- Email: [email protected]
Detection of newly discovered KIs virus in India
Accepted Manuscript Title: Detection of newly discovered KIs virus in India Authors: Kavita Lole, Neeta Thorat, Dadasaheb Akolkar, Shweta Pingle PII: DOI: Reference:
S0168-1702(17)30638-X https://doi.org/10.1016/j.virusres.2017.09.021 VIRUS 97249
To appear in:
Virus Research
Received date: Revised date: Accepted date:
21-8-2017 25-9-2017 26-9-2017
Please cite this article as: Lole, Kavita, Thorat, Neeta, Akolkar, Dadasaheb, Pingle, Shweta, Detection of newly discovered KIs virus in India.Virus Research https://doi.org/10.1016/j.virusres.2017.09.021 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Detection of newly discovered KIs virus in India
Kavita Lole#1, Neeta Thorat1, Dadasaheb Akolkar2, Shweta Pingle1
Author affiliations 1Hepatitis
Division, National Institute of Virology, Microbial Containment Complex, Pune,
India 2Datar
Genetics Limited, F8, D-Road, Ambad, Nashik, India
#Corresponding author Kavita Lole, Scientist ‘E’, Hepatitis Division, National Institute of Virology, Microbial Containment Complex, Sus Road, Pashan, Pune 411021, India.
Tel: +91-20-25871194
Fax: +91-20-25871895
E-mail: [email protected]
1
Highlights
KIs virus is a putative new hepatitis virus 648 blood samples from India were screened for KIs-V One serum showed two closely related viruses This is the first evidence of KIs-V occurrence in India
Abstract
KIs virus (KIs-V) is a putative new hepatitis virus recently identified from Japan. Prevalence of this virus was found to be significantly higher in individuals with past exposure to hepatitis E virus and having moderately raised alanine aminotransferase levels. The present work was undertaken to see the circulation of this virus in India. Blood samples (n=648) collected during hepatitis E outbreaks from different states (1990–2014) were screened by PCR. One anti- HEV IgM positive serum was found to be positive for two closely related viruses, one with 100% and other with 94.4% homology withthe KIs-V sequence reported from Japan. This is the first evidence of KIs-V occurrence in India. Significance of association between KIs-V and hepatitis E virus still remains unanswered. Further studies are needed for understanding pathogenesis of KIs-V in humans.
Keywords: KIs-virus, Hepatitis E virus, alanine aminotransferase, fecal-oral transmission
2
The manuscript
Viral hepatitis is the disease of enormous public health importance worldwide. It can be caused due to hepatotropic viruses, A, B, C, D and E, which account for about 80-90% cases of hepatitis. However, 10-20% hepatitis cases still remain undiagnosed indicating possible existence of yet unidentified agents. KIs virus (KIs-V) is a putative new hepatitis virus recently identified from Japan (Satoh et al., 2011). KIs-V is an enveloped virus with circular double-stranded DNA genome of ~9,500 bp and the viral genome has very less homology with known viral sequences. In Japan, KIs-V prevalence was found to be significantly higher in individuals having past exposure to hepatitis E virus (HEV) (anti-HEV IgG positive). These individuals had moderately raised alanine aminotransferase (ALT) levels (Satoh et al., 2011). The present work was undertaken to see possible circulation of this virus in India. The human ethics committee at the National Institute of Virology (NIV), Pune, India approved the study (NIV/IHEC/2013/D-5161). Total 648 archived serum samples, collected during investigations of hepatitis E outbreaks (n=30) (year 1990 – 2014) by the NIV, were screened for KIs-V with PCR using previously reported primer sets (Satoh et al., 2011). Samples represented 14 Indian states as follows- Maharashtra, Kerala, Gujarat, Karnataka, Andhra Pradesh, Odisha, Tamilnadu, Madhya Pradesh, Uttar Pradesh, West Bengal, Meghalay, Assam, Bihar and Himachal Pradesh (Table 1). Anti-HEV IgG /IgM antibodies were detected by using in-house ELISA (Arankalle et al., 2007). HBsAg, anti-HAV antibodies and anti-HCV antibodies were tested using Abbott i 1000SR, ARCHITECT PLUS kits (Abbott Diagnostics Division, CA, USA). ALT levels were measured using SPAN
