- Email: [email protected]
Development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of ostreid herpesvirus 1 DNA
Journal of Virological Methods 170 (2010) 30–36
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Protocol
Development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of ostreid herpesvirus 1 DNA Weicheng Ren a , Tristan Renault b , Yuyong Cai a,c , Chongming Wang a,∗ a
Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Science, 106 Nanjing Road, Qingdao, Shandong 266071, China Laboratoire de Génétique et Pathologie, Ifermer, 17390 La Tremblade, France c Department of Aquaculture, Ocean University of China, 5 Yushan Road, Qingdao, Shandong 266003, China b
a b s t r a c t Article history: Received 9 March 2010 Received in revised form 17 August 2010 Accepted 23 August 2010 Available online 8 September 2010 Keywords: Ostreid herpesvirus 1 (OsHV-1) Oyster Loop-mediated isothermal amplification (LAMP) Detection
A loop-mediated isothermal amplification (LAMP) assay was developed for rapid, specific and sensitive detection of ostreid herpesvirus 1 (OsHV-1) DNA. A set of four primers was designed, based on the sequence of the ATPase subunit of the OsHV-1 DNA-packaging terminase gene. The reaction temperature and time were optimized to 64 ◦ C and 60 min, respectively. LAMP products were detected by agarose gel electrophoresis or by visual inspection of a color change due to addition of fluorescent dye. The developed method was highly specific for detection of OsHV-1, and no cross-reaction was observed with other DNA viruses, such as White spot syndrome virus (WSSV), Penaeus stylirostris densovirus (PstDNV), Turbot reddish body iridovirus (TRBIV) and Lymphocystis disease virus (LCDV) found commonly in China. The lower detection limit of the LAMP assay was approximately 20 copies per reaction, and it was 100 times more sensitive than that of conventional PCR. A comparative evaluation of 10 oyster samples using LAMP and PCR assays showed overall correlation in positive and negative results for OsHV-1. These results indicate that the LAMP assay is a simple, rapid, sensitive, specific and reliable technique for the detection of OsHV-1. The LAMP technique has capacity for use for the detection of OsHV-1 both in the laboratory and on farms. Crown Copyright © 2010 Published by Elsevier B.V. All rights reserved.
1. Introduction Herpes-like virus and herpesvirus infections have been associated with high mortality in the larvae and spat of the Pacific oyster, Crassostrea gigas (Hine et al., 1992; Nicolas et al., 1992; Renault et al., 1994), and other marine mollusk species including the European flat oyster Ostrea edulis (Comps and Cochennec, 1993; Renault et al., 2000a), the Australian flat oyster Ostrea angasi (Hine and Thorne, 1997), larvae of the Chilean oyster Tiostrea chilensis in New Zealand (Hine et al., 1998), the European carpet shell clam Ruditapes decussatus (Renault et al., 2001), the scallop Pecten maximus in France (Arzul et al., 2001), the abalone Haliotis diversicolor supertexta in Taiwan (Chang et al., 2005), the abalone Haliotis spp. in Australia (Tan et al., 2008) and the oyster Crassostrea hongkongensis in China (Moss et al., 2007). Herpesvirus infection has become endemic throughout the world and is not only a major threat to marine mollusk aquaculture but also to marine ecology. The virus isolated from French infected C. gigas has been classified as the single member of the family Malacoherpesviridae in the Herpesvirales order under the species name ostreid herpesvirus 1 (OsHV-1), and it’s complete genome
∗ Corresponding author. Tel.: +86 532 8582 3062; fax: +86 532 8581 1514. E-mail address: [email protected] (C.M. Wang).
has been sequenced (GenBank accession AY509253) (Davison et al., 2005). Traditionally, OsHV-1 infections have been diagnosed by sensitive and specific molecular diagnostic techniques such as PCR and in situ hybridization (Renault and Lipart, 1998; Renault et al., 2000b; Arzul et al., 2002; Lipart and Renault, 2002; Barbosa-Solomieu et al., 2004). However, these methods are generally a little time consuming, laborious and sometimes insensitive and non-specific. Although PCR is a powerful tool for detection of OsHV-1, a thermal cycler to amplify DNA and subsequent electrophoresis to visualize amplicons are required, limiting its practical use for instant screening in the field. Recently, a much more specific and sensitive method of detection was carried out by quantitative PCR for OsHV-1 (Pepin et al., 2008). However, it may not be routinely used in rough laboratories and mollusc aquaculture facilities, due to the expense of the thermal cycler and the fluorescence detector required in this technology. Loop-mediated isothermal amplification (LAMP) is a novel technique to amplify nucleic acids under isothermal condition. It is a rapid, sensitive, inexpensive and powerful tool, with possible applications for all life sciences (Notomi et al., 2000). LAMP relies on an auto-cycling strand displacement DNA synthesis performed by the Bst DNA polymerase large fragment (Notomi et al., 2000; Nagamine et al., 2002). This offers several advantages: first, the reaction can be
0166-0934/$ – see front matter. Crown Copyright © 2010 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2010.08.015
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
31
Table 1 Primers used for loop-mediated isothermal amplification. Primer name
Length of oligonucleotide (bp)
Sequence (5 -3 )
OsHV-1-F3 OsHV-1-B3
20 20
CCATCGGCGTCAAATTCAAG TGTGTGGTATAACTGTGGGC CTAACGGCAAGGCTATGTTTGGGA TTTTCTTTGGATCCTCGATGACCTT CGATTCCGTTATCATACATGGGGCA TTTTGAGAGAAGCCGTAGAAACTACAG
OsHV-1-FIP (F1c + TTTT + F2)
49
OsHV-1-BIP (B1c + TTTT + B2)
52
conducted under isothermal conditions ranging from 60 to 65 ◦ C; second, it utilizes four primers that recognize six distinct regions; and third, it produces a large amount of amplified product, resulting in easier visual detection by eye and without the electrophoresis step (Mori et al., 2001; Iwamoto et al., 2003). In aquaculture, LAMP assays have been developed to detect fish and shellfish pathogens such as White spot syndrome virus (Kono et al., 2004), Taura syndrome virus (Kiatpathomchai et al., 2007), Flavobacterium columnare (Yeh et al., 2006), Spring viraemia of carp virus (Shivappa et al., 2008) and Cyprinid herpesvirus-3 (Gunimaladevi et al., 2005). In this study, a highly sensitive, rapid and specific diagnostic protocol for detection of OsHV-1 was developed. A set of four primers were designed which were highly efficient in amplifying ATPase subunit of DNA-packaging terminase gene, a highly preserved domain of OsHV-1, which is highly diverged from other herpesvirus (Davison et al., 2005). Additionally, a comparative study of LAMP and conventional PCR assay for OsHV-1 detection was carried out. 2. Materials and methods 2.1. Samples and preparation of DNA template Samples of oyster, C. gigas (second-year old) were obtained from farms in Changdao, Shandong, China in 2007. OsHV-1 virions were purified from tissues except for gonad and adductor muscle following the method described previously by Le Deuff and Renault (1999). DNA extraction was carried out with a DNA extraction Kit (TIANGEN, Beijing, China) following the manufacturer’s instructions.
