- Email: [email protected]
Development of a LAMP marker of the Puroindoline a-D1b allele in bread wheat
Journal of Cereal Science 69 (2016) 264e266
Contents lists available at ScienceDirect
Journal of Cereal Science journal homepage: www.elsevier.com/locate/jcs
Research note
Development of a LAMP marker of the Puroindoline a-D1b allele in bread wheat Shiro Fukuta*, Takako Tsuji, Ryoji Suzuki, Yuho Matsumoto, Kouji Ito, Kouji Kataoka, Satomi Kawara, Noriyuki Miyake Aichi Agricultural Research Center, 1-1 Sagamine, Yazako, Nagakute, Aichi 480-1193, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 December 2015 Received in revised form 20 March 2016 Accepted 23 March 2016 Available online 24 March 2016
Grain hardness of wheat (Triticum aestivum) is one of the most important characteristics for end-use properties. Grain texture is controlled by major locus Puroindoline gene. A large deletion of the majority of Puroindoline a (Pina) coding region cause hard texture. In this study, we report the development of a loop-mediated isothermal amplification (LAMP) reaction to identify Pina-D1b allele, which is popular genotype for hard type of bread wheat in Japan. In the LAMP method, Pina-D1b allele was easily detected using the simple NaOH extraction method and visualization of DNA amplification by hydroxynaphthol blue. © 2016 Elsevier Ltd. All rights reserved.
Keywords: Wheat Puroindoline Loop-mediated isothermal amplification DNA marker
Grain hardness of wheat (Triticum aestivum) is one of the most important characteristics that affect quality of flour and end product. Wheat grain is classified into hard and soft types, depending on their grain texture phenotype. Soft wheat is usually used for cookies, cakes and pastries, and hard wheat is for bread and Chinese noodles, respectively. Grain hardness is simply inherited, controlled by Puroindoline a (Pina-D1) and Puroindoline b (Pinb-D1), which are located at the Hardness locus on the short arm of chromosome 5D (Mattern et al., 1973; Law et al., 1978). They were reported to encode wheat endosperm-specific lipid binding proteins. The soft phenotype is determined by the wild-type alleles Pina-D1a and Pinb-D1a, whereas mutations in either Pina-D1 or Pinb-D1 results in hard texture phenotype (Chen et al., 2013). While many mutations in Pina-D1 (i.e. Pina-D1b-D1t) or Pinb-D1 (PinbD1b-D1ac) were reported to produce hard endosperm of bread wheat, Pina-D1b is popular genotype for hard type of bread wheat in Japan. Molecular techniques have become the main strategy for the selection of crops. PCR-based methods have been developed and shown to be a valuable tool. Allele specific PCR marker was reported for detection of the Pina-D1a and b alleles (Chen et al., 2010; Huang, 2011; Suzuki and Takeuchi, 2007).
* Corresponding author. E-mail address: [email protected] (S. Fukuta). http://dx.doi.org/10.1016/j.jcs.2016.03.014 0733-5210/© 2016 Elsevier Ltd. All rights reserved.
The loop-mediated isothermal amplification (LAMP) assay is a rapid DNA amplification method reported by Notomi et al. (2000). In the LAMP reaction, DNA is synthesized by auto-cycling system at isothermal conditions ranging from 60 to 68 C within 1 h. This effective amplification is enabled by Bst DNA polymerase, which has strand displacement activity, and a set of four specially designed primers. In the agricultural field the LAMP assay has been used for detection of various plant pathogens (Fukuta et al., 2013), biotype identification of insect (Takeuchi et al., 2010) or DNA marker for marker assisted selection (MAS) (Fukuta et al., 2015). The LAMP assay has been reported to have many advantages (i.e. rapid amplification, simple operation, easy detection, high sensitivity). Here, we aimed to develop a DNA marker for wheat Pina-D1b based on LAMP and to demonstrate the suitability of this system for MAS using rapid and simple protocols for sample preparation and detection of DNA amplification. Wheat cultivars and strains with Pina-D1a and Pina-D1b were used in this study. The cultivars ‘Hanamanten’, ‘Haruibuki’, ‘Minami-no-karoi’, ‘Chukei-9696’, ‘Norin 61’, ‘Nebari-goshi’ contain the Pina-D1a allele, whereas, ‘Glenlea’, ‘Jagger’, ‘Haru-yutaka’, ‘Kantou125’, ‘Aikei 10-7’, ‘Aikei Kou 10e22’ and ‘Aikei Kou 11e18’ contain the Pina-D1b allele. The genotype of Pina-D1of each cultivar or strain was investigated using PCR marker reported by Suzuki and Takeuchi (2007).