3
Diagnostics kit (India). Samples positive for HBsAg and anti-HCV antibodies were excluded from the study. For KIs-V detection, viral DNA was extracted from 200µl serum samples using QIAamp Blood DNA kit (QIAGEN, Hilden, Germany) and 5µl DNA was used as a template in PCR by using previously reported nested primer sets (101-C and N101-B, KS-2 and N101-D) (Satoh et al., 2011). Amplified DNA fragments were sequenced from both the strands by using Big dye terminator cycle sequencing kit (ABI, USA) and products were analyzed on ABI 3130X1 Genetic analyzer (Applied Biosystems, Foster City, USA). A single anti-HEV IgM positive blood sample from a patient with raised ALT (75 IU/L) from Reva, Madhya Pradesh, India, collected during hepatitis E outbreak in 1990 was found to be KIs-V positive. The sample was found negative for HEV RNA when tested by reverse transcription PCR (Arankalle et al., 2007). Sequencing chromatograms showed mixed peaks indicating presence of more than one species of viruses in the sample. For confirmation, the PCR product was TA-cloned (pGEM-T-EASY, Promega) and 10 representative clones were processed for sequencing. Phylogenetic analysis showed grouping of the clone sequences into 2 distinct clusters. First cluster showed 100% nucleotide homology with the KIs-V sequence and the second cluster showed ~86% nucleotide homology (GenBank accession No. AB550431) (Satoh et al., 2011) (figure 1). These results suggested presence of viral variants in the sample. To rule out possible origin of contaminant DNA from the extraction kit, 3 representative serum samples, including the KIs-V positive sample were processed for the extraction using two other viral DNA extraction methods as follows, i) DNAzol (Invitrogen, Carlsbad, USA) which does not have silica based extraction and, ii) RTP DNA/RNA Virus
4
Mini Kit (Stratec Molecular, Berlin, Germany). For the extraction with DNAzol, DNA was purified from 200µl serum as per the manufacturer’s instructions and the DNA pellet was resuspended in 50µl water. For the RTP kit, viral DNA was isolated from 100µl serum and eluted in 40 µl volume. Five microliter DNA, isolated from both the protocols was used as template for PCR using the above mentioned KIs-V primers. The KIs-V positive sample once again showed amplification of the KIs-V-specific fragment confirming presence of KIsV in the sample, while, 2 negative samples remained negative for KIs-V. Full genome sequencing of viral genomes was done by using Ion Proton system (Life technologies, USA). Briefly, 10ng sample DNA was processed for fragmentation using Ion Shear Plus Reagent Kit (Life technologies, USA), fragmented products were purified using AgencourtAmpure XP DNA reagent and ligated with Barcode adaptors. Products were purified, size selected, amplified and quantified. Clonal amplification was carried out by emulsion PCR and the Ion sphere particles were deposited on to Ion PI chip. All proton quality-approved, trimmed and filtered (against human genome) data were exported as BAM files for bioinformatics analysis. A total of 1981564 unmapped reads were quality filtered with mean quality score >=20, minimum length 20 and trimmed using PrinSeq-Lite program. Resulting 1745137 high quality reads were assembled using MIRA v4.0.2 assembler and contigs were annotated using BLASTn against NCBI database. From the 1745137 reads, 212290 reads uniquely mapped onto KIs-virus sequence with 100% coverage (9496 bp) of the KIs-V genome (GenBank accession No. AB550431). Generated consensus full genome sequence showed 100% homology to the Japanese KIs-V sequence. In addition, ~30% aligned reads showed 81-98% identity with the reported KIs-V sequence (BAM files, supplementary data) and these reads covered ~50% of the KIs-V genome.
