- Email: [email protected]
Detection of Mycobacterium leprae by Three-Primer PCR
Immunobiol., vol. 191, pp. 351-353 (1994)
I[)
1994 by Gustav fisch er Veriag, Stuttgart
Department of Immunology and Cell Biology, Forschungsinstitut Borstel, Germany
Detection of Mycobacterium /eprae by Three-Primer
peR
ELVIRA RI CHTER, MICHAEL DucHRow, CARSTEN SCHLUTER, MARGRIT HAHN, HANS-D. Fl.AD, and JOHANN ES GERDES
Abstract Recently, polymerase chain reaction has been introduced for the species-s pecific assessment of Mycobacterium leprae (1). To avoid Southern blotting techniques using radioactively labelled oligonucleotide probes, the aim of this study was to establish a three primer-based single-step PCR techniqu e. Using primers designed for this purpose we amplified a part of the gene encoding for the 16S ribosomal RNA of slowly growing mycobacteria. Due to th e species-specific antisense primer a second, smaller fragment specific for M. leprae was amplified. Our results show th at the employment of a second antisense primer in th e PC R may be a substitution for Southern blot hybridization.
Introduction Mycobacterial infections still represent a major health problem . This is not only true for tuberculosis and leprosy, but also for atypical mycobacterial infections which gain increasing clinical importance as opportunistic infections after HIV infection. Thus, there is an objective need for speciesspecific diagnosis of a given mycobacterial infection. Routine histopathological diagnosis, however, is limited to the detection of «acid fast bacilli ». Recently our group established a poly merase chain reaction (PCR) method for the species-specific assessment of M. leprae (1). We amplified parts of the gene encoding for the 16S ribosomal RNA (rRNA) by using primer pairs proposed by EDWARD et al. (2). Species-specificity was determined by Southern blot hybridization using a 16S rRNA probe specific for M. leprae (1). The latter method suffers from the inherent drawback of being time-consuming and from the need to use radioactively labelled Abbreviation: peR = polymerase chain reaction
352 . E. RICHTER et al. probes. Thus, the aim of this study was to establish a single-step polymerase chain reaction for species-specific detection of M. leprae.
Materials and Methods Bacterial strains and preparation of bacterial DNA
All mycobacterial strains were a generous gift of Dr. ROSCH-GERDES (Forschungsinstitut Borstel) except M. leprae, which were purified from infected armadillo liver and kindly provided by Dr. M. HAAS (Forschungsinstitut Borstel). About 106 mycobacteria were suspended in one milliliter of distilled water. Subsequently 300 [11 of this suspension were subjected to a series of heat/cold shocks, alternately boiling for one minute at 95 DC and snap-freezing for one minute in liquid nitrogen. This procedure was repeated five times. Polymerase chain reaction
To establish a single-step PCR for the species-specific assessment of mycobacteria, we used the principles of confirmation of PCR products detailed by KAI et al. (3). For this purpose we chose three primers: a conserved 5' primer (pI), AGAGTTTGATCCTGGCTCAG (2). As 3' primers we selected two sequences, one specific for most slowly growing mycobacteria (p5), ACCGTCAATCCGAGAGAACC and another specific for M. leprae (pL), CACAAGACATGCGCCTTGAA. All three primers were used in a single PCR reaction. Primer pair 1/5 amplifies a 479 bp fragment, while the second antisense primer (pL) targets a species-specific sequence inside the 479 bp fragment, resulting in a second fragment of 204 bp. The PCR was performed with 1 fd template in a total volume of 100 [11, containing 30 mM tricine, pH 8.4, 2 mM MgClb 5 mM ~-mercaptoethanol, 0.01 % gelatin, 0.1 % thesit, 200 [1M of each dNTPs, 1 [1M of primers 1 and 5, 0.1 [1M of the M. leprae-specific primer, and 2.5 U Taq polymerase. PCR was performed in a thermocycler (Perkin-Elmer Cetus, Norwalk, CT, USA). The thermal profile involved 35 cycles of denaturation at 94 DC for two minutes, primer annealing at 57 DC for two minutes and extension at 72 DC for three minutes. During the last cycle reaction mixtures were incubated 15 minutes at 72 DC to complete any unfinished single-stranded products. 10 [11 of the PCR samples were separated by 1 % agarose gel electrophoresis, and DNA was visualized by ethidium bromide staining.