S. Fukuta et al. / Journal of Cereal Science 69 (2016) 264e266
F3
265
F2
F1
B1
B2
BLoop
B3
Fig. 1. Schematic representation of LAMP primer design. Two inner primers (FIP and BIP) and two outer primers (F3 and B3) were designed against six arbitrary regions within the target DNA sequence (F3, F2, F1, B3, B2 and B1). A BLoop primer was composed of the sequence of region between B2 and B1. In the aligned sequences, the dot indicates a match, a dash indicates a gap sequence.
Fig. 2. Turbidity of the LAMP reaction with Pina-D1b primer set.
Genomic DNA from leaves of each wheat cultivar was isolated using the NaOH extraction method (Fukuta et al., 2015), and 1 mL of the diluted extract was used as template DNA for the LAMP assay. The Pina-D1b genotypes has a 15,380-bp deletion in comparison with wild type (Chen et al., 2010). The sequences of Pina-D1a
(GenBank accession number: DQ363911) and Pina-D1b (GenBank accession number: AB262660) were compared by multiple sequence alignment using DNSIS (Hitachi Solutions) (Fig. 1). A set of primers used for the LAMP assay was designed from the unique sequence of Pina-D1b using PrimerExporer V.4 software (http://primerexplorer.jp) (F3: GCTATACAACACACAACCG; B3: CTTTGTTAAGTGTCAGGAGG; FIP: GTGGAGATGAATAGATGAGATGAGG-CACAGAAATCGTGCCACC; BIP: CCTCATAGGCCAGAGCGGGGTAC-AGGAAGTATGTCAAGCGTG; BLoop: GCAAATCGAGATTGGAGCAC). The LAMP reaction was performed in a total volume of 25 mL. The reaction mixture contained 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 0.8 M betaine (SigmaeAldrich, Tokyo, Japan), 4 mM MgSO4, 1.6 mM dNTPs, 0.2 mM each of F3 and B3 primer, 1.6 mM each of FIP and BIP primer, 0.8 mM of BLoop primer, 120 mM Hydroxynaphthol Blue (HNB) (Dojindo, Kumamoto, Japan), 8 units of Bst DNA polymerase (Nippon Gene, Tokyo, Japan) and 1 mL of the DNA template. The mixture was incubated at 63 C for 30 min while monitoring the turbidity of the reaction solution with a LA200 real-time turbidimeter (Teramecs, Kyoto, Japan). The results of the reaction with the Pina-D1b primer set are shown in Fig. 2. The turbidity of the reaction with DNA from ‘Glenlea’, ‘Jagger’, ‘Haru-yutaka’, ‘Kantou-125’,‘Aikei 10e7’, ‘Aikei Kou 10e22’ and ‘Aikei Kou 11e18’ increase after 20 min to 25 min. On the other hand, Pina-D1a allele (‘Hanamanten’, ‘Haruibuki’, ‘Minami-no-kaori’, ‘Chukei-9696’, ‘Norin 61’ and ‘Nebarigoshi’)
Fig. 3. The LAMP tubes of the LAMP reaction with Pina-D1b primer from ‘Hanamanten’ (Tube 1), ‘Haruibuki’ (Tube 2), ‘Minami-no-kaori’ (Tube 3), ‘Chukei-9696’ (Tube 4), ‘Norin 61’ (Tube 5), ‘Nebarigoshi’ (Tube 6), ‘Glenlea’ (Tube 7), ‘Jagger’ (Tube 8), ‘Haru-yutaka’ (Tube 9), ‘Kantou-125’ (Tube 10),’Aikei 10e7’ (Tube 11), ‘Aikei Kou 10e22’(Tube 12) and ‘Aikei Kou 11e18’(Tube 13).