5
Missing regions of the second viral genome were sequenced by using primer walking strategy. For that, 13 sets of forward and reverse primers were designed from the existing sequence (supplementary table 1) and amplification was carried out using template DNA extracted from the original serum sample. Amplicons were sequenced by using Sanger sequencing method and generated full genome sequence was aligned with the KIs-V sequence. Complete genome of the second virus, named as IND-KIs-Reva-1990-V was also of 9690 bp in length and showed 94.4% nucleotide homology to the KIs-V sequence. Sequence variations were not uniformly distributed in the new viral genome. When analyzed as 1kbp segments, variations in the genome ranged from 100%-78.1%. Some regions were found to be highly conserved (supplementary table 2). However, it is not possible to comment on significance of these sequence variations since KIs-V genome is not yet completely characterized. It is possible that variable regions in the genome could be important antigen encoding regions which are under host immune pressure. This sequence is deposited in GenBank with the Accession No. KU199684. To see the extent of positivity of the new virus in the above mentioned serum samples, 150 samples were randomly selected and screened by using another set of nested primers, specific for the new virus, KI6861F: 5’TGCTCCTGCCACTGCATCAC3’, KI7346R: 5’AAGTCTCGAAATATCACCATGTTCGTA3’, KI6899F: 5’CGGCTACGACATTGTATCCCGC3’, KI7302R: 5’CTTCGCCACAGGTGGAGCGG3’ (product size 360bp). None of these samples were positive for the virus indicating a very low prevalence of IND-KIs-Reva-1990-V in India, similar to KIs-V. Previously reported 4 complete KIs-V genomes from Japan were also identical sequences (Satoh et al., 2011). Surprisingly, positive sample from India also harbored
6
similar virus with 100% sequence homology to KIs-V, suggesting high sequence conservation of this virus and possibly high fidelity of the viral polymerase. New virus, INDKIs-Reva 1990-V, with 94.4% homology was also present in the same sample. Separation of viruses in to 2 distinct clusters and successful generation of complete genome sequence by primer walking strategy indicated independent existence of these 2 viruses in the sample and not because of the mutant variants of KIs-V. KIs-V-like viruses seem to have restricted occurrence as attempts to detect KIs-V in 576 French blood donors (Biagini et al., 2012) and in Italian plasma and cerebrospinal fluid samples (Macera et al., 2015) yielded negative results. Satoh et al have shown relatively higher prevalence of KIs-V infection in anti-HEV antibody positive persons in Japan. These individuals had moderately elevated ALT levels suggesting possible association of KIs-V with liver inflammation. They also proposed that HEV and KIs-V may have the same faecooral mode of transmission. Both Hepatitis A and E viruses are transmitted by faecal-oral route and are endemic in India (Acharya S. K., 2013). Hence we thought it would be appropriate to include both anti-HAV and anti-HEV positive serum samples for KIs-V screening. Selected sample categories included individuals who either had recent exposure (IgM positive) or past exposure (IgG positive) to HAV or HEV . Representative samples were also taken from individuals who were not exposed to HEV (anti-HEV IgM and IgG negative). The only sample that tested positive for KIs-V and IND-KIs-Reva 1990-V was anti-HEV IgM positive with moderately higher ALT levels (75 IU/ L). Though these findings are in agreement with the previous report, it is not possible to comment on the HEV and KIs-V association at this
7
juncture . However, our results indicate that KIs-V-like viruses are present in India, though to a very low extent. In conclusion, one sample out of 648 serum samples from India showed presence of 2 closely related KIs-V like viruses, one with 100% homology to the previously reported KIsV sequence from Japan and the other new virus (IND-KIs-Reva 1990-V) with 94.4% homology. Significance of the association between KIs-V and hepatitis E virus still remains unanswered. Further investigations need to be undertaken for understanding the natural history and pathogenesis of KIs-V in humans. Competing financial interests The authors declare no competing financial interests.
Acknowledgement The work described here was supported by Indian Council of Medical Research (ICMR) and National Institute of Virology (NIV), Pune, India. We are indebted to all the staff members of the hepatitis Group who were actively involved in collecting samples.