using the LAMP primer designing software PrimerExplorer V4 (http://primerexplorer.jp/e/). A set of four primers recognizing six distinct regions in the target sequence was designed, including F1c (169,963-169986), F2 (170,022-170,042), F3 (170,058-170,077), B1c (169,928-169,952), B2 (169,883-169,905) and B3 (169,856169,875). The forward inner primer, OsHV-1-FIP, consisted of F1c, a TTTT linker and F2; the backward inner primer, OsHV-1-BIP, consisted of B1c, a TTTT linker and B2. The two outer primers, OsHV-1-F3 and OsHV-1-B3, were located outside the F2 and B2 regions, respectively. The primer sequences and their respective binding locations were indicated in Table 1 and Fig. 1. 2.3. Optimization of LAMP conditions OsHV-1 DNA extracted from purified particles was used as the template to optimize LAMP reaction conditions, with the LAMP reaction itself was conducted as described by Notomi et al. (2000), with some minor modifications. The reaction volume was 25 l and contained 1.6 M each of OsHV-1-FIP and OsHV-1-BIP, 0.2 M each of OsHV-1-F3 and OsHV-1-B3, 1.6 mM dNTPs, 1 M betaine (Sigma–Aldrich, St. Louis, MO, USA), 4 mM MgSO4 , 10× ThermoPol reaction buffer (20 mM Tris–HCl, 10 mM KCl, 10 mM (NH4 )2 SO4 , 0.1% Triton X-100), eight units of Bst DNA polymerase (New England Biolabs. Inc., MA, USA), and 1 l of OsHV-1 DNA template (1 ng/l). The reaction mixture was incubated at 62, 63, 64 and 65 ◦ C for 60 min in a water bath, and then heated to 80 ◦ C for 5 min to terminate the reaction. At the optimum temperature, the reaction time of LAMP (15, 30, 45, 60 and 75 min) was also tested. LAMP products were electrophoresed on a 2% (w/v) agarose gel to determine the optimal reaction conditions.
2.2. LAMP primer design 2.4. Detection of LAMP products LAMP primers were designed according to the sequence of ATPase subunit of DNA-packaging terminase gene on OsHV-1 genomic DNA sequence (ORF 109, GenBank accession AY509253) following the method of Notomi et al. (2000) and
The LAMP products were subjected to agarose gel electrophoresis or fluorescent dye staining. After LAMP reaction, 3 l of amplified products were analyzed on a 2% (w/v) agarose gel and
Fig. 1. Nucleic acid sequence of target DNA fragment used to design inner and outer primers. The nucleic acid sequences used for primer design and their positions are marked by lines.
32
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
Fig. 2. Determination of LAMP reaction conditions over different temperatures and times by agarose gel electrophoresis. (A) varied temperature. Lanes 1–4, LAMP was carried out at 62, 63, 64 and 65 ◦ C, respectively; (B) varied time. Lanes 1–5, LAMP was carried out for 15, 30, 45, 60 and 75 min, respectively. Lane M, DNA size Marker (DL 2000).
subsequently stained with GeneFinderTM (Biov Bio Xiamen, China). LAMP products were also detected by visual observation. 1 l of GeneFinderTM , diluted to 1:10 with 6× loading buffer (TaKara, Dalian, China), was added to the reaction and observed for any color changing. Green fluorescence was observed clearly with the naked eye in the positive reaction, whereas it remained original orange in the negative reaction. 2.5. Specificity of the OsHV-1 LAMP assay To confirm the specificity of the LAMP assay, DNA samples of White spot syndrome virus (WSSV), Penaeus stylirostris densovirus (PstDNV), Turbot reddish body iridovirus (TRBIV) and Lymphocystis disease virus (LCDV) were included in the analysis. In addition, 2 l of LAMP products were digested with 5 units of the restriction enzyme, HinfI (Fermentas, Canada) in a 20 l reaction mixture for 4 h at 37 ◦ C. Approximately 2 l of the digested products were analyzed on a 2% (w/v) agarose gel. 2.6. Cloning of OsHV-1 DNA To determine the sensitivity of the OsHV-1 LAMP assay, a 1652 bp DNA fragment was amplified from the OsHV-1 DNA extracted from purified particles by conventional PCR using the primers 5 -GAC GGA GCA CTT GTC GTG TCA TT-3 (168,879-168,901) and 5 -ATC AAC GCT TCC TCG GGT GTT AT-3 (170,508–170,530). The PCR was carried out in a 50 l volume containing 5 l of 10× reaction buffer, 1 l of dNTP mixture (10 mM each dNTP), 0.25 l of rTaq polymerase (5 units/l, Takara, Dalian, China), 2 l of each of the two primers (10 M), 1 l of OsHV-1 DNA template and 38.75 l of distilled water. The thermal cycling program consisted of an initial denaturation step at 94 ◦ C for 4 min, followed by 35 cycles of denaturation (30 s at 94 ◦ C), annealing (30 s at 53 ◦ C) and extension (60 s at 72 ◦ C), with a final extension step for 5 min at 72 ◦ C. PCR product was purified and cloned into the pGEM-T easy vector (Promega, Madison, USA) following the manufacturer’s instructions. The concentration of the recombinant plasmid, designated pGEM-T-OsHV-1, was determined by Nanodrop 2000c (Thermo Scientific, USA) and used to make standard dilutions to test the lower detection limit of the LAMP assay. 2.7. Detection limits of LAMP and conventional PCR The plasmid, pGEM-T-OsHV-1, was diluted into a 10-fold serials (2 × 100 to 2 × 106 copies) by Tris–EDTA buffer (10 mM Tris, 1 mM EDTA, pH 8.0, TE) and used as a template in the optimized LAMP reaction. To assess the sensitivity of the LAMP assay for detection of OsHV-1, a conventional PCR was performed with the same template
DNA using a pair of specific primer (sense primer 5 -CCC ACA GAG GTG CAA CCT ACA-3 (168,997–169,017) and anti-sense primer 5 CAC CAC ATA TTC ACC CGT TTT-3 (169,668–169,688)), amplifying a 692 bp fragment on OsHV-1 genome with the same reaction conditions of Section 2.6. LAMP and PCR products were electrophoresed on a 2% (w/v) agarose gel and stained with GeneFinderTM . LAMP amplicons were able to be detected with the naked eye by adding the diluted GeneFinderTM to the tubes and the color changing in the solutions was observed. 2.8. Evaluation of the LAMP assay using samples The validity of the OsHV-1 LAMP was evaluated by testing with five OsHV-1 infected and five uninfected samples from previous diagnostic oyster samples. LAMP was carried out using the optimized conditions (Section 2.3). Conventional PCR was performed using the Gp3/Gp4 primer pair and methods described previously (Arzul et al., 2001). All amplification products were electrophoresed on a 2% (w/v) agarose gel and stained with GeneFinderTM . A reaction including OsHV-1 DNA was used as a positive control and a reaction without any DNA template was included as a negative control. 3. Results 3.1. Optimization of OsHV-1 LAMP reaction conditions In the optimization experiments, the LAMP reaction was carried out using OsHV-1 DNA as the template to determine the optimal temperature and time. LAMP products were found at the temperatures of 62, 63, 64 and 65 ◦ C, and the electrophoresis diagram showed little difference from the reactions. According to the electrophoresis result, the 64 ◦ C was considered as the optimal reaction temperature for OsHV-1 LAMP assay (Fig. 2A). No ladder-like bands were found when the reaction was carried out at 64 ◦ C for 15 and 30 min (Fig. 2B). When the reaction time was extended out to 45, 60 and 75 min at 64 ◦ C, LAMP amplicons were detected (Fig. 2B). At 45 min the amplified products were visualized as weak bands, while 60 and 75 min reaction times produced better results. Therefore, a reaction time of 60 min was chosen as the optimal time for this LAMP assay. Thus, the optimal reaction conditions were 64 ◦ C and 60 min, and these conditions were used in the subsequent experiments. 3.2. Detection of LAMP products by alternative methods LAMP products were subjected to agarose gel electrophoresis and characteristic ladder-like multiple bands were shown (Fig. 3A). Alternatively, visual inspection of LAMP amplification products in
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
33
Fig. 3. LAMP products detected by electrophoresis analysis (A) and by visual observation (B). Lane 1, positive control reaction; lane 2, negative control reaction; tube 1, positive reaction visualized by adding GeneFinderTM ; tube 2, negative reaction; Lane M, DNA size Marker (DL 2000).