Results and Discussion Figure 1 demonstrates a characteristic result of our new three primer-based peR technique for the species-specific detection of M. leprae. The 479 bp amplificate could only be detected in slowly growing mycobacteria, in which the 165 rRNA molecule is characterized by a long helix 18 (4). None of the fast growing mycobacteria species tested nor the Nocardia species were positive. The 204 bp fragment was amplified exclusively with M. leprae DNA (lane 9). The sequence of the 479 bp fragment as determined by cycle sequencing on an automated laser fluorescent (A.L.F.) DNA sequencer (Pharmacia, Freiburg, Germany) proved to be identical with the expected M. leprae-specific sequence recently published (4) (data not shown), clearly indicating that a species-specific assessment of M. leprae is
PCR for Mycoba cterium leprae . 353
1 2 3 4 5
6 7 8 9 1011121314
Figure I . Specificity of three primer-based PCR for Mycobacterium leprae. Agarose gel electrophoresis of PCR products: lane 1: molecular weight marker, lane 2: Nocardia species, lane J: Mycobacterium chelonae, lane 4 : M. Jortuitum, lane 5: M. xenopi, lane 6: M. gordonae, lane 7: M. kansasii, lane 8: M. marinum, lane 9: M. leprae, lane 10: M. avium, lane 11: M. intracellulare, lane 12: M. tuberculosis, lane 13: negative control (without template), lane 14: molecular weight marker.
possible with our new method. Since the gene for 16S rRNA is essential for all mycobacteria, this PCR protocol may also be applied for the detection of mycobacteria other than M. leprae. The employment of a second antisense primer in the PCR may thus be able to substitute for Southern blot hybridization. Acknowledgments This work was supported in part by the German Leprosy Relief Association and the Deutsche Forschungsgemeinschaft SFB 367, Project C1.
References 1. AR NOLDI , J., C. SCHL OTER, M. D UCHROW, L. HO BNER, M. ERNST, A. T ESKE, H.-D. FLAD, J. GERDES, and E. C. BOTTGER. 1992. Species-specific assessment of Mycobacterium leprae in skin biopsies by in situ hybridization and polymerase chain reaction. Lab. Invest. 66: 618-623. 2. EDWARD, U ., T. ROGALL, H. Bl.OCKER, M . EMDE, and E. C. BOTTGER. 1989. Isolatio n and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucl. Acids Res. 17: 7843-7853. 3. KAI, M., S. KAMIY A, S. SAWAMURA, T. YAMAMOTO, and A. OZAWA. 1991. Simplified method for confirmation of PCR products. Nucl. Acids Res. 19: 4562 . 4. BOTTGER, E . C. 1991. Systematik, D ifferenzierung und Nachweis von bakteriellen Infektio nserregern - die Familie Mycobacteriaceae. lmmun. lnfekt. 19: 143-152.
Dr. JOHANNES GERD ES, Forschungsinstitut Borstel, Division of Molecular Immunology, Parkallee 22, 23845 Borstel, Germany
I[)
1994 by Gustav fisch er Veriag, Stuttgart
Department of Immunology and Cell Biology, Forschungsinstitut Borstel, Germany
Detection of Mycobacterium /eprae by Three-Primer
peR
ELVIRA RI CHTER, MICHAEL DucHRow, CARSTEN SCHLUTER, MARGRIT HAHN, HANS-D. Fl.AD, and JOHANN ES GERDES
Abstract Recently, polymerase chain reaction has been introduced for the species-s pecific assessment of Mycobacterium leprae (1). To avoid Southern blotting techniques using radioactively labelled oligonucleotide probes, the aim of this study was to establish a three primer-based single-step PCR techniqu e. Using primers designed for this purpose we amplified a part of the gene encoding for the 16S ribosomal RNA of slowly growing mycobacteria. Due to th e species-specific antisense primer a second, smaller fragment specific for M. leprae was amplified. Our results show th at the employment of a second antisense primer in th e PC R may be a substitution for Southern blot hybridization.
Introduction Mycobacterial infections still represent a major health problem . This is not only true for tuberculosis and leprosy, but also for atypical mycobacterial infections which gain increasing clinical importance as opportunistic infections after HIV infection. Thus, there is an objective need for speciesspecific diagnosis of a given mycobacterial infection. Routine histopathological diagnosis, however, is limited to the detection of «acid fast bacilli ». Recently our group established a poly merase chain reaction (PCR) method for the species-specific assessment of M. leprae (1). We amplified parts of the gene encoding for the 16S ribosomal RNA (rRNA) by using primer pairs proposed by EDWARD et al. (2). Species-specificity was determined by Southern blot hybridization using a 16S rRNA probe specific for M. leprae (1). The latter method suffers from the inherent drawback of being time-consuming and from the need to use radioactively labelled Abbreviation: peR = polymerase chain reaction
352 . E. RICHTER et al. probes. Thus, the aim of this study was to establish a single-step polymerase chain reaction for species-specific detection of M. leprae.