REFERENCES 1. Acharya SK. This is hepatitis: know it, confront it. Indian J Med Res 2013;138:8–10 2. Arankalle VA, Lole KS, Deshmukh TM, Chobe LP, Gandhe SS. Evaluation of human (genotype 1) and swine (genotype 4)-ORF2-based ELISAs for anti-HEV IgM and IgG detection in an endemic country and search for type 4 human HEV infections. J. Viral Hepat. 2007; 14: 435-445
8
3. Biagini P., Touinssi M., Galicher V., de Micco P. KIs virus and blood donors, France. Emerg. Infect. Dis. 2012; 18, 1374-1375 4. Macera L, Focosi D, Manzin A, Ceccherini Nelli L, Pistello M, Maggi F. Lack of KIs virus DNA in plasma and cerebrospinal fluid in Italy. New Microbiol. 2015; 38:593-4. 5. Satoh K., Iwata-Takahura A., Osada N., Yoshikawa A., Hoshi Y., Miyakawa K., Gotanda Y., Satake M., Tadokoro K., Mizoguchi H. Novel DNA sequence isolated from blood donors with high transaminase levels. Hepatol. Res. 2011; 41, 971-981
Figures
Figure 1: Phylogenetic analysis: The 304 nt amplicon was TA-cloned, and representative 10 clones were sequenced and compared with reported KIs-V sequence employing MEGA5 software with Jukes Cantor model Cl 5 Cl 8 63
Cl 6 Cl 2 Cl 12 Cl 11 KIs-V SEQUENCE Cl 4 Cl 14 100
Cl 13 Cl 7
0.005
Table: 1 Blood samples tested
9
Category
No. of Age range samples
ALT (IU/L)
Anti-HEV IgM +ve
106
10-82 yr
Raised
Anti-HEV IgG +ve
97 98 95
8-69 yr 7-69 yr 6-65 yr
Normal Raised Normal
Anti- HAV IgM +ve
66
3 month- 68 yr
Raised
20
3-40 yr
Normal
Anti-HEV -ve, HAV IgM -ve
98
6-94 yr
Raised
68
5-76 yr
Normal
10
S0168-1702(17)30638-X https://doi.org/10.1016/j.virusres.2017.09.021 VIRUS 97249
To appear in:
Virus Research
Received date: Revised date: Accepted date:
21-8-2017 25-9-2017 26-9-2017
Please cite this article as: Lole, Kavita, Thorat, Neeta, Akolkar, Dadasaheb, Pingle, Shweta, Detection of newly discovered KIs virus in India.Virus Research https://doi.org/10.1016/j.virusres.2017.09.021 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Detection of newly discovered KIs virus in India
Kavita Lole#1, Neeta Thorat1, Dadasaheb Akolkar2, Shweta Pingle1
Author affiliations 1Hepatitis
Division, National Institute of Virology, Microbial Containment Complex, Pune,
India 2Datar
Genetics Limited, F8, D-Road, Ambad, Nashik, India
#Corresponding author Kavita Lole, Scientist ‘E’, Hepatitis Division, National Institute of Virology, Microbial Containment Complex, Sus Road, Pashan, Pune 411021, India.
Tel: +91-20-25871194
Fax: +91-20-25871895
E-mail: [email protected]
1
Highlights
KIs virus is a putative new hepatitis virus 648 blood samples from India were screened for KIs-V One serum showed two closely related viruses This is the first evidence of KIs-V occurrence in India
Abstract
KIs virus (KIs-V) is a putative new hepatitis virus recently identified from Japan. Prevalence of this virus was found to be significantly higher in individuals with past exposure to hepatitis E virus and having moderately raised alanine aminotransferase levels. The present work was undertaken to see the circulation of this virus in India. Blood samples (n=648) collected during hepatitis E outbreaks from different states (1990–2014) were screened by PCR. One anti- HEV IgM positive serum was found to be positive for two closely related viruses, one with 100% and other with 94.4% homology withthe KIs-V sequence reported from Japan. This is the first evidence of KIs-V occurrence in India. Significance of association between KIs-V and hepatitis E virus still remains unanswered. Further studies are needed for understanding pathogenesis of KIs-V in humans.
Keywords: KIs-virus, Hepatitis E virus, alanine aminotransferase, fecal-oral transmission
2
The manuscript
Viral hepatitis is the disease of enormous public health importance worldwide. It can be caused due to hepatotropic viruses, A, B, C, D and E, which account for about 80-90% cases of hepatitis. However, 10-20% hepatitis cases still remain undiagnosed indicating possible existence of yet unidentified agents. KIs virus (KIs-V) is a putative new hepatitis virus recently identified from Japan (Satoh et al., 2011). KIs-V is an enveloped virus with circular double-stranded DNA genome of ~9,500 bp and the viral genome has very less homology with known viral sequences. In Japan, KIs-V prevalence was found to be significantly higher in individuals having past exposure to hepatitis E virus (HEV) (anti-HEV IgG positive). These individuals had moderately raised alanine aminotransferase (ALT) levels (Satoh et al., 2011). The present work was undertaken to see possible circulation of this virus in India. The human ethics committee at the National Institute of Virology (NIV), Pune, India approved the study (NIV/IHEC/2013/D-5161). Total 648 archived serum samples, collected during investigations of hepatitis E outbreaks (n=30) (year 1990 – 2014) by the NIV, were screened for KIs-V with PCR using previously reported primer sets (Satoh et al., 2011). Samples represented 14 Indian states as follows- Maharashtra, Kerala, Gujarat, Karnataka, Andhra Pradesh, Odisha, Tamilnadu, Madhya Pradesh, Uttar Pradesh, West Bengal, Meghalay, Assam, Bihar and Himachal Pradesh (Table 1). Anti-HEV IgG /IgM antibodies were detected by using in-house ELISA (Arankalle et al., 2007). HBsAg, anti-HAV antibodies and anti-HCV antibodies were tested using Abbott i 1000SR, ARCHITECT PLUS kits (Abbott Diagnostics Division, CA, USA). ALT levels were measured using SPAN
3
Diagnostics kit (India). Samples positive for HBsAg and anti-HCV antibodies were excluded from the study. For KIs-V detection, viral DNA was extracted from 200µl serum samples using QIAamp Blood DNA kit (QIAGEN, Hilden, Germany) and 5µl DNA was used as a template in PCR by using previously reported nested primer sets (101-C and N101-B, KS-2 and N101-D) (Satoh et al., 2011). Amplified DNA fragments were sequenced from both the strands by using Big dye terminator cycle sequencing kit (ABI, USA) and products were analyzed on ABI 3130X1 Genetic analyzer (Applied Biosystems, Foster City, USA). A single anti-HEV IgM positive blood sample from a patient with raised ALT (75 IU/L) from Reva, Madhya Pradesh, India, collected during hepatitis E outbreak in 1990 was found to be KIs-V positive. The sample was found negative for HEV RNA when tested by reverse transcription PCR (Arankalle et al., 2007). Sequencing chromatograms showed mixed peaks indicating presence of more than one species of viruses in the sample. For confirmation, the PCR product was TA-cloned (pGEM-T-EASY, Promega) and 10 representative clones were processed for sequencing. Phylogenetic analysis showed grouping of the clone sequences into 2 distinct clusters. First cluster showed 100% nucleotide homology with the KIs-V sequence and the second cluster showed ~86% nucleotide homology (GenBank accession No. AB550431) (Satoh et al., 2011) (figure 1). These results suggested presence of viral variants in the sample. To rule out possible origin of contaminant DNA from the extraction kit, 3 representative serum samples, including the KIs-V positive sample were processed for the extraction using two other viral DNA extraction methods as follows, i) DNAzol (Invitrogen, Carlsbad, USA) which does not have silica based extraction and, ii) RTP DNA/RNA Virus
4