the reaction tubes was carried out by adding diluted fluorescent dye to the reaction mixture. A positive reaction tube containing OsHV1-specific amplicons exhibited a green color, while the contents within the negative control tube remained the original orange color (Fig. 3B).
3.3. Detection limits of LAMP and conventional PCR LAMP and conventional PCR were carried out and their respective detection limits were compared using 10-fold serial dilutions (2 × 100 to 2 × 106 copies/l) of plasmid DNA as the template. The detection limit of target DNA by LAMP assay was 2 × 101 copies (Fig. 4A), and 2 × 103 copies (Fig. 4B) by conventional PCR. Thus, the detection limit of the LAMP method appears as 100 times lower
than that of the conventional PCR in the tested conditions. Additionally, visual observation of LAMP results in the reaction tubes was confirmed by adding diluted GeneFinderTM to the reaction mixture. Positive LAMP reaction exhibited a green color while a negative reaction corresponded to the original orange color (Fig. 4C). These observations showed that simply judging by eye, the results of the LAMP assay correlated with results seen after gel electrophoresis of reactions.
3.4. Specificity of the LAMP assay To determine the specificity of the LAMP assay for the detection of OsHV-1, LAMP reactions were performed using DNA from WSSV, PstDNV, TRBIV and LCDV as DNA templates. The LAMP
Fig. 4. Sensitivities of LAMP and PCR assays for detection of OsHV-1. Lanes 1–7, LAMP and PCR conducted using 10-fold serial dilutions of standard plasmid DNA, pGEM-TOsHV-1: 2 × 106 , 2 × 105 , 2 × 104 , 2 × 103 , 2 × 102 , 2 × 101 and 2 × 100 copies, respectively; (A) sensitivity of LAMP assay for detection of the pGEM-T-OsHV-1 plasmid DNA; (B) sensitivity of PCR assay for detection of the pGEM-T-OsHV-1 plasmid DNA; (C) sensitivity of visual inspection for LAMP products by GeneFinderTM staining; lane M, DNA size Marker (DL 2000).
34
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
presence of OsHV-1 when the LAMP assay was employed and all uninfected samples were negative as expected (Fig. 6A). The same results were obtained using conventional PCR (Fig. 6B), indicating that the LAMP assay results correlated strongly with the conventional PCR results for OsHV-1 detection. Therefore, occurrence of false positive or negative results in the LAMP was eliminated and then the method could be applied with credibility for detection of OsHV-1.
4. Discussion
Fig. 5. Specificity of LAMP assay tested by electrophoretic analysis. Lane 1, OsHV-1 DNA; lane 2, no DNA template control; lanes 3–6, DNA from WSSV, PstDNV, TRBIV and, LCDV, respectively; lane 7, LAMP products digested with HinfI; lane M, DNA size Marker (DL 2000).
products were digested with HinfI, restricting the DNA in the B1c region (Fig. 1). Agarose gel electrophoresis analysis indicated that no LAMP bands were visible when the other DNA viruses were used as templates (Fig. 5). The sizes of the restriction digested fragments were in agreement with the predicted sizes of approximately 71 and 150 bp (Fig. 5). Further confirmation of the sequences of the digested products was determined by sequencing, wherein the sequences obtained matched the expected nucleic acid sequences (data not shown). 3.5. Evaluation of the LAMP assay using samples The evaluation of the LAMP assay was carried out with DNA samples extracted from five OsHV-1 infected and five uninfected oysters. All five OsHV-1 infected samples were positive for the
OsHV-1 is the causative agent of viral disease in various marine mollusk species, and has emerged as a major constraint on the culture of marine mollusk. Rapid and sensitive detection of pathogen is important for shellfish farmers and management agencies to take appropriate measures to prevent or monitor disease outbreaks. Therefore, it appears essential to develop a simple, rapid, sensitive and convenient assay for the detection of OsHV-1. Many PCR assays have been well optimized with high sensitivity and specificity. However, these PCR assays are technically and instrumentally demanding, time consuming, and not suitable for the detection of OsHV-1 in the field. In this study, the novel LAMP diagnostic protocol was established to detect OsHV-1 in oyster. The OsHV-1 LAMP assay developed worked well in a relatively wide range of temperatures (from 62 to 65 ◦ C), which facilitated it more applicable in the field or rural laboratories without precise temperature control. The methods for detecting OsHV-1 described previously, such as conventional PCR and real-time PCR, require highly precise and expensive thermal cycling during DNA amplification, and appropriate equipments for the detection of the amplified products (Renault et al., 2000b; Arzul et al., 2002; Barbosa-Solomieu et al., 2004; Pepin et al., 2008). The conventional PCR assay takes 2–3 h besides the electrophoresis time and real-time PCR needs 100 min (Pepin et al., 2008), whereas the LAMP assay could be performed within 1 h. In previous reports, a shorter reaction time (<30 min) was used because the LAMP reaction can be accelerated through the addition of specific loop
Fig. 6. Comparison of LAMP (A) and PCR (B) assays for detection of OsHV-1 in oyster. Lanes 2–6, DNA from oyster C. gigas infected with OsHV-1; lanes 8–12, DNA from OsHV-1 uninfected oyster C. gigas; lane 1, OsHV-1 DNA as a positive control; lane 7, no DNA template control; lane M, DNA size Marker (DL 2000).
