- Email: [email protected]
Detection of nucleotide polymorphisms in feline calicivirus isolates by reverse transcription PCR and a fluorescence resonance energy transfer probe
Journal of Virological Methods 109 (2003) 261 /263 www.elsevier.com/locate/jviromet
Brief report
Detection of nucleotide polymorphisms in feline calicivirus isolates by reverse transcription PCR and a fluorescence resonance energy transfer probe Chris Helps *, Dave Harbour Division of Veterinary Pathology, Infection and Immunity, Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, Bristol BS40 5DU, UK Received 31 October 2002; received in revised form 20 January 2003; accepted 21 January 2003
Abstract A fluorescence resonance energy transfer system has been developed to detect nucleotide polymorphisms in isolates of feline calicivirus (FCV). Isolates with an exact match to the 28 nucleotide probe gave a melting temperature of 75 8C while isolates with one, two, three or four mismatches gave melting temperatures of 71, 65, 60 and 57 8C, respectively. The technique, which is simple, rapid and accurate, is suitable for typing field isolates of FCV. # 2003 Elsevier Science B.V. All rights reserved. Keywords: FCV; Nucleotide polymorphisms; FRET
Feline calicivirus (FCV) is an important pathogen in cats, being the most common cause of feline upper respiratory tract disease (Gaskell and Dawson, 1998). The virus has a positive sense single-stranded RNA genome of 7.7 kb and encodes three open reading frames (Carter et al., 1992). Open reading frame (orf) 1 encodes the non-structural proteins, orf 2 the capsid protein and orf 3 a putative minor structural protein (Oshikamo et al., 1994; Sosnovtsev and Green, 2000; Tohya et al., 1991; Wirblich et al., 1996). We reported recently the first real-time RT-PCR assay for the detection of FCV (Helps et al., 2002). Using this assay it was found that a region of variability existed between the PCR primers that could be detected by SYBR green melting curve analysis. However, using this technique some single and multiple nucleotide substitutions between field isolates were not detected. A fluorescence resonance energy transfer (FRET) system using a fluorescein (Fam) labelled probe and internally labelled cyanine 5 (Cy5) anti-sense primer has previously been reported for the detection of point
* Corresponding author. Tel.: /44-117-928-9242; fax: /44-117928-9505. E-mail address: [email protected] (C. Helps).
mutations (Bernard et al., 1998; Lay and Wittwer, 1997). In this paper we report the use of a similar FRET system to identify both single and multiple nucleotide polymorphisms in a region of variability in the FCV genome. Field isolates of FCV collected from diagnostic submission samples over the past 25 years and identified by virus isolation were stored at /70 8C. Template RNA was prepared from tissue culture supernatant of these isolates using the DNeasy Tissue kit (Qiagen, UK) following the manufacturer’s instructions for cultured cells. This kit was found to be ideal for the purification of both RNA and DNA from viral and bacterial samples (Helps et al., 2002). The FRET system chosen uses the transfer of energy from Fam, attached at the 3? end of a probe, to Cy5, which was attached internally near the 3? end of the antisense primer (see Fig. 1; Bernard et al., 1998). In order to use this technique on the Bio-Rad iCycler IQ system (Bio-Rad, UK) the filters were changed as follows; the FAM excitation filter was removed and replaced with a blank, and the Cy5 excitation filter was replaced by the Fam excitation filter. In the plate set-up screen the Cy5 filter set is chosen for the analysis. This causes excitation using the Fam filter and the emission is read through the Cy5 filter. In addition, an external well factor plate must
0166-0934/03/$ - see front matter # 2003 Elsevier Science B.V. All rights reserved. doi:10.1016/S0166-0934(03)00051-X
262
C. Helps, D. Harbour / Journal of Virological Methods 109 (2003) 261 /263
Fig. 1. Schematic diagram of the FCV FRET system. The top DNA strand shows the probe that is labelled at its 3? end with Fam. The lower DNA strand shows the anti-sense strand with the anti-sense primer highlighted in bold. This primer is labelled on the third nucleotide from the 3? end (T) with Cy5.