266
S. Fukuta et al. / Journal of Cereal Science 69 (2016) 264e266
gave no amplification. The LAMP tubes are shown in Fig. 3. DNA amplification was confirmed by a colour change of HNB (Goto et al., 2009). In the negative tubes, the colour of the reaction solution did not change and remained violet. On the other hand, in the positive tubes, the reaction solution changed colour from violet to sky blue. The colour change was easily perceptible by the naked eye and confirmed through direct observation. Chen et al. (2010) and Huang (2011) developed a detection method for Pina-D1b. The method consisted of a DNA extraction followed by PCR. But the extraction method required complicated process for PCR. On the other hand, the LAMP reaction can be performed directly with crude biological material without DNA extraction (Fukuta et al., 2015; Kaneko et al., 2007). This study indicates that the LAMP method would be a useful tool for rapid and accurate selection for Pina-D1b allele. The simplicity and cost-effectiveness of LAMP make it readily applicable as an MAS for wheat breeding. Acknowledgements This research was supported by Research project for newly costreducing technology of Japanese agricultural products from the Ministry of Agriculture, Forestry and Fisheries of Japan. References Chen, F., Zhang, F., Morris, C., He, Z., Xia, X., Cui, D., 2010. Molecular characterization of the Puroindoline a-D1b allele and development of a STS marker in wheat (Triticum aestivum L.). J. Cereal Sci. 52, 80e82. Chen, F., Huanhuan, L., Cui, D., 2013. Discovery, distribution and diversity of Puroindoline-D1 genes in bread wheat from five countries (Triticum aesativum L.).
BMC Plant Biol. 13, 125. Fukuta, S., Tsuji, T., Suzuki, R., Shimizu, T., Matsumoto, Y., Saka, N., Miyake, N., Ito, K., Kataoka, K., Hashizume, H., Kawahara, S., Yoshida, T., Nonoyama, T., Nakajima, Y., Asami, I., 2015. Development of a loop-mediated isothermal amplification marker for genotyping of the wheat Wx-B1 allele. Mol. Breed. 35, 42. Fukuta, S., Tamura, M., Maejima, H., Takahashi, R., Kuwayama, S., Tsuji, T., Yoshida, T., Itoh, K., Hashizume, H., Nakajima, Y., Uehara, Y., Shirako, Y., 2013. Differential detection of Wheat yellow mosaic virus, Japanese soil-borne wheat mosaic virus and Chinese wheat mosaic virus by reverse transcription loopmediated isothermal amplification reaction. J. Virol. Methods 189, 348e354. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K., 2009. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Bio Technol. 46, 167e172. -Babel, Development of simple and co-dominant PCR Huang, X.-Q., 2011. A. Brûle markers to genotype puroindoline a and b alleles for grain hardness in bread wheat (Triticum aestivum L.). J. Cereal Sci. 53, 277e284. Kaneko, H., Kawana, T., Fukushima, E., Suzutani, T., 2007. Tolerance of loopmediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 70, 499e501. Law, C.N., Young, C.F., Brown, J.W.S., Snape, J.W., Worland, J.W., 1978. The Study of Grain Protein Control in Wheat Using Whole Chromosome Substitution Lines. Seed Protein Improvement by Nuclear Techniques. International Atomic Energy Agency, Vienna, Austria, pp. 483e502. Mattern, P.J., Morris, R., Schmidt, J.W., Johnson, V.A., 1973. Location of genes for kernel properties in the wheat cultivar ‘Cheyenne’ using chromosome substitution lines. In: Sears, E.R., Sears, L.M.S. (Eds.), Proceedings of the 4th International Wheat Genetics Symposium (Columbia, MO, 1-6 August, 1973). Agricultural Experiment Station, University of Missouri, Columbia, USA, pp. 703e707. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, e63. T. Suzuki, T. Takeuchi, 2007. Kenkyu-Seika-Joho http://www.naro.affrc.go.jp/org/ harc/seika/h19/403.html. in Japanese. Takeuchi, Y., Yoshimura, Y., Fukuta, S., Ooya, T., 2010. Identification of B and Qbiotype of Bemisia tabaci by loop-mediated isothermal amplification (LAMP) methods. In: Proceedings of the Kansai Plant Protection Society, 52, pp. 143e145 (Japanese).