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
primers (Nagamine et al., 2002; Blomström et al., 2008). However, the presence of specific loop primers can result in unstable reactions according to the other studies (Phillai et al., 2006; Teng et al., 2007). In this study, the loop primers were not designed and no LAMP products were detected when the time of duration was less than 45 min. In addition, the LAMP assay was carried out by incubation the mixture in a simple water bath, which highlights the potential application for the detection of OsHV-1 in the field. Therefore, the novel OsHV-1 LAMP assay would be more practical for routine diagnosis in fields conditions in contrast with the conventional PCR and real-time PCR assays. The LAMP assay was very sensitive for detecting OsHV-1, which demonstrated 100 times more sensitive than that of conventional PCR used in the present study with the same DNA template. The lower detection limit of the LAMP assay makes it a viable alternative to PCR for detection of OsHV-1 in asymptomatic samples, in which lower levels of virus may exist. Thus, infected samples can be determined during the early stages of infection and effectively controlled before the infection becomes epizootic. In previous study, real-time PCR was developed and also validated 100 times than that of single PCR, with a detection limit of four copies of viral genomic DNA (Pepin et al., 2008). Hence, the LAMP assay for detecting OsHV1 was slightly less sensitive as compared to the real-time PCR assay, which was in agreement with the previous reports (Kimura et al., 2005; Maeda et al., 2009). Although the LAMP assay is slightly less sensitive than real-time PCR, it is still considered superior because it is a comparatively simple and rapid method which can be performed both in the field and in the lab. Additionally, LAMP can amplify DNA with high efficiency, resulting in the large accumulation of products (109 copies of the target DNA) within 1 h (Notomi et al., 2000). Presence of LAMP positive amplicons can be confirmed by adding a fluorescent dsDNA intercalating dye to the reaction tubes, allowing observation with the naked eye (Iwamoto et al., 2003; Dukes et al., 2006). In this study, LAMP amplified products in the reaction tubes were confirmed by adding diluted GeneFinderTM to the reaction mix. Positive LAMP reactions exhibited a green color while a negative reaction corresponded to the original orange color (Fig. 4C). These results showed that simply judging by eye, the results of the LAMP assay correlated with the results seen after gel electrophoresis, which was in accordance with previous reports (Sun et al., 2006; En et al., 2008; Zhang et al., 2009; Xu et al., 2010). The visual inspection of LAMP products with fluorescent dyes was seen as advantageous as there was no need for electrophoresis and subsequent staining with carcinogenic ethidium bromide. Hence, fluorescent dying can substitute for the gel electrophoresis in LAMP assay to judge whether or not the target gene exists. These results could facilitate the implementation of LAMP assays as field tests in rural laboratories or aquaculture facilities. LAMP is highly specific for target DNA sequence. Using the OsHV-1 LAMP assay followed by electrophoresis of amplicons, no cross-reactions were found with other DNA viruses such as WSSV, PstDNV, TRBIV and LCDV found commonly in China, and no amplification products were detected with no-template control (Fig. 5). The LAMP products were also digested using restriction enzyme HinfI, and the sizes of the digested fragments accorded with the expected sizes of 71 and 150 bp, which demonstrated that the LAMP amplification was conducted by the target DNA of OsHV-1 and not by the unrelated oyster genome DNA. These findings indicated that the LAMP assay was specific for OsHV-1 DNA and could not be affected by the presence of non-target genomic DNA in the reaction. The high specificity and selectivity of LAMP assay are attributed to the specific primers designed, which recognize initially the target DNA by six independent sequences followed by four distinct sequences during the later stages of the amplification (Notomi et al., 2000). Thus, the OsHV-1 LAMP assay is highly credible in detecting OsHV-1 infection in oyster.
35
In conclusion, a simple, rapid and sensitive LAMP assay to detect OsHV-1 in oyster was developed and validated. In this simple diagnostic protocol, the reaction was carried out in a single tube and incubated for 60 min in a water bath or heating block at 64 ◦ C. Besides the high specificity, the detection limit of the LAMP assay was as low as 20 copies per reaction of the target gene, which was 100 times more sensitive than that of conventional PCR. LAMP products could be detected by agarose gel electrophoresis or using the naked eye with the aid of GenefinderTM , which could facilitate field implementation of the LAMP assay. Thus, the LAMP assay represents a rapid, specific, sensitive and reliable diagnostic protocol which can be applied in field conditions for detection and surveillance of OsHV-1 infection. This technique has massive potential for routine diagnosis in less well-equipped laboratories as well as in commercial brood stock facilities, hatcheries or shellfish farms. Acknowledgements This study was supported by grants from The National High Technology Research and Development Program of China (863 program; Grant 2006AA100307), Modern Agro-industry Technology Research System (Grant nycytx-47), the Research and Development Special Fund for Public Welfare Industry (Agriculture) of China (Grant nyhyzx07-047). References Arzul, I., Nicolas, J.L., Davison, A.J., Renault, T., 2001. French scallops: a new host for ostreid herpesvirus-1. Virology 290, 342–349. Arzul, I., Renault, T., Thébault, A., Gérard, A., 2002. Detection of oyster herpesvirus DNA and proteins in asymptomatic Crassostrea gigas adults. Virus Res. 84, 151–160. Barbosa-Solomieu, V., Miossec, L., Vázquez-Juárez, R., Ascencio-Valle, F., Renault, T., 2004. Diagnosis of Ostreid herpesvirus 1 in fixed paraffin embedded archival samples using PCR and in situ hybridisation. J. Virol. Methods 119, 65–72. Blomström, A.L., Hakhverdyan, M., Reid, S.M., Dukes, J.P., King, D.P., Belák, S., Berg, M., 2008. A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 147 (1), 188–193. Chang, P.H., Kuo, S.T., Lai, S.H., Yang, H.S., Ting, Y.Y., Hsu, C.L., Chen, H.C., 2005. Herpes-like virus infection causing mortality of cultured abalone Haliotis diversicolor supertexta in Taiwan. Dis. Aquat. Org. 65, 23–27. Comps, M., Cochennec, N., 1993. A herpes-like virus from the European oyster Ostrea edulis L. J. Invertebr. Pathol. 62, 201–203. Davison, A.J., Trus, B.L., Cheng, N., Steven, A.C., Watson, M.S., Cunningham, C., Le Deuff, R.M., Renault, T., 2005. A novel class of herpesvirus with bivalve hosts. J. Gen. Virol. 