Materials and Methods Bacterial strains and preparation of bacterial DNA
All mycobacterial strains were a generous gift of Dr. ROSCH-GERDES (Forschungsinstitut Borstel) except M. leprae, which were purified from infected armadillo liver and kindly provided by Dr. M. HAAS (Forschungsinstitut Borstel). About 106 mycobacteria were suspended in one milliliter of distilled water. Subsequently 300 [11 of this suspension were subjected to a series of heat/cold shocks, alternately boiling for one minute at 95 DC and snap-freezing for one minute in liquid nitrogen. This procedure was repeated five times. Polymerase chain reaction
To establish a single-step PCR for the species-specific assessment of mycobacteria, we used the principles of confirmation of PCR products detailed by KAI et al. (3). For this purpose we chose three primers: a conserved 5' primer (pI), AGAGTTTGATCCTGGCTCAG (2). As 3' primers we selected two sequences, one specific for most slowly growing mycobacteria (p5), ACCGTCAATCCGAGAGAACC and another specific for M. leprae (pL), CACAAGACATGCGCCTTGAA. All three primers were used in a single PCR reaction. Primer pair 1/5 amplifies a 479 bp fragment, while the second antisense primer (pL) targets a species-specific sequence inside the 479 bp fragment, resulting in a second fragment of 204 bp. The PCR was performed with 1 fd template in a total volume of 100 [11, containing 30 mM tricine, pH 8.4, 2 mM MgClb 5 mM ~-mercaptoethanol, 0.01 % gelatin, 0.1 % thesit, 200 [1M of each dNTPs, 1 [1M of primers 1 and 5, 0.1 [1M of the M. leprae-specific primer, and 2.5 U Taq polymerase. PCR was performed in a thermocycler (Perkin-Elmer Cetus, Norwalk, CT, USA). The thermal profile involved 35 cycles of denaturation at 94 DC for two minutes, primer annealing at 57 DC for two minutes and extension at 72 DC for three minutes. During the last cycle reaction mixtures were incubated 15 minutes at 72 DC to complete any unfinished single-stranded products. 10 [11 of the PCR samples were separated by 1 % agarose gel electrophoresis, and DNA was visualized by ethidium bromide staining.
Results and Discussion Figure 1 demonstrates a characteristic result of our new three primer-based peR technique for the species-specific detection of M. leprae. The 479 bp amplificate could only be detected in slowly growing mycobacteria, in which the 165 rRNA molecule is characterized by a long helix 18 (4). None of the fast growing mycobacteria species tested nor the Nocardia species were positive. The 204 bp fragment was amplified exclusively with M. leprae DNA (lane 9). The sequence of the 479 bp fragment as determined by cycle sequencing on an automated laser fluorescent (A.L.F.) DNA sequencer (Pharmacia, Freiburg, Germany) proved to be identical with the expected M. leprae-specific sequence recently published (4) (data not shown), clearly indicating that a species-specific assessment of M. leprae is
PCR for Mycoba cterium leprae . 353
1 2 3 4 5
6 7 8 9 1011121314
Figure I . Specificity of three primer-based PCR for Mycobacterium leprae. Agarose gel electrophoresis of PCR products: lane 1: molecular weight marker, lane 2: Nocardia species, lane J: Mycobacterium chelonae, lane 4 : M. Jortuitum, lane 5: M. xenopi, lane 6: M. gordonae, lane 7: M. kansasii, lane 8: M. marinum, lane 9: M. leprae, lane 10: M. avium, lane 11: M. intracellulare, lane 12: M. tuberculosis, lane 13: negative control (without template), lane 14: molecular weight marker.
possible with our new method. Since the gene for 16S rRNA is essential for all mycobacteria, this PCR protocol may also be applied for the detection of mycobacteria other than M. leprae. The employment of a second antisense primer in the PCR may thus be able to substitute for Southern blot hybridization. Acknowledgments This work was supported in part by the German Leprosy Relief Association and the Deutsche Forschungsgemeinschaft SFB 367, Project C1.
References 1. AR NOLDI , J., C. SCHL OTER, M. D UCHROW, L. HO BNER, M. ERNST, A. T ESKE, H.-D. FLAD, J. GERDES, and E. C. BOTTGER. 1992. Species-specific assessment of Mycobacterium leprae in skin biopsies by in situ hybridization and polymerase chain reaction. Lab. Invest. 66: 618-623. 2. EDWARD, U ., T. ROGALL, H. Bl.OCKER, M . EMDE, and E. C. BOTTGER. 1989. Isolatio n and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucl. Acids Res. 17: 7843-7853. 3. KAI, M., S. KAMIY A, S. SAWAMURA, T. YAMAMOTO, and A. OZAWA. 1991. Simplified method for confirmation of PCR products. Nucl. Acids Res. 19: 4562 . 4. BOTTGER, E . C. 1991. Systematik, D ifferenzierung und Nachweis von bakteriellen Infektio nserregern - die Familie Mycobacteriaceae. lmmun. lnfekt. 19: 143-152.
Dr. JOHANNES GERD ES, Forschungsinstitut Borstel, Division of Molecular Immunology, Parkallee 22, 23845 Borstel, Germany