be used. 50 ml of the following solution was used in each well of the external well factor plate; 1/PCR buffer (20 mM Tris pH 8.4, 50 mM KCl), 3 mM MgCl2 and 100 mg ethidium bromide per ml. Primers were designed using MACVECTOR ver 7.0 (Oxford Molecular, UK) to amplify a 67 base pair product from the orf 1 region of the FCV genome (nucleotides 2466/2532 from accession number M86379). The asymmetric RT-PCR reaction consisted of 25 ml of 2 /Platinum QRT-PCR Thermoscript (Invitrogen, The Netherlands), 100 nM FCV sense primer 5?-ATTTGGCCTGGGCTCTTC-3?, 400 nM FCV anti-sense primer labelled internally with Cy5 on the third nucleotide from the 3? end (5?TATGCGGCTCTGATTGCT(Cy5)TG-3?), 5 ml template RNA, 1 ml thermoscript/platinum Taq mix and water to 50 ml. After an initial incubation at 50 8C for 30 min to allow reverse transcription, the reaction was heated to 95 8C for 5 min to inactivate the thermoscript and activate the platinum Taq polymerase. The reaction was then cycled 45 times at temperatures of 95 8C for 10 s and 55 8C for 15 s in a MJ Research PTC-200 DNA engine (GRI, UK). Immediately following PCR, 1 ml of 10 mM Fam labelled probe 5?-GCCGTCACCTCACACTAACAGGACAGTT-Fam-3? was added to each reaction. The PCR plates were sealed with optical tape and transferred to the iCycler IQ (modified as above) where a melting curve was carried out by raising the incubation temperature from 50 to 80 8C in 1 8C increments with a hold of 10 s at each increment. Data were analysed using the iCycler IQ software (Bio-Rad, UK). Sequence data for FCV isolates was determined as described previously (Helps et al., 2002). Fig. 1 shows a schematic representation of the FRET system used in this study. It differs from other FRET systems used commonly in that the anti-sense primer is internally labelled with the acceptor fluorophore rather than employing two probes; one containing the donor and the other the acceptor fluorophore (Bernard et al., 1998; Wittwer et al., 1997). The current setup has the advantage that the PCR product can be much smaller; 67 bp in this study. It is also desirable to have an excess of the anti-sense DNA strand so that the probe can anneal with less competition from the sense strand. The system also gives more fluorescence when the acceptor fluorophore is in excess over the donor fluorophore.
Both of these criteria are met if asymmetric PCR is used with a four-fold excess of the anti-sense primer, as in the current study. Fig. 2 shows melting curves for five field isolates of FCV. The sequence of the PCR products for these FCV isolates is shown in Table 1. It can clearly be seen that the temperature (Tm) at which the probe melts from the template is dependent on the number of mismatches that occur and that even a single nucleotide mismatch can easily be distinguished. The second Tm value in Table 1 is taken from our previous work using SYBR green I and is included for comparison (Helps et al., 2002). It can be seen that both methods show a similar overall trend with the Tm decreasing as the number of mismatch increase (with the exception of isolate 33). The current FRET system has the advantage that nucleotide mismatches cause a much greater shift in Tm than was observed with SYBR green I. This can be seen for
Fig. 2. FRET melting curves for five FCV PCR products. Sequence data derived from FCV isolates was used to chose five that had between zero and four nucleotide mismatches with the probe. The RTPCR assay was used to amplify PCR product from the genomic RNA, followed by melting curve analysis. The negative differential of the relative fluorescence divided by temperature (/d(RFU)/dT) was plotted against temperature. The number above each curve relates to the isolate number.