Mini Kit (Stratec Molecular, Berlin, Germany). For the extraction with DNAzol, DNA was purified from 200µl serum as per the manufacturer’s instructions and the DNA pellet was resuspended in 50µl water. For the RTP kit, viral DNA was isolated from 100µl serum and eluted in 40 µl volume. Five microliter DNA, isolated from both the protocols was used as template for PCR using the above mentioned KIs-V primers. The KIs-V positive sample once again showed amplification of the KIs-V-specific fragment confirming presence of KIsV in the sample, while, 2 negative samples remained negative for KIs-V. Full genome sequencing of viral genomes was done by using Ion Proton system (Life technologies, USA). Briefly, 10ng sample DNA was processed for fragmentation using Ion Shear Plus Reagent Kit (Life technologies, USA), fragmented products were purified using AgencourtAmpure XP DNA reagent and ligated with Barcode adaptors. Products were purified, size selected, amplified and quantified. Clonal amplification was carried out by emulsion PCR and the Ion sphere particles were deposited on to Ion PI chip. All proton quality-approved, trimmed and filtered (against human genome) data were exported as BAM files for bioinformatics analysis. A total of 1981564 unmapped reads were quality filtered with mean quality score >=20, minimum length 20 and trimmed using PrinSeq-Lite program. Resulting 1745137 high quality reads were assembled using MIRA v4.0.2 assembler and contigs were annotated using BLASTn against NCBI database. From the 1745137 reads, 212290 reads uniquely mapped onto KIs-virus sequence with 100% coverage (9496 bp) of the KIs-V genome (GenBank accession No. AB550431). Generated consensus full genome sequence showed 100% homology to the Japanese KIs-V sequence. In addition, ~30% aligned reads showed 81-98% identity with the reported KIs-V sequence (BAM files, supplementary data) and these reads covered ~50% of the KIs-V genome.
5
Missing regions of the second viral genome were sequenced by using primer walking strategy. For that, 13 sets of forward and reverse primers were designed from the existing sequence (supplementary table 1) and amplification was carried out using template DNA extracted from the original serum sample. Amplicons were sequenced by using Sanger sequencing method and generated full genome sequence was aligned with the KIs-V sequence. Complete genome of the second virus, named as IND-KIs-Reva-1990-V was also of 9690 bp in length and showed 94.4% nucleotide homology to the KIs-V sequence. Sequence variations were not uniformly distributed in the new viral genome. When analyzed as 1kbp segments, variations in the genome ranged from 100%-78.1%. Some regions were found to be highly conserved (supplementary table 2). However, it is not possible to comment on significance of these sequence variations since KIs-V genome is not yet completely characterized. It is possible that variable regions in the genome could be important antigen encoding regions which are under host immune pressure. This sequence is deposited in GenBank with the Accession No. KU199684. To see the extent of positivity of the new virus in the above mentioned serum samples, 150 samples were randomly selected and screened by using another set of nested primers, specific for the new virus, KI6861F: 5’TGCTCCTGCCACTGCATCAC3’, KI7346R: 5’AAGTCTCGAAATATCACCATGTTCGTA3’, KI6899F: 5’CGGCTACGACATTGTATCCCGC3’, KI7302R: 5’CTTCGCCACAGGTGGAGCGG3’ (product size 360bp). None of these samples were positive for the virus indicating a very low prevalence of IND-KIs-Reva-1990-V in India, similar to KIs-V. Previously reported 4 complete KIs-V genomes from Japan were also identical sequences (Satoh et al., 2011). Surprisingly, positive sample from India also harbored
6