Contents lists available at ScienceDirect
Journal of Cereal Science journal homepage: www.elsevier.com/locate/jcs
Research note
Development of a LAMP marker of the Puroindoline a-D1b allele in bread wheat Shiro Fukuta*, Takako Tsuji, Ryoji Suzuki, Yuho Matsumoto, Kouji Ito, Kouji Kataoka, Satomi Kawara, Noriyuki Miyake Aichi Agricultural Research Center, 1-1 Sagamine, Yazako, Nagakute, Aichi 480-1193, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 December 2015 Received in revised form 20 March 2016 Accepted 23 March 2016 Available online 24 March 2016
Grain hardness of wheat (Triticum aestivum) is one of the most important characteristics for end-use properties. Grain texture is controlled by major locus Puroindoline gene. A large deletion of the majority of Puroindoline a (Pina) coding region cause hard texture. In this study, we report the development of a loop-mediated isothermal amplification (LAMP) reaction to identify Pina-D1b allele, which is popular genotype for hard type of bread wheat in Japan. In the LAMP method, Pina-D1b allele was easily detected using the simple NaOH extraction method and visualization of DNA amplification by hydroxynaphthol blue. © 2016 Elsevier Ltd. All rights reserved.
Keywords: Wheat Puroindoline Loop-mediated isothermal amplification DNA marker
Grain hardness of wheat (Triticum aestivum) is one of the most important characteristics that affect quality of flour and end product. Wheat grain is classified into hard and soft types, depending on their grain texture phenotype. Soft wheat is usually used for cookies, cakes and pastries, and hard wheat is for bread and Chinese noodles, respectively. Grain hardness is simply inherited, controlled by Puroindoline a (Pina-D1) and Puroindoline b (Pinb-D1), which are located at the Hardness locus on the short arm of chromosome 5D (Mattern et al., 1973; Law et al., 1978). They were reported to encode wheat endosperm-specific lipid binding proteins. The soft phenotype is determined by the wild-type alleles Pina-D1a and Pinb-D1a, whereas mutations in either Pina-D1 or Pinb-D1 results in hard texture phenotype (Chen et al., 2013). While many mutations in Pina-D1 (i.e. Pina-D1b-D1t) or Pinb-D1 (PinbD1b-D1ac) were reported to produce hard endosperm of bread wheat, Pina-D1b is popular genotype for hard type of bread wheat in Japan. Molecular techniques have become the main strategy for the selection of crops. PCR-based methods have been developed and shown to be a valuable tool. Allele specific PCR marker was reported for detection of the Pina-D1a and b alleles (Chen et al., 2010; Huang, 2011; Suzuki and Takeuchi, 2007).
* Corresponding author. E-mail address: [email protected] (S. Fukuta). http://dx.doi.org/10.1016/j.jcs.2016.03.014 0733-5210/© 2016 Elsevier Ltd. All rights reserved.
The loop-mediated isothermal amplification (LAMP) assay is a rapid DNA amplification method reported by Notomi et al. (2000). In the LAMP reaction, DNA is synthesized by auto-cycling system at isothermal conditions ranging from 60 to 68 C within 1 h. This effective amplification is enabled by Bst DNA polymerase, which has strand displacement activity, and a set of four specially designed primers. In the agricultural field the LAMP assay has been used for detection of various plant pathogens (Fukuta et al., 2013), biotype identification of insect (Takeuchi et al., 2010) or DNA marker for marker assisted selection (MAS) (Fukuta et al., 2015). The LAMP assay has been reported to have many advantages (i.e. rapid amplification, simple operation, easy detection, high sensitivity). Here, we aimed to develop a DNA marker for wheat Pina-D1b based on LAMP and to demonstrate the suitability of this system for MAS using rapid and simple protocols for sample preparation and detection of DNA amplification. Wheat cultivars and strains with Pina-D1a and Pina-D1b were used in this study. The cultivars ‘Hanamanten’, ‘Haruibuki’, ‘Minami-no-karoi’, ‘Chukei-9696’, ‘Norin 61’, ‘Nebari-goshi’ contain the Pina-D1a allele, whereas, ‘Glenlea’, ‘Jagger’, ‘Haru-yutaka’, ‘Kantou125’, ‘Aikei 10-7’, ‘Aikei Kou 10e22’ and ‘Aikei Kou 11e18’ contain the Pina-D1b allele. The genotype of Pina-D1of each cultivar or strain was investigated using PCR marker reported by Suzuki and Takeuchi (2007).