C. Helps, D. Harbour / Journal of Virological Methods 109 (2003) 261 /263
263
Table 1 Sequence data and melting curve values for five FCV isolates Isolate number
Sequence
Tm (8C)
Tm (8C)a
25 29 27 33 22 FRET probe
ATTTGGCCTGGGCTCTTCGCCGTCACCTCACACTAACAGGACAGTTCCAAGCAATCAGAGCCGCATA ATTTGGCCTGGGCTCTTCGCCGTCACCTCACACTAACTGGACAGTTTCAAGCCATCAGAGCCGCATA ¯ ATTTGGCCTGGGCTCTTCGCCGTCACCTTACACTAACTGGACAGTTTCAAGCCATCAGAGCCGCATA ¯ ¯ ATTTGGCCTGGGCTCTTCGCCGTCACCTTACACTAACTGGGCAGTTTCAAGCCATCAGAGCCGCATA ¯ ¯ ¯ ATTTGGCCTGGGCTCTTCGCCGTCACCTTACACTATCTGGTCAGTTCCAAGCCATCAGAGCCGCATA ¯ ¯ ¯ ¯ GCCGTCACCTCACACTAACAGGACAGTT
75 71 65 60 57
85.0 85.0 84.4 84.8 84.2
Sequence data and melting curve temperatures (Tm) were obtained as described in the methods for five isolates of FCV. The five sequences are shown together with the FRET probe. Nucleotides that are variable between the probe and the isolate are underlined. a Tm of PCR product as determined by SYBR green I melting curve analysis (Helps et al., 2002).
isolates 25 and 29 where the Tm’s were identical using the SYBR green I assay but differed by 4 8C when the current FRET assay was used. This is further illustrated by the fact that the range of melting temperatures in the current study was nearly 20 8C, while that in the previous study was 2.2 8C, even though the FCV isolates used were identical. While other studies have used FRET technology they have mostly been employed for the detection of single nucleotide polymorphisms (Bernard et al., 1998; Lay and Wittwer, 1997). In the present study we show that a single hybridisation probe can detect between one and four nucleotide polymorphisms in a variable region of the FCV genome. Direct sequencing of PCR products remains the ‘gold standard’ for characterisation of FCV isolates (Glenn et al., 1999; Radford et al., 1997), but this is both time consuming and expensive. Using the FRET system that we have developed for FCV it is possible to characterise the Tm of a 28 bp region in around 90 min. Future work will focus on using this technique in other regions of the FCV viral genome, such as the capsid gene, where linear epitopes have already been identified (Radford et al., 1999).
Acknowledgements This work was supported by a pilot study award to CH from the Department of Clinical Veterinary Science, University of Bristol, UK.
References Bernard, P.S., Lay, M.J., Wittwer, C.T., 1998. Integrated amplification and detection of the C677T point mutation in the methylenetetrahydrofolate reductase gene by fluorescence resonance energy
transfer and probe melting curves. Anal. Biochem. 255 (1), 101 / 107. Carter, M.J., Milton, I.D., Meanger, J., Bennett, M., Gaskell, R.M., Turner, P.C., 1992. The complete nucleotide sequence of a feline calicivirus. Virology 190 (1), 443 /448. Gaskell, R., Dawson, S., 1998. Feline respiratory disease. In: Greene, C.E. (Ed.), Infectious Diseases of the Dog and Cat, second ed. W.B. Saunders, Philadelphia. Glenn, M., Radford, A.D., Turner, P.C., Carter, M., Lowery, D., DeSilver, D.A., Meanger, J., Baulch-Brown, C., Bennett, M., Gaskell, R.M., 1999. Nucleotide sequence of UK and Australian isolates of feline calicivirus (FCV) and phylogenetic analysis of FCVs. Vet. Microbiol. 