86, 41–53. Dukes, J.P., King, D.P., Alexandersen, S., 2006. Novel reverse transcription loopmediated isothermal amplification for rapid detection of foot-and-mouth disease virus. Arch. Virol. 151, 1093–1106. En, F.X., Xiao, W., Li, J., Chen, Q., 2008. Loop-mediated isothermal amplification establishment for detection of pseudorabies virus. J. Virol. Methods 151, 35–39. Gunimaladevi, I., Kono, T., LaPatra, S.E., Sakai, M., 2005. A loop mediated isothermal amplification (LAMP) method for detection of infectious hematopoietic necrosis virus (IHNV) in rainbow trout (Oncorhynchus mykiss). Arch. Virol. 150, 899– 909. Hine, P.M., Thorne, T., 1997. Replication of herpes-like viruses in haemocytes of adult flat oysters Ostrea angasi: an ultrastructural study. Dis. Aquat. Org. 29, 189–196. Hine, P.M., Wesney, B., Besant, P., 1998. Replication of a herpes-like virus in larvae of the flat oyster Tiostrea chilensis at ambient temperatures. Dis. Aquat. Org. 32, 161–171. Hine, P.M., Wesney, B., Hay, B.E., 1992. Herpesvirus associated with mortalities among hatchery-reared larval Pacific oysters Crassostrea gigas. Dis. Aquat. Org. 12, 135–142. Iwamoto, T., Sonobe, T., Hayashi, K., 2003. Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare in sputum samples. J. Clin. Microbiol. 41, 2616–2622. Kiatpathomchai, W., Jareonram, W., Jitrapakdee, S., Flegel, T.W., 2007. Rapid and sensitive detection of Taura syndrome virus by reverse transcription loop-mediated isothermal amplification. J. Virol. Methods 146, 125–128. Kimura, H., Ihira, M., Enomoto, Y., Kawada, J., Ito, Y., Morishima, T., Yoshikawa, T., Asano, Y., 2005. Rapid detection of herpes simplex virus DNA in cerebrospinal fluid: comparison between loop-mediated isothermal amplification and realtime PCR. Med. Microbiol. Immunol. 194, 181–185. Kono, T., Savan, R., Sakai, M., Itami, T., 2004. Detection of white spot syndrome virus in shrimp by loop-mediated isothermal amplification. J. Virol. Methods 115, 59–65.
36
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
Le Deuff, R.M., Renault, T., 1999. Purification and partial genome characterization of a herpes-like virus infecting the Japanese oyster, Crassostrea gigas. J. Gen. Virol. 80, 1317–1322. Lipart, C., Renault, T., 2002. Herpes-like virus detection in infected Crassostrea gigas spat using DIG-labelled probes. J. Virol. Methods 101, 1–10. Maeda, J., Inoue, M., Nakabayashi, K., Otomo, Y., Shintani, Y., Ohta, M., Okumura, M., Matsuura, N., 2009. Rapid diagnosis of lymph node metastasis in lung cancer with loop-mediated isothermal amplification assay using carcinoembryonic antigen-mRNA. Lung Cancer 65, 324–327. Mori, Y., Nagamine, K., Tomita, N., Notomi, T., 2001. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res. Commun. 289, 150–154. Moss, J.A., Burreson, E.M., Cordes, J.F., Dungan, C.F., Brown, G.D., Wang, A., Wu, X., Reece, K.S., 2007. Pathogens in Crassostrea ariakensis and other Asian oyster species: implications for non-native oyster introduction to Chesapeake Bay. Dis. Aquat. Org. 77, 207–223. Nagamine, K., Hase, T., Notomi, T., 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell Probes 16, 223–229. Nicolas, J.L., Comps, M., Cochennec, N., 1992. Herpes-like virus infecting Pacificoyster larvae, Crassostrea gigas. Bull. Eur. Assoc. Fish Pathol. 12, 11–13. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, e63. Pepin, J.F., Riou, A., Renault, T., 2008. Rapid and sensitive detection of ostreid herpesvirus 1 in oyster samples by real-time PCR. J. Virol. Methods 149, 269–276. Phillai, D., Bonami, J.R., Sri Widada, J., 2006. Rapid detection of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV), the pathogenic agents of white tail disease of Macrobrachium rosenbergii (De Man), by loop-mediated isothermal amplification. J. Fish Dis. 29, 275–283. Renault, T., Le Deuff, R.M., Cochennec, N., Maffart, P., 1994. Herpesviruses associated with mortalities among Pacific oyster, Crassostrea gigas, in France-comparative study. Rev. Med. Vet. 145, 735–742. Renault, T., Lipart, C., 1998. Diagnosis of herpes-like virus infections in oysters using molecular techniques. Eur. Aquacult. Soc. Spec. Publ. 26, 235–236.
Renault, T., Le Deuff, R.M., Chollet, B., Cochennec, N., Gérard, A., 2000a. Concomitant herpes-like virus infections in hatchery-reared larvae and nursery-cultured spat Crassostrea gigas and Ostrea edulis. Dis. Aquat. Org. 42, 173–183. Renault, T., Le Deuff, R.M., Lipart, C., Delsert, C., 2000b. Development of a PCR procedure for the detection of a herpes-like virus infecting oysters in France. J. Virol. Methods 88, 41–50. Renault, T., Lipart, C., Arzul, I., 2001. A herpes-like virus infects a non ostreid bivalve species: Virus replication in Ruditapes philippinarum larvae. Dis. Aquat. Org. 45, 1–7. Shivappa, R.B., Savan, R., Kono, T., Sakai, M., Emmenegger, E., Kurath, G., Levine, J.F., 2008. Detection of spring viraemia of carp virus (SVCV) by loop-mediated isothermal amplification (LAMP) in koi carp, Cyprinus carpio L. J. Fish Dis. 31, 249–258. Sun, Z.F., Hu, C.Q., Ren, C.H., Shen, Q., 2006. Sensitive and rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) in shrimps by loop-mediated isothermal amplification. J. Virol. Methods 131, 41–46. Tan, J., Lancaster, M., Hyatt, A., Van Driel, R., Wong, F., Warner, S., 2008. Purification of a herpes-like virus from abalone (Haliotis spp.) with ganglioneuritis and detection by transmission electron microscopy. J. Virol. Methods 149, 338– 341. Teng, P.H., Chen, C.L., Sung, P.F., Lee, F.C., Ou, B.R., Lee, P.Y., 2007. Specific detection of reverse transcription-loop-mediated isothermal amplification amplicons for Taura syndrome virus by colorimetric dot-blot hybridization. J. Virol. Methods 146, 317–326. Xu, H.D., Feng, J., Guo, Z.X., Ou, Y.J., Wang, J.Y., 2010. Detection of red-spotted grouper nervous necrosis virus by loop-mediated isothermal amplification. J. Virol. Methods 163, 123–128. Yeh, H.Y., Shoemaker, C.A., Klesius, P.H., 2006. Sensitive and rapid detection of Flavobacterium columnare in channel catfish Ictalurus punctatus by a loopmediated isothermal amplification method. J. Appl. Microbiol. 100, 919–925. Zhang, Q.L., Shi, C.Y., Huang, J., Jia, K.T., Chen, X.H., Liu, H., 2009. Rapid diagnosis of turbot reddish body iridovirus in turbot using the loop-mediated isothermal amplification method. J. Virol. Methods 158, 18–23.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Protocol
Development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of ostreid herpesvirus 1 DNA Weicheng Ren a , Tristan Renault b , Yuyong Cai a,c , Chongming Wang a,∗ a
Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Science, 106 Nanjing Road, Qingdao, Shandong 266071, China Laboratoire de Génétique et Pathologie, Ifermer, 17390 La Tremblade, France c Department of Aquaculture, Ocean University of China, 5 Yushan Road, Qingdao, Shandong 266003, China b
a b s t r a c t Article history: Received 9 March 2010 Received in revised form 17 August 2010 Accepted 23 August 2010 Available online 8 September 2010 Keywords: Ostreid herpesvirus 1 (OsHV-1) Oyster Loop-mediated isothermal amplification (LAMP) Detection
A loop-mediated isothermal amplification (LAMP) assay was developed for rapid, specific and sensitive detection of ostreid herpesvirus 1 (OsHV-1) DNA. A set of four primers was designed, based on the sequence of the ATPase subunit of the OsHV-1 DNA-packaging terminase gene. The reaction temperature and time were optimized to 64 ◦ C and 60 min, respectively. LAMP products were detected by agarose gel electrophoresis or by visual inspection of a color change due to addition of fluorescent dye. The developed method was highly specific for detection of OsHV-1, and no cross-reaction was observed with other DNA viruses, such as White spot syndrome virus (WSSV), Penaeus stylirostris densovirus (PstDNV), Turbot reddish body iridovirus (TRBIV) and Lymphocystis disease virus (LCDV) found commonly in China. The lower detection limit of the LAMP assay was approximately 20 copies per reaction, and it was 100 times more sensitive than that of conventional PCR. A comparative evaluation of 10 oyster samples using LAMP and PCR assays showed overall correlation in positive and negative results for OsHV-1. These results indicate that the LAMP assay is a simple, rapid, sensitive, specific and reliable technique for the detection of OsHV-1. The LAMP technique has capacity for use for the detection of OsHV-1 both in the laboratory and on farms. Crown Copyright © 2010 Published by Elsevier B.V. All rights reserved.
1. Introduction Herpes-like virus and herpesvirus infections have been associated with high mortality in the larvae and spat of the Pacific oyster, Crassostrea gigas (Hine et al., 1992; Nicolas et al., 1992; Renault et al., 1994), and other marine mollusk species including the European flat oyster Ostrea edulis (Comps and Cochennec, 1993; Renault et al., 2000a), the Australian flat oyster Ostrea angasi (Hine and Thorne, 1997), larvae of the Chilean oyster Tiostrea chilensis in New Zealand (Hine et al., 1998), the European carpet shell clam Ruditapes decussatus (Renault et al., 2001), the scallop Pecten maximus in France (Arzul et al., 2001), the abalone Haliotis diversicolor supertexta in Taiwan (Chang et al., 2005), the abalone Haliotis spp. in Australia (Tan et al., 2008) and the oyster Crassostrea hongkongensis in China (Moss et al., 2007). Herpesvirus infection has become endemic throughout the world and is not only a major threat to marine mollusk aquaculture but also to marine ecology. The virus isolated from French infected C. gigas has been classified as the single member of the family Malacoherpesviridae in the Herpesvirales order under the species name ostreid herpesvirus 1 (OsHV-1), and it’s complete genome
∗ Corresponding author. Tel.: +86 532 8582 3062; fax: +86 532 8581 1514. E-mail address: [email protected] (C.M. Wang).
has been sequenced (GenBank accession AY509253) (Davison et al., 2005). Traditionally, OsHV-1 infections have been diagnosed by sensitive and specific molecular diagnostic techniques such as PCR and in situ hybridization (Renault and Lipart, 1998; Renault et al., 2000b; Arzul et al., 2002; Lipart and Renault, 2002; Barbosa-Solomieu et al., 2004). However, these methods are generally a little time consuming, laborious and sometimes insensitive and non-specific. Although PCR is a powerful tool for detection of OsHV-1, a thermal cycler to amplify DNA and subsequent electrophoresis to visualize amplicons are required, limiting its practical use for instant screening in the field. Recently, a much more specific and sensitive method of detection was carried out by quantitative PCR for OsHV-1 (Pepin et al., 2008). However, it may not be routinely used in rough laboratories and mollusc aquaculture facilities, due to the expense of the thermal cycler and the fluorescence detector required in this technology. Loop-mediated isothermal amplification (LAMP) is a novel technique to amplify nucleic acids under isothermal condition. It is a rapid, sensitive, inexpensive and powerful tool, with possible applications for all life sciences (Notomi et al., 2000). LAMP relies on an auto-cycling strand displacement DNA synthesis performed by the Bst DNA polymerase large fragment (Notomi et al., 2000; Nagamine et al., 2002). This offers several advantages: first, the reaction can be
0166-0934/$ – see front matter. Crown Copyright © 2010 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2010.08.015
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
31
Table 1 Primers used for loop-mediated isothermal amplification. Primer name
Length of oligonucleotide (bp)
Sequence (5 -3 )
OsHV-1-F3 OsHV-1-B3
20 20
CCATCGGCGTCAAATTCAAG TGTGTGGTATAACTGTGGGC CTAACGGCAAGGCTATGTTTGGGA TTTTCTTTGGATCCTCGATGACCTT CGATTCCGTTATCATACATGGGGCA TTTTGAGAGAAGCCGTAGAAACTACAG
OsHV-1-FIP (F1c + TTTT + F2)
49
OsHV-1-BIP (B1c + TTTT + B2)
52
conducted under isothermal conditions ranging from 60 to 65 ◦ C; second, it utilizes four primers that recognize six distinct regions; and third, it produces a large amount of amplified product, resulting in easier visual detection by eye and without the electrophoresis step (Mori et al., 2001; Iwamoto et al., 2003). In aquaculture, LAMP assays have been developed to detect fish and shellfish pathogens such as White spot syndrome virus (Kono et al., 2004), Taura syndrome virus (Kiatpathomchai et al., 2007), Flavobacterium columnare (Yeh et al., 2006), Spring viraemia of carp virus (Shivappa et al., 2008) and Cyprinid herpesvirus-3 (Gunimaladevi et al., 2005). In this study, a highly sensitive, rapid and specific diagnostic protocol for detection of OsHV-1 was developed. A set of four primers were designed which were highly efficient in amplifying ATPase subunit of DNA-packaging terminase gene, a highly preserved domain of OsHV-1, which is highly diverged from other herpesvirus (Davison et al., 2005). Additionally, a comparative study of LAMP and conventional PCR assay for OsHV-1 detection was carried out. 2. Materials and methods 2.1. Samples and preparation of DNA template Samples of oyster, C. gigas (second-year old) were obtained from farms in Changdao, Shandong, China in 2007. OsHV-1 virions were purified from tissues except for gonad and adductor muscle following the method described previously by Le Deuff and Renault (1999). DNA extraction was carried out with a DNA extraction Kit (TIANGEN, Beijing, China) following the manufacturer’s instructions.