S. Fukuta et al. / Journal of Cereal Science 69 (2016) 264e266
F3
265
F2
F1
B1
B2
BLoop
B3
Fig. 1. Schematic representation of LAMP primer design. Two inner primers (FIP and BIP) and two outer primers (F3 and B3) were designed against six arbitrary regions within the target DNA sequence (F3, F2, F1, B3, B2 and B1). A BLoop primer was composed of the sequence of region between B2 and B1. In the aligned sequences, the dot indicates a match, a dash indicates a gap sequence.
Fig. 2. Turbidity of the LAMP reaction with Pina-D1b primer set.
Genomic DNA from leaves of each wheat cultivar was isolated using the NaOH extraction method (Fukuta et al., 2015), and 1 mL of the diluted extract was used as template DNA for the LAMP assay. The Pina-D1b genotypes has a 15,380-bp deletion in comparison with wild type (Chen et al., 2010). The sequences of Pina-D1a
(GenBank accession number: DQ363911) and Pina-D1b (GenBank accession number: AB262660) were compared by multiple sequence alignment using DNSIS (Hitachi Solutions) (Fig. 1). A set of primers used for the LAMP assay was designed from the unique sequence of Pina-D1b using PrimerExporer V.4 software (http://primerexplorer.jp) (F3: GCTATACAACACACAACCG; B3: CTTTGTTAAGTGTCAGGAGG; FIP: GTGGAGATGAATAGATGAGATGAGG-CACAGAAATCGTGCCACC; BIP: CCTCATAGGCCAGAGCGGGGTAC-AGGAAGTATGTCAAGCGTG; BLoop: GCAAATCGAGATTGGAGCAC). The LAMP reaction was performed in a total volume of 25 mL. The reaction mixture contained 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 0.8 M betaine (SigmaeAldrich, Tokyo, Japan), 4 mM MgSO4, 1.6 mM dNTPs, 0.2 mM each of F3 and B3 primer, 1.6 mM each of FIP and BIP primer, 0.8 mM of BLoop primer, 120 mM Hydroxynaphthol Blue (HNB) (Dojindo, Kumamoto, Japan), 8 units of Bst DNA polymerase (Nippon Gene, Tokyo, Japan) and 1 mL of the DNA template. The mixture was incubated at 63 C for 30 min while monitoring the turbidity of the reaction solution with a LA200 real-time turbidimeter (Teramecs, Kyoto, Japan). The results of the reaction with the Pina-D1b primer set are shown in Fig. 2. The turbidity of the reaction with DNA from ‘Glenlea’, ‘Jagger’, ‘Haru-yutaka’, ‘Kantou-125’,‘Aikei 10e7’, ‘Aikei Kou 10e22’ and ‘Aikei Kou 11e18’ increase after 20 min to 25 min. On the other hand, Pina-D1a allele (‘Hanamanten’, ‘Haruibuki’, ‘Minami-no-kaori’, ‘Chukei-9696’, ‘Norin 61’ and ‘Nebarigoshi’)
Fig. 3. The LAMP tubes of the LAMP reaction with Pina-D1b primer from ‘Hanamanten’ (Tube 1), ‘Haruibuki’ (Tube 2), ‘Minami-no-kaori’ (Tube 3), ‘Chukei-9696’ (Tube 4), ‘Norin 61’ (Tube 5), ‘Nebarigoshi’ (Tube 6), ‘Glenlea’ (Tube 7), ‘Jagger’ (Tube 8), ‘Haru-yutaka’ (Tube 9), ‘Kantou-125’ (Tube 10),’Aikei 10e7’ (Tube 11), ‘Aikei Kou 10e22’(Tube 12) and ‘Aikei Kou 11e18’(Tube 13).