67 (3), 175 /193. Helps, C.R., Lait, P., Tasker, S., Harbour, D.A., 2002. Melting curve analysis of feline calicivirus isolates detected by real-time reverse transcription PCR. J. Virol. Methods 106 (2), 241 /244. Lay, M.J., Wittwer, C.T., 1997. Real-time fluorescence genotyping of factor V Leiden during rapid-cycle PCR. Clin. Chem. 43 (12), 2262 /2267. Oshikamo, R., Tohya, Y., Kawaguchi, Y., Tomonaga, K., Maeda, K., Takeda, N., Utagawa, E., Kai, C., Mikami, T., 1994. The molecular cloning and sequence of an open reading frame encoding for non-structural proteins of feline calicivirus F4 strain isolated in Japan. J. Vet. Med. Sci. 56 (6), 1093 /1099. Radford, A.D., Bennett, M., McArdle, F., Dawson, S., Turner, P.C., Glenn, M.A., Gaskell, R.M., 1997. The use of sequence analysis of a feline calicivirus (FCV) hypervariable region in the epidemiological investigation of FCV related disease and vaccine failures. Vaccine 15 (12 /13), 1451 /1458. Radford, A.D., Willoughby, K., Dawson, S., McCracken, C., Gaskell, R.M., 1999. The capsid gene of feline calicivirus contains linear Bcell epitopes in both variable and conserved regions. J. Virol. 73 (10), 8496 /8502. Sosnovtsev, S.V., Green, K.Y., 2000. Identification and genomic mapping of the ORF3 and VPg proteins in feline calicivirus virions. Virology 277 (1), 193 /203. Tohya, Y., Taniguchi, Y., Takahashi, E., Utagawa, E., Takeda, N., Miyamura, K., Yamazaki, S., Mikami, T., 1991. Sequence analysis of the 3?-end of feline calicivirus genome. Virology 183 (2), 810 / 814. Wirblich, C., Thiel, H.J., Meyers, G., 1996. Genetic map of the calicivirus rabbit hemorrhagic disease virus as deduced from in vitro translation studies. J. Virol. 70 (11), 7974 /7983. Wittwer, C.T., Herrmann, M.G., Moss, A.A., Rasmussen, R.P., 1997. Continuous fluorescence monitoring of rapid cycle DNA amplification, Biotechniques 22(1), 130 /131, 134 /138.
Brief report
Detection of nucleotide polymorphisms in feline calicivirus isolates by reverse transcription PCR and a fluorescence resonance energy transfer probe Chris Helps *, Dave Harbour Division of Veterinary Pathology, Infection and Immunity, Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, Bristol BS40 5DU, UK Received 31 October 2002; received in revised form 20 January 2003; accepted 21 January 2003
Abstract A fluorescence resonance energy transfer system has been developed to detect nucleotide polymorphisms in isolates of feline calicivirus (FCV). Isolates with an exact match to the 28 nucleotide probe gave a melting temperature of 75 8C while isolates with one, two, three or four mismatches gave melting temperatures of 71, 65, 60 and 57 8C, respectively. The technique, which is simple, rapid and accurate, is suitable for typing field isolates of FCV. # 2003 Elsevier Science B.V. All rights reserved. Keywords: FCV; Nucleotide polymorphisms; FRET
Feline calicivirus (FCV) is an important pathogen in cats, being the most common cause of feline upper respiratory tract disease (Gaskell and Dawson, 1998). The virus has a positive sense single-stranded RNA genome of 7.7 kb and encodes three open reading frames (Carter et al., 1992). Open reading frame (orf) 1 encodes the non-structural proteins, orf 2 the capsid protein and orf 3 a putative minor structural protein (Oshikamo et al., 1994; Sosnovtsev and Green, 2000; Tohya et al., 1991; Wirblich et al., 1996). We reported recently the first real-time RT-PCR assay for the detection of FCV (Helps et al., 2002). Using this assay it was found that a region of variability existed between the PCR primers that could be detected by SYBR green melting curve analysis. However, using this technique some single and multiple nucleotide substitutions between field isolates were not detected. A fluorescence resonance energy transfer (FRET) system using a fluorescein (Fam) labelled probe and internally labelled cyanine 5 (Cy5) anti-sense primer has previously been reported for the detection of point
* Corresponding author. Tel.: /44-117-928-9242; fax: /44-117928-9505. E-mail address: [email protected] (C. Helps).