using the LAMP primer designing software PrimerExplorer V4 (http://primerexplorer.jp/e/). A set of four primers recognizing six distinct regions in the target sequence was designed, including F1c (169,963-169986), F2 (170,022-170,042), F3 (170,058-170,077), B1c (169,928-169,952), B2 (169,883-169,905) and B3 (169,856169,875). The forward inner primer, OsHV-1-FIP, consisted of F1c, a TTTT linker and F2; the backward inner primer, OsHV-1-BIP, consisted of B1c, a TTTT linker and B2. The two outer primers, OsHV-1-F3 and OsHV-1-B3, were located outside the F2 and B2 regions, respectively. The primer sequences and their respective binding locations were indicated in Table 1 and Fig. 1. 2.3. Optimization of LAMP conditions OsHV-1 DNA extracted from purified particles was used as the template to optimize LAMP reaction conditions, with the LAMP reaction itself was conducted as described by Notomi et al. (2000), with some minor modifications. The reaction volume was 25 l and contained 1.6 M each of OsHV-1-FIP and OsHV-1-BIP, 0.2 M each of OsHV-1-F3 and OsHV-1-B3, 1.6 mM dNTPs, 1 M betaine (Sigma–Aldrich, St. Louis, MO, USA), 4 mM MgSO4 , 10× ThermoPol reaction buffer (20 mM Tris–HCl, 10 mM KCl, 10 mM (NH4 )2 SO4 , 0.1% Triton X-100), eight units of Bst DNA polymerase (New England Biolabs. Inc., MA, USA), and 1 l of OsHV-1 DNA template (1 ng/l). The reaction mixture was incubated at 62, 63, 64 and 65 ◦ C for 60 min in a water bath, and then heated to 80 ◦ C for 5 min to terminate the reaction. At the optimum temperature, the reaction time of LAMP (15, 30, 45, 60 and 75 min) was also tested. LAMP products were electrophoresed on a 2% (w/v) agarose gel to determine the optimal reaction conditions.
2.2. LAMP primer design 2.4. Detection of LAMP products LAMP primers were designed according to the sequence of ATPase subunit of DNA-packaging terminase gene on OsHV-1 genomic DNA sequence (ORF 109, GenBank accession AY509253) following the method of Notomi et al. (2000) and
The LAMP products were subjected to agarose gel electrophoresis or fluorescent dye staining. After LAMP reaction, 3 l of amplified products were analyzed on a 2% (w/v) agarose gel and
Fig. 1. Nucleic acid sequence of target DNA fragment used to design inner and outer primers. The nucleic acid sequences used for primer design and their positions are marked by lines.
32
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
Fig. 2. Determination of LAMP reaction conditions over different temperatures and times by agarose gel electrophoresis. (A) varied temperature. Lanes 1–4, LAMP was carried out at 62, 63, 64 and 65 ◦ C, respectively; (B) varied time. Lanes 1–5, LAMP was carried out for 15, 30, 45, 60 and 75 min, respectively. Lane M, DNA size Marker (DL 2000).
subsequently stained with GeneFinderTM (Biov Bio Xiamen, China). LAMP products were also detected by visual observation. 1 l of GeneFinderTM , diluted to 1:10 with 6× loading buffer (TaKara, Dalian, China), was added to the reaction and observed for any color changing. Green fluorescence was observed clearly with the naked eye in the positive reaction, whereas it remained original orange in the negative reaction. 2.5. Specificity of the OsHV-1 LAMP assay To confirm the specificity of the LAMP assay, DNA samples of White spot syndrome virus (WSSV), Penaeus stylirostris densovirus (PstDNV), Turbot reddish body iridovirus (TRBIV) and Lymphocystis disease virus (LCDV) were included in the analysis. In addition, 2 l of LAMP products were digested with 5 units of the restriction enzyme, HinfI (Fermentas, Canada) in a 20 l reaction mixture for 4 h at 37 ◦ C. Approximately 2 l of the digested products were analyzed on a 2% (w/v) agarose gel. 2.6. Cloning of OsHV-1 DNA To determine the sensitivity of the OsHV-1 LAMP assay, a 1652 bp DNA fragment was amplified from the OsHV-1 DNA extracted from purified particles by conventional PCR using the primers 5 -GAC GGA GCA CTT GTC GTG TCA TT-3 (168,879-168,901) and 5 -ATC AAC GCT TCC TCG GGT GTT AT-3 (170,508–170,530). The PCR was carried out in a 50 l volume containing 5 l of 10× reaction buffer, 1 l of dNTP mixture (10 mM each dNTP), 0.25 l of rTaq polymerase (5 units/l, Takara, Dalian, China), 2 l of each of the two primers (10 M), 1 l of OsHV-1 DNA template and 38.75 l of distilled water. The thermal cycling program consisted of an initial denaturation step at 94 ◦ C for 4 min, followed by 35 cycles of denaturation (30 s at 94 ◦ C), annealing (30 s at 53 ◦ C) and extension (60 s at 72 ◦ C), with a final extension step for 5 min at 72 ◦ C. PCR product was purified and cloned into the pGEM-T easy vector (Promega, Madison, USA) following the manufacturer’s instructions. The concentration of the recombinant plasmid, designated pGEM-T-OsHV-1, was determined by Nanodrop 2000c (Thermo Scientific, USA) and used to make standard dilutions to test the lower detection limit of the LAMP assay. 2.7. Detection limits of LAMP and conventional PCR The plasmid, pGEM-T-OsHV-1, was diluted into a 10-fold serials (2 × 100 to 2 × 106 copies) by Tris–EDTA buffer (10 mM Tris, 1 mM EDTA, pH 8.0, TE) and used as a template in the optimized LAMP reaction. To assess the sensitivity of the LAMP assay for detection of OsHV-1, a conventional PCR was performed with the same template
DNA using a pair of specific primer (sense primer 5 -CCC ACA GAG GTG CAA CCT ACA-3 (168,997–169,017) and anti-sense primer 5 CAC CAC ATA TTC ACC CGT TTT-3 (169,668–169,688)), amplifying a 692 bp fragment on OsHV-1 genome with the same reaction conditions of Section 2.6. LAMP and PCR products were electrophoresed on a 2% (w/v) agarose gel and stained with GeneFinderTM . LAMP amplicons were able to be detected with the naked eye by adding the diluted GeneFinderTM to the tubes and the color changing in the solutions was observed. 2.8. Evaluation of the LAMP assay using samples The validity of the OsHV-1 LAMP was evaluated by testing with five OsHV-1 infected and five uninfected samples from previous diagnostic oyster samples. LAMP was carried out using the optimized conditions (Section 2.3). Conventional PCR was performed using the Gp3/Gp4 primer pair and methods described previously (Arzul et al., 2001). All amplification products were electrophoresed on a 2% (w/v) agarose gel and stained with GeneFinderTM . A reaction including OsHV-1 DNA was used as a positive control and a reaction without any DNA template was included as a negative control. 