similar virus with 100% sequence homology to KIs-V, suggesting high sequence conservation of this virus and possibly high fidelity of the viral polymerase. New virus, INDKIs-Reva 1990-V, with 94.4% homology was also present in the same sample. Separation of viruses in to 2 distinct clusters and successful generation of complete genome sequence by primer walking strategy indicated independent existence of these 2 viruses in the sample and not because of the mutant variants of KIs-V. KIs-V-like viruses seem to have restricted occurrence as attempts to detect KIs-V in 576 French blood donors (Biagini et al., 2012) and in Italian plasma and cerebrospinal fluid samples (Macera et al., 2015) yielded negative results. Satoh et al have shown relatively higher prevalence of KIs-V infection in anti-HEV antibody positive persons in Japan. These individuals had moderately elevated ALT levels suggesting possible association of KIs-V with liver inflammation. They also proposed that HEV and KIs-V may have the same faecooral mode of transmission. Both Hepatitis A and E viruses are transmitted by faecal-oral route and are endemic in India (Acharya S. K., 2013). Hence we thought it would be appropriate to include both anti-HAV and anti-HEV positive serum samples for KIs-V screening. Selected sample categories included individuals who either had recent exposure (IgM positive) or past exposure (IgG positive) to HAV or HEV . Representative samples were also taken from individuals who were not exposed to HEV (anti-HEV IgM and IgG negative). The only sample that tested positive for KIs-V and IND-KIs-Reva 1990-V was anti-HEV IgM positive with moderately higher ALT levels (75 IU/ L). Though these findings are in agreement with the previous report, it is not possible to comment on the HEV and KIs-V association at this
7
juncture . However, our results indicate that KIs-V-like viruses are present in India, though to a very low extent. In conclusion, one sample out of 648 serum samples from India showed presence of 2 closely related KIs-V like viruses, one with 100% homology to the previously reported KIsV sequence from Japan and the other new virus (IND-KIs-Reva 1990-V) with 94.4% homology. Significance of the association between KIs-V and hepatitis E virus still remains unanswered. Further investigations need to be undertaken for understanding the natural history and pathogenesis of KIs-V in humans. Competing financial interests The authors declare no competing financial interests.
Acknowledgement The work described here was supported by Indian Council of Medical Research (ICMR) and National Institute of Virology (NIV), Pune, India. We are indebted to all the staff members of the hepatitis Group who were actively involved in collecting samples.
REFERENCES 1. Acharya SK. This is hepatitis: know it, confront it. Indian J Med Res 2013;138:8–10 2. Arankalle VA, Lole KS, Deshmukh TM, Chobe LP, Gandhe SS. Evaluation of human (genotype 1) and swine (genotype 4)-ORF2-based ELISAs for anti-HEV IgM and IgG detection in an endemic country and search for type 4 human HEV infections. J. Viral Hepat. 2007; 14: 435-445
8
3. Biagini P., Touinssi M., Galicher V., de Micco P. KIs virus and blood donors, France. Emerg. Infect. Dis. 2012; 18, 1374-1375 4. Macera L, Focosi D, Manzin A, Ceccherini Nelli L, Pistello M, Maggi F. Lack of KIs virus DNA in plasma and cerebrospinal fluid in Italy. New Microbiol. 2015; 38:593-4. 5. Satoh K., Iwata-Takahura A., Osada N., Yoshikawa A., Hoshi Y., Miyakawa K., Gotanda Y., Satake M., Tadokoro K., Mizoguchi H. Novel DNA sequence isolated from blood donors with high transaminase levels. Hepatol. Res. 2011; 41, 971-981
Figures
Figure 1: Phylogenetic analysis: The 304 nt amplicon was TA-cloned, and representative 10 clones were sequenced and compared with reported KIs-V sequence employing MEGA5 software with Jukes Cantor model Cl 5 Cl 8 63
Cl 6 Cl 2 Cl 12 Cl 11 KIs-V SEQUENCE Cl 4 Cl 14 100
Cl 13 Cl 7
0.005
Table: 1 Blood samples tested
9
Category
No. of Age range samples
ALT (IU/L)
Anti-HEV IgM +ve
106
10-82 yr
Raised
Anti-HEV IgG +ve
97 98 95
8-69 yr 7-69 yr 6-65 yr
Normal Raised Normal
Anti- HAV IgM +ve
66
3 month- 68 yr
Raised
20
3-40 yr
Normal
Anti-HEV -ve, HAV IgM -ve
98
6-94 yr
Raised
68
5-76 yr
Normal
10