266
S. Fukuta et al. / Journal of Cereal Science 69 (2016) 264e266
gave no amplification. The LAMP tubes are shown in Fig. 3. DNA amplification was confirmed by a colour change of HNB (Goto et al., 2009). In the negative tubes, the colour of the reaction solution did not change and remained violet. On the other hand, in the positive tubes, the reaction solution changed colour from violet to sky blue. The colour change was easily perceptible by the naked eye and confirmed through direct observation. Chen et al. (2010) and Huang (2011) developed a detection method for Pina-D1b. The method consisted of a DNA extraction followed by PCR. But the extraction method required complicated process for PCR. On the other hand, the LAMP reaction can be performed directly with crude biological material without DNA extraction (Fukuta et al., 2015; Kaneko et al., 2007). This study indicates that the LAMP method would be a useful tool for rapid and accurate selection for Pina-D1b allele. The simplicity and cost-effectiveness of LAMP make it readily applicable as an MAS for wheat breeding. Acknowledgements This research was supported by Research project for newly costreducing technology of Japanese agricultural products from the Ministry of Agriculture, Forestry and Fisheries of Japan. References Chen, F., Zhang, F., Morris, C., He, Z., Xia, X., Cui, D., 2010. Molecular characterization of the Puroindoline a-D1b allele and development of a STS marker in wheat (Triticum aestivum L.). J. Cereal Sci. 52, 80e82. Chen, F., Huanhuan, L., Cui, D., 2013. Discovery, distribution and diversity of Puroindoline-D1 genes in bread wheat from five countries (Triticum aesativum L.).
BMC Plant Biol. 13, 125. Fukuta, S., Tsuji, T., Suzuki, R., Shimizu, T., Matsumoto, Y., Saka, N., Miyake, N., Ito, K., Kataoka, K., Hashizume, H., Kawahara, S., Yoshida, T., Nonoyama, T., Nakajima, Y., Asami, I., 2015. Development of a loop-mediated isothermal amplification marker for genotyping of the wheat Wx-B1 allele. Mol. Breed. 35, 42. Fukuta, S., Tamura, M., Maejima, H., Takahashi, R., Kuwayama, S., Tsuji, T., Yoshida, T., Itoh, K., Hashizume, H., Nakajima, Y., Uehara, Y., Shirako, Y., 2013. Differential detection of Wheat yellow mosaic virus, Japanese soil-borne wheat mosaic virus and Chinese wheat mosaic virus by reverse transcription loopmediated isothermal amplification reaction. J. Virol. Methods 189, 348e354. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K., 2009. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Bio Technol. 46, 167e172. -Babel, Development of simple and co-dominant PCR Huang, X.-Q., 2011. A. Brûle markers to genotype puroindoline a and b alleles for grain hardness in bread wheat (Triticum aestivum L.). J. Cereal Sci. 53, 277e284. Kaneko, H., Kawana, T., Fukushima, E., Suzutani, T., 2007. Tolerance of loopmediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 70, 499e501. Law, C.N., Young, C.F., Brown, J.W.S., Snape, J.W., Worland, J.W., 1978. The Study of Grain Protein Control in Wheat Using Whole Chromosome Substitution Lines. Seed Protein Improvement by Nuclear Techniques. International Atomic Energy Agency, Vienna, Austria, pp. 483e502. Mattern, P.J., Morris, R., Schmidt, J.W., Johnson, V.A., 1973. Location of genes for kernel properties in the wheat cultivar ‘Cheyenne’ using chromosome substitution lines. In: Sears, E.R., Sears, L.M.S. (Eds.), Proceedings of the 4th International Wheat Genetics Symposium (Columbia, MO, 1-6 August, 1973). Agricultural Experiment Station, University of Missouri, Columbia, USA, pp. 703e707. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, e63. T. Suzuki, T. Takeuchi, 2007. Kenkyu-Seika-Joho http://www.naro.affrc.go.jp/org/ harc/seika/h19/403.html. in Japanese. Takeuchi, Y., Yoshimura, Y., Fukuta, S., Ooya, T., 2010. Identification of B and Qbiotype of Bemisia tabaci by loop-mediated isothermal amplification (LAMP) methods. In: Proceedings of the Kansai Plant Protection Society, 52, pp. 143e145 (Japanese).