3. Results 3.1. Optimization of OsHV-1 LAMP reaction conditions In the optimization experiments, the LAMP reaction was carried out using OsHV-1 DNA as the template to determine the optimal temperature and time. LAMP products were found at the temperatures of 62, 63, 64 and 65 ◦ C, and the electrophoresis diagram showed little difference from the reactions. According to the electrophoresis result, the 64 ◦ C was considered as the optimal reaction temperature for OsHV-1 LAMP assay (Fig. 2A). No ladder-like bands were found when the reaction was carried out at 64 ◦ C for 15 and 30 min (Fig. 2B). When the reaction time was extended out to 45, 60 and 75 min at 64 ◦ C, LAMP amplicons were detected (Fig. 2B). At 45 min the amplified products were visualized as weak bands, while 60 and 75 min reaction times produced better results. Therefore, a reaction time of 60 min was chosen as the optimal time for this LAMP assay. Thus, the optimal reaction conditions were 64 ◦ C and 60 min, and these conditions were used in the subsequent experiments. 3.2. Detection of LAMP products by alternative methods LAMP products were subjected to agarose gel electrophoresis and characteristic ladder-like multiple bands were shown (Fig. 3A). Alternatively, visual inspection of LAMP amplification products in
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
33
Fig. 3. LAMP products detected by electrophoresis analysis (A) and by visual observation (B). Lane 1, positive control reaction; lane 2, negative control reaction; tube 1, positive reaction visualized by adding GeneFinderTM ; tube 2, negative reaction; Lane M, DNA size Marker (DL 2000).
the reaction tubes was carried out by adding diluted fluorescent dye to the reaction mixture. A positive reaction tube containing OsHV1-specific amplicons exhibited a green color, while the contents within the negative control tube remained the original orange color (Fig. 3B).
3.3. Detection limits of LAMP and conventional PCR LAMP and conventional PCR were carried out and their respective detection limits were compared using 10-fold serial dilutions (2 × 100 to 2 × 106 copies/l) of plasmid DNA as the template. The detection limit of target DNA by LAMP assay was 2 × 101 copies (Fig. 4A), and 2 × 103 copies (Fig. 4B) by conventional PCR. Thus, the detection limit of the LAMP method appears as 100 times lower
than that of the conventional PCR in the tested conditions. Additionally, visual observation of LAMP results in the reaction tubes was confirmed by adding diluted GeneFinderTM to the reaction mixture. Positive LAMP reaction exhibited a green color while a negative reaction corresponded to the original orange color (Fig. 4C). These observations showed that simply judging by eye, the results of the LAMP assay correlated with results seen after gel electrophoresis of reactions.
3.4. Specificity of the LAMP assay To determine the specificity of the LAMP assay for the detection of OsHV-1, LAMP reactions were performed using DNA from WSSV, PstDNV, TRBIV and LCDV as DNA templates. The LAMP
Fig. 4. Sensitivities of LAMP and PCR assays for detection of OsHV-1. Lanes 1–7, LAMP and PCR conducted using 10-fold serial dilutions of standard plasmid DNA, pGEM-TOsHV-1: 2 × 106 , 2 × 105 , 2 × 104 , 2 × 103 , 2 × 102 , 2 × 101 and 2 × 100 copies, respectively; (A) sensitivity of LAMP assay for detection of the pGEM-T-OsHV-1 plasmid DNA; (B) sensitivity of PCR assay for detection of the pGEM-T-OsHV-1 plasmid DNA; (C) sensitivity of visual inspection for LAMP products by GeneFinderTM staining; lane M, DNA size Marker (DL 2000).
34
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
presence of OsHV-1 when the LAMP assay was employed and all uninfected samples were negative as expected (Fig. 6A). The same results were obtained using conventional PCR (Fig. 6B), indicating that the LAMP assay results correlated strongly with the conventional PCR results for OsHV-1 detection. Therefore, occurrence of false positive or negative results in the LAMP was eliminated and then the method could be applied with credibility for detection of OsHV-1.
4. Discussion
Fig. 5. Specificity of LAMP assay tested by electrophoretic analysis. Lane 1, OsHV-1 DNA; lane 2, no DNA template control; lanes 3–6, DNA from WSSV, PstDNV, TRBIV and, LCDV, respectively; lane 7, LAMP products digested with HinfI; lane M, DNA size Marker (DL 2000).
products were digested with HinfI, restricting the DNA in the B1c region (Fig. 1). Agarose gel electrophoresis analysis indicated that no LAMP bands were visible when the other DNA viruses were used as templates (Fig. 5). The sizes of the restriction digested fragments were in agreement with the predicted sizes of approximately 71 and 150 bp (Fig. 5). Further confirmation of the sequences of the digested products was determined by sequencing, wherein the sequences obtained matched the expected nucleic acid sequences (data not shown). 3.5. Evaluation of the LAMP assay using samples The evaluation of the LAMP assay was carried out with DNA samples extracted from five OsHV-1 infected and five uninfected oysters. All five OsHV-1 infected samples were positive for the
OsHV-1 is the causative agent of viral disease in various marine mollusk species, and has emerged as a major constraint on the culture of marine mollusk. Rapid and sensitive detection of pathogen is important for shellfish farmers and management agencies to take appropriate measures to prevent or monitor disease outbreaks. Therefore, it appears essential to develop a simple, rapid, sensitive and convenient assay for the detection of OsHV-1. Many PCR assays have been well optimized with high sensitivity and specificity. However, these PCR assays are technically and instrumentally demanding, time consuming, and not suitable for the detection of OsHV-1 in the field. In this study, the novel LAMP diagnostic protocol was established to detect OsHV-1 in oyster. The OsHV-1 LAMP assay developed worked well in a relatively wide range of temperatures (from 62 to 65 ◦ C), which facilitated it more applicable in the field or rural laboratories without precise temperature control. The methods for detecting OsHV-1 described previously, such as conventional PCR and real-time PCR, require highly precise and expensive thermal cycling during DNA amplification, and appropriate equipments for the detection of the amplified products (Renault et al., 2000b; Arzul et al., 2002; Barbosa-Solomieu et al., 2004; Pepin et al., 2008). The conventional PCR assay takes 2–3 h besