pretreatment of the teats with disinfectant or contact of the milking cluster with the parlor floor may result in higher levels of fecal Campylobacter contamination. A few publications reported Campylobacter contamination of milk as a result of udder infection (Bianchini et al., 2014). In a study carried out in Italy, C. jejuni was detected in 12% of the examined bulk tank milk samples (Bianchini et al., 2014). Stanley and Jones described an

9

incidence between 3.8 and 8.1% in the United Kingdom and Yang et al. recovered C. jejuni from 27.3% of the bulk tank milk in China (Bianchini et al., 2014). In our study, M. tuberculosis complex was detected only in the bovine milk samples (13.3%). Previous studies have addressed the identification of Mycobacteria in milk samples collected from both individual and collective bulk tanks. In a study carried out in Brazil, Mycobacterium spp. was detected from 8% of bovine milk samples (Marília Masello Junqueira et al., 2013). Zoonotic tuberculosis in human is attributed mainly to M. bovis and occasionally to M. tuberculosis, which is mainly transmitted through milk. Therefore, certain habits, such as the consumption of raw bovine milk, may predispose individuals to these infections (Marília Masello Junqueira et al., 2013). According to our results, C. burnetii was detected with slightly higher frequency in bovine samples (8.3%) than in ovine milk samples (3.3%). The difference between the prevalence of C. burnetii in bovine and ovine milk samples may be due to the different routes of shedding in these animals. Ovine shed C. burnetii mainly in feces and vaginal mucus, whereas bovine shed mainly in milk Furthermore, the infected animals may not persistently shed C. burnetii. Shedding of C. burnetii by infected animals occurs mainly during parturition and lactation. Therefore, detection of C. burnetii in milk greatly depends on the sampling time. The use of repeated sampling can reduce the likelihood of falsely classifying a herd as C. burnetii negative (Rahimi et al., 2010; van den Brom et al., 2013). In previous studies conducted in Iran, a total 18.2% of dairy herds in Fars, 4.2% in Khuzestan and 5.5% in Yazd were infected with C. burnetii (Khalili et al., 2015). Nine (14.9%) bovine milk samples were contained simultaneously more than one pathogen (Table 1): four samples were positive for C. burnetii and Brucella spp (6.6%), three samples for

10

Brucella spp. and M. tuberculosis complex (5%) and two samples for Brucella spp. and M. tuberculosis complex and C. burnetii (3.3%). The application of PCR for the direct detection of pathogens in milk has been limited by the complex composition of the starting material, which may contain inhibitors for PCR amplification. The presence of a divalent cation (Mg2+ and/or Ca2+) can inhibit DNA polymerase, and the presence of proteins and fat globules can obstruct the accessibility of DNA polymerase to the DNA template. Furthermore, the abundance of host epithelial cells in milk could make the bacterial DNA a very small fraction of the total DNA extracted from the sample (Carvalho, R.C.T., 2014). Despite these difficulties, the extraction method reported in the present study produced DNA from milk samples, which can be used as a template for a PCR assay. Furthermore, the findings of this study are limited to PCR-based detection of bacterial DNA in milk samples, so we are unable to speculate on the viability of organisms in milk samples, or on the sensitivity and specificity of PCR assay compared to other diagnostic methods. Raw milk is offered for sale in some market place in Zanjan. Therefore it is essential to gather information about microbial risk factors and hazards associated with raw milk production. In conclusion, critical control point management programmes created for individual milk production farms based upon risk analysis, total quality management and critical control point principles such as pasteurization and sanitary treatment of milk are essential for obtaining safe and healthy milk for consumers and for processing.

11

Acknowledgement The authors gratefully acknowledge the technically assistance provided by the Department of Microbiology Zanjan University of Medical Sciences for the procurement of PCR instrument. Conflict of Interest The authors declare that they have no conflict of interest.

12

References Abbas, B.A., Aldeewan. A.B., 2009. Occurance and epidemiology of Brucella spp in raw milk samples at Basrah province, Iraq. Bulg. J. Vet. Med. 12(2), 136-42. Abd El-Malek, A.M., Fathi Hassan Ali, S., Hassanein, R., Abdelazeem Mohamed, M., Ibrahim Elsayh, K., 2010. Occurrence of Listeria species in meat, chicken products and human stools in Assiut city, Egypt with PCR use for rapid identification of Listeria monocytogenes. Vet. World. 3(8), 353-359. Bianchini, V., Borella, L., Benedetti, V., Parisi, A., Miccolupo, A., Santoro, E., Recordati, C. and Luini, M., 2014. Prevalence in Bulk Tank Milk and Epidemiology of Campylobacter jejuni in Dairy Herds in Northern Italy. Appl. Environ. Microbiol. 80,1832-37. Carvalho, R.C.T., Castro, V.S., Fernandes, DV.GS., Moura, G., Soares, E.S., Figueiredo, EES., Paschoalin, V.MF., 2014. Use of PCR for detection of bovine tuberculosis bacillus in milk of positive skin test cows. Braz. J. Vet. Res. Anim. Sci. 51(1), 42-48. Di Pinto, A., Ciccarese, G., Forte, T.V., Bijo, B., Shehu, F., Tantillo, G., 2006. Detection of mycobacterium tuberculosis complex in milk using polimerase chain reaction (PCR). Food Control. 17, 776–780. Feizabadi, M.M., Dolatabadi, S., Zali, MR., 2007. Isolation and drug resistant patterns of Campylobacter strains cultured from diarrheic children in Tehran. Jpn. J. Infect. Dis. 60, 217219. Ghorbanalizadgan, M., Bakhshi, B., Kazemnejad Lili, A., Najar-Peerayeh, S., Nikmanesh, B., 2014. A Molecular Survey of Campylobacter jejuni and Campylobacter coli Virulence and Diversity. Iran Biomed. J. 18 (3), 158-164. Gupta, V.K., Deepak, K.V., Rout, P.K., Singh, S.V., Vihan, V.S., 2006. Polymerase chain reaction (PCR) for detection of Brucella melitensis in goat milk. Small Ruminant Res. 65, 79–84. Hamdy, M.ER., Amin, A.S., 2002. Detection of Brucella species in the milk of infected cattle, sheep, goats and camels by PCR. Vet. J. 163, 299-305. Ilhan, Z., Solmaz, H., Aksakal, A., Gulhan, T., Ekin, I.H., Boynukara, B., 2008. Detection of Brucella melitensis DNA in the milk of sheep after abortion by PCR assay. Arch. Med. Vet. 40, 141-146. Jami, S., Jamshidi, A., Khanzadi, S., 2010. The presence of Listeria monocytogenes in raw milk samples in Mashhad, Iran. I.J.V.R. 11(4), 33. Jafar, A.Q., AlMomin, S., Al-Mouqati, S.A., Kumar, V., 2014. Characterization and evaluation of an arbitrary primed Polymerase Chain Reaction (PCR) product for the specific detection of Brucella species. Saudi J. Biol. Sci. xxx, xxx–xxx. Josiane da, S.Q., Ila, F. NL., Havt, A., Prata, M. MG., Cavalcante, P.A., Medeiros, P. HQ. S., Cid, D.AC., Moraes, M. L., Rey, L.C., Soares, A.M., Mota, RM. S., Richard, BH. W., Guerrant, L., Lima, AA. M., 2012. Campylobacter jejuni infection and virulence associated genes in 13

children with moderate to severe diarrhoea admitted to emergency rooms in northeastern Brazil. J. Med. Microbiol. 61, 507–513. Kamal, I. H., Gashgari, B.A., Moselhy, S.S., Kumosani, T.A., Abulnaja, K.O., 2013. Two-stage PCR assay for detection of human brucellosis in endemic areas. BMC Infect. Dis.13, 145-49. Khan, J.A., Rathore, R.S., Khan, S., Ahmad, I., 2013. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method. Braz. J. Microbiol. 44(3), 751-758. Khalili, M., Ghobadian Diali, H., Norouzian Mirza, H., Mosavi, S.M., 2015. Detection of Coxiella burnetii by PCR in bulk tank milk samples from dairy caprine herds in southeast of Iran. Asian Pac. J. Trop. Dis. 5(2), 119-122. Konosonoka, I. H., Jemeljanovs, A., Osmane, B., Ikauniece, D. and Gulbe, G., 2012. Incidence of Listeria spp. in Dairy Cows Feed and RawMilk in Latvia. ISRN. Vet. Sci. Article ID 435187, 5 pages doi:10.5402/2012/435187. Mahmoodi, M.M., 2010. Occurance of Listeria monocytogenes in raw milk and dairy products in Noorabad, Iran. J. Anim. Vet. Adv. 9(1), 16-19. Marília Masello Junqueira, F., Paes, A.C., Ribeiro, M.G., de Figueiredo Pantoja, J.C., Barreto Santos, A.C., Miyata, M., Fujimura Leite, C.Q., Motta, R.G., Paganini Listoni, F.J., 2013. Occurrence of mycobacteria in bovine milk samples from both individual and collective bulk tanks at farms and informal markets in the southeast region of Sao Paulo, Brazil. BMC Vet. Res. 9, 85. Messelhäusser, U., Kämpf, P., Hörmansdorfer, S., Wagner, B., Schalch, B., Busch, U., Höller, C., Wallner, P., Barth, G., Rampp, A., 2011. Culture and Molecular Method for Detection of Mycobacterium tuberculosis Complex and Mycobacterium avium subsp. paratuberculosis in Milk and Dairy Products. Appl. Environ .Microbiol. 295–297. doi:10.1128/AEM.06322-11. Mukherjee, F., Jain, J., Patel, V., Nair. M., 2007. Multiple genus-specific markers in PCR assays improve the specificity and sensitivity of diagnosis of brucellosis in field animals. J. Med. Microbiol. 56, 1309–1316. Rahimi, E., Doosti, A., Ameri, M., Kabiri, E., Sharifian, B., 2010. Detection of Coxiella burnetii by Nested PCR in Bulk Milk Samples from Dairy Bovine, Ovine, and Caprine Herds in Iran. Zoonoses Public Health. 57, e38–e41. Singh, J., Virender, KB., Sunita, G., 2012. Simultaneous detection of Listeria monocytogenes and Salmonella spp. in dairy products using real time PCR-melt curve analysis. J. Food. Sci. Technol. 49(2), 234–239. Tina, S. L., Strain, E., Kase, A.J., 2013. Comparison of six commercial DNA extraction kits for detection of Brucella neotomae in Mexican and Central American-style cheese and other milk products. Food Microbiol. 34, 100-105.

14

Van den Brom, R., van Engelen, E., Vos, J., Luttikholt, SJ. M., Moll, L., Roest, HI. J., van der Heijden, HM. JF., Vellem, P., 2013. Detection of Coxiella burnetii in the bulk tank milk from a farm with vaccinated goats, by using a specific PCR technique. Small Ruminant Res. 110, 150– 154. Xiaofeng, R., Jiechao, Y., Guicheng, H., Guangxing, L., 2007. A hypothetic universal PCR: implication for the rapid detection of major pathogenic bacteria in milk. Life Sci. j. 4(2), 88 – 89. Zhang, G.Q., Nguyen, S.V., To, H., Ogawa, M., Hotta, A., Yamaguchi, T., Kim, H.J., Fukushi, H., Hirai, K., 1998. Clinical evaluation of a new PCR assay for detection of Coxiella burnetii in human serum samples. J. Clin. Microbiol. 36(1), 77- 80.

15

Figure Captions

Fig. 1. PCR amplification of reference strains and milk samples. M: molecular marker (100 bp DNA Ladder), Lane 1: Listeria monocytogenes ATCC 7644 (prfA), Lane 2: Brucella abortus 544 (ATCC23448) (bcsp31), Lane 3: Bacillus Calmette-Guerin (BCG) strain ATCC 27289 (IS6110), Lane 4: Coxiella burnetii Nine Mile phase I/ RSA 493 (com2), Lane 5: Campylobacter jejuni ATCC 27853 (hipO), Lane 6-12: positive and negative milk samples

16

Tables Table 1. Primers used in this study

Bacterial pathogen C. burnetii

Target gene com1 com2

L. monocytogens

Brucella spp

C. jejuni

M. tuberculosis complex

Primer sequence (5'

3')

AGTAGAAGCATCCCAAGCATTG TGCCTGCTAGCTGTAACGATTG GAAGCGCAACAAGAAGAACAC TTGGAA GTTATCACGCAGTTG

Amplicon size (bp) 501

Ref. Zhang, G.Q., et al

438

Zhang, G.Q., et al

prfA

TCATCGACGGCAACCTCGG TGAGCAACGTATCCTCCAGAGT

217

Abd El-Malek, A.M., et al.

bcsp31

TGGCTCGGTTGCCAATATCAA CGCGCTTGCCTTTCAGGTCTG

223

Mukherjee, F., et al.

hipO

GAAGAGGGTTTGGGTGGTG AGCTAGCTTCGCATAATAACTTG

735

Ghorbanalizadgan, M., et al.

IS6110

CGTGAGGGCATCGAGGTGGC GCGTAGGCGTCGGTGACAAA

245

Carvalho, R.C.T., et al.

17

Table 2. Distribution of food-borne pathogens in bovine and ovine milk samples.

No

Milk samples

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Ovine Ovine Ovine Ovine Ovine Ovine Ovine Ovine Ovine Ovine Ovine Ovine Ovine Ovine Ovine Bovine Bovine Bovine Bovine Bovine Ovine Ovine Ovine Ovine Ovine Ovine Ovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine

C. burnetii

Brucella spp

L. monocytogenes

C.jejuni

com2 ─ ─ ─ ─ ─ ─ + + ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ + ─ ─ + ─ ─ ─ + ─ ─ + ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ + ─ ─ ─ ─ ─ ─ ─ ─ ─

bcsp31 + ─ ─ ─ ─ ─ ─ ─ ─ + ─ ─ ─ ─ ─ + ─ ─ ─ ─ + + + + + + + ─ + + + ─ + + + + + + ─ + + ─ + ─ + + + ─ + + + + ─ ─ + ─ + ─ ─ +

prfA ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ 18─ ─ ─ ─ ─

hipO ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─

M.tuberculosis complex IS6110 ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ + ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ ─ + + ─ ─ ─ ─ + ─ ─ ─ ─ ─ ─ ─ + ─ + ─ ─ ─ ─ ─ + +