mutations (Bernard et al., 1998; Lay and Wittwer, 1997). In this paper we report the use of a similar FRET system to identify both single and multiple nucleotide polymorphisms in a region of variability in the FCV genome. Field isolates of FCV collected from diagnostic submission samples over the past 25 years and identified by virus isolation were stored at /70 8C. Template RNA was prepared from tissue culture supernatant of these isolates using the DNeasy Tissue kit (Qiagen, UK) following the manufacturer’s instructions for cultured cells. This kit was found to be ideal for the purification of both RNA and DNA from viral and bacterial samples (Helps et al., 2002). The FRET system chosen uses the transfer of energy from Fam, attached at the 3? end of a probe, to Cy5, which was attached internally near the 3? end of the antisense primer (see Fig. 1; Bernard et al., 1998). In order to use this technique on the Bio-Rad iCycler IQ system (Bio-Rad, UK) the filters were changed as follows; the FAM excitation filter was removed and replaced with a blank, and the Cy5 excitation filter was replaced by the Fam excitation filter. In the plate set-up screen the Cy5 filter set is chosen for the analysis. This causes excitation using the Fam filter and the emission is read through the Cy5 filter. In addition, an external well factor plate must
0166-0934/03/$ - see front matter # 2003 Elsevier Science B.V. All rights reserved. doi:10.1016/S0166-0934(03)00051-X
262
C. Helps, D. Harbour / Journal of Virological Methods 109 (2003) 261 /263
Fig. 1. Schematic diagram of the FCV FRET system. The top DNA strand shows the probe that is labelled at its 3? end with Fam. The lower DNA strand shows the anti-sense strand with the anti-sense primer highlighted in bold. This primer is labelled on the third nucleotide from the 3? end (T) with Cy5.
be used. 50 ml of the following solution was used in each well of the external well factor plate; 1/PCR buffer (20 mM Tris pH 8.4, 50 mM KCl), 3 mM MgCl2 and 100 mg ethidium bromide per ml. Primers were designed using MACVECTOR ver 7.0 (Oxford Molecular, UK) to amplify a 67 base pair product from the orf 1 region of the FCV genome (nucleotides 2466/2532 from accession number M86379). The asymmetric RT-PCR reaction consisted of 25 ml of 2 /Platinum QRT-PCR Thermoscript (Invitrogen, The Netherlands), 100 nM FCV sense primer 5?-ATTTGGCCTGGGCTCTTC-3?, 400 nM FCV anti-sense primer labelled internally with Cy5 on the third nucleotide from the 3? end (5?TATGCGGCTCTGATTGCT(Cy5)TG-3?), 5 ml template RNA, 1 ml thermoscript/platinum Taq mix and water to 50 ml. After an initial incubation at 50 8C for 30 min to allow reverse transcription, the reaction was heated to 95 8C for 5 min to inactivate the thermoscript and activate the platinum Taq polymerase. The reaction was then cycled 45 times at temperatures of 95 8C for 10 s and 55 8C for 15 s in a MJ Research PTC-200 DNA engine (GRI, UK). Immediately following PCR, 1 ml of 10 mM Fam labelled probe 5?-GCCGTCACCTCACACTAACAGGACAGTT-Fam-3? was added to each reaction. The PCR plates were sealed with optical tape and transferred to the iCycler IQ (modified as above) where a melting curve was carried out by raising the incubation temperature from 50 to 80 8C in 1 8C increments with a hold of 10 s at each increment. Data were analysed using the iCycler IQ software (Bio-Rad, UK). Sequence data for FCV isolates was determined as described previously (Helps et al., 2002). Fig. 1 shows a schematic representation of the FRET system used in this study. It differs from other FRET systems used commonly in that the anti-sense primer is internally labelled with the acceptor fluorophore rather than employing two probes; one containing the donor and the other the acceptor fluorophore (Bernard et al., 1998; Wittwer et al., 1997). The current setup has the advantage that the PCR product can be much smaller; 67 bp in this study. It is also desirable to have an excess of the anti-sense DNA strand so that the probe can anneal with less competition from the sense strand. The system also gives more fluorescence when the acceptor fluorophore is in excess over the donor fluorophore.
Both of these criteria are met if asymmetric PCR is used with a four-fold excess of the anti-sense primer, as in the current study. Fig. 2 shows melting curves for five field isolates of FCV. The sequence of the PCR products for these FCV isolates is shown in Table 1. It can clearly be seen that the temperature (Tm) at which the probe melts from the template is dependent on the number of mismatches that occur and that even a single nucleotide mismatch can easily be distinguished. The second Tm value in Table 1 is taken from our previous work using SYBR green I and is included for comparison (Helps et al., 2002). It can be seen that both methods show a similar overall trend with the Tm decreasing as the number of mismatch increase (with the exception of isolate 33). The current FRET system has the advantage that nucleotide mismatches cause a much greater shift in Tm than was observed with SYBR green I. This can be seen for
Fig. 2. FRET melting curves for five FCV PCR products. Sequence data derived from FCV isolates was used to chose five that had between zero and four nucleotide mismatches with the probe. The RTPCR assay was used to amplify PCR product from the genomic RNA, followed by melting curve analysis. The negative differential of the relative fluorescence divided by temperature (/d(RFU)/dT) was plotted against temperature. The number above each curve relates to the isolate number.
C. Helps, D. Harbour / Journal of Virological Methods 109 (2003) 261 /263
263
Table 1 Sequence data and melting curve values for five FCV isolates Isolate number
Sequence
Tm (8C)
Tm (8C)a
25 29 27 33 22 FRET probe
ATTTGGCCTGGGCTCTTCGCCGTCACCTCACACTAACAGGACAGTTCCAAGCAATCAGAGCCGCATA ATTTGGCCTGGGCTCTTCGCCGTCACCTCACACTAACTGGACAGTTTCAAGCCATCAGAGCCGCATA ¯ ATTTGGCCTGGGCTCTTCGCCGTCACCTTACACTAACTGGACAGTTTCAAGCCATCAGAGCCGCATA ¯ ¯ ATTTGGCCTGGGCTCTTCGCCGTCACCTTACACTAACTGGGCAGTTTCAAGCCATCAGAGCCGCATA ¯ ¯ ¯ ATTTGGCCTGGGCTCTTCGCCGTCACCTTACACTATCTGGTCAGTTCCAAGCCATCAGAGCCGCATA ¯ ¯ ¯ ¯ GCCGTCACCTCACACTAACAGGACAGTT
75 71 65 60 57
85.0 85.0 84.4 84.8 84.2
Sequence data and melting curve temperatures (Tm) were obtained as described in the methods for five isolates of FCV. The five sequences are shown together with the FRET probe. Nucleotides that are variable between the probe and the isolate are underlined. a Tm of PCR product as determined by SYBR green I melting curve analysis (Helps et al., 2002).
isolates 25 and 29 where the Tm’s were identical using the SYBR green I assay but differed by 4 8C when the current FRET assay was used. This is further illustrated by the fact that the range of melting temperatures in the current study was nearly 20 8C, while that in the previous study was 2.2 8C, even though the FCV isolates used were identical. While other studies have used FRET technology they have mostly been employed for the detection of single nucleotide polymorphisms (Bernard et al., 1998; Lay and Wittwer, 1997). In the present study we show that a single hybridisation probe can detect between one and four nucleotide polymorphisms in a variable region of the FCV genome. Direct sequencing of PCR products remains the ‘gold standard’ for characterisation of FCV isolates (Glenn et al., 1999; Radford et al., 1997), but this is both time consuming and expensive. Using the FRET system that we have developed for FCV it is possible to characterise the Tm of a 28 bp region in around 90 min. Future work will focus on using this technique in other regions of the FCV viral genome, such as the capsid gene, where linear epitopes have already been identified (Radford et al., 1999).
Acknowledgements This work was supported by a pilot study award to CH from the Department of Clinical Veterinary Science, University of Bristol, UK.
References Bernard, P.S., Lay, M.J., Wittwer, C.T., 1998. Integrated amplification and detection of the C677T point mutation in the methylenetetrahydrofolate reductase gene by fluorescence resonance energy
transfer and probe melting curves. Anal. Biochem. 255 (1), 101 / 107. Carter, M.J., Milton, I.D., Meanger, J., Bennett, M., Gaskell, R.M., Turner, P.C., 1992. The complete nucleotide sequence of a feline calicivirus. Virology 190 (1), 443 /448. Gaskell, R., Dawson, S., 1998. Feline respiratory disease. In: Greene, C.E. (Ed.), Infectious Diseases of the Dog and Cat, second ed. W.B. Saunders, Philadelphia. Glenn, M., Radford, A.D., Turner, P.C., Carter, M., Lowery, D., DeSilver, D.A., Meanger, J., Baulch-Brown, C., Bennett, M., Gaskell, R.M., 1999. Nucleotide sequence of UK and Australian isolates of feline calicivirus (FCV) and phylogenetic analysis of FCVs. Vet. Microbiol. 67 (3), 175 /193. Helps, C.R., Lait, P., Tasker, S., Harbour, D.A., 2002. Melting curve analysis of feline calicivirus isolates detected by real-time reverse transcription PCR. J. Virol. Methods 106 (2), 241 /244. Lay, M.J., Wittwer, C.T., 1997. Real-time fluorescence genotyping of factor V Leiden during rapid-cycle PCR. Clin. Chem. 43 (12), 2262 /2267. Oshikamo, R., Tohya, Y., Kawaguchi, Y., Tomonaga, K., Maeda, K., Takeda, N., Utagawa, E., Kai, C., Mikami, T., 1994. The molecular cloning and sequence of an open reading frame encoding for non-structural proteins of feline calicivirus F4 strain isolated in Japan. J. Vet. Med. Sci. 56 (6), 1093 /1099. Radford, A.D., Bennett, M., McArdle, F., Dawson, S., Turner, P.C., Glenn, M.A., Gaskell, R.M., 1997. The use of sequence analysis of a feline calicivirus (FCV) hypervariable region in the epidemiological investigation of FCV related disease and vaccine failures. Vaccine 15 (12 /13), 1451 /1458. Radford, A.D., Willoughby, K., Dawson, S., McCracken, C., Gaskell, R.M., 1999. The capsid gene of feline calicivirus contains linear Bcell epitopes in both variable and conserved regions. J. Virol. 73 (10), 8496 /8502. Sosnovtsev, S.V., Green, K.Y., 2000. Identification and genomic mapping of the ORF3 and VPg proteins in feline calicivirus virions. Virology 277 (1), 193 /203. Tohya, Y., Taniguchi, Y., Takahashi, E., Utagawa, E., Takeda, N., Miyamura, K., Yamazaki, S., Mikami, T., 1991. Sequence analysis of the 3?-end of feline calicivirus genome. Virology 183 (2), 810 / 814. Wirblich, C., Thiel, H.J., Meyers, G., 1996. Genetic map of the calicivirus rabbit hemorrhagic disease virus as deduced from in vitro translation studies. J. Virol. 70 (11), 7974 /7983. Wittwer, C.T., Herrmann, M.G., Moss, A.A., Rasmussen, R.P., 1997. Continuous fluorescence monitoring of rapid cycle DNA amplification, Biotechniques 22(1), 130 /131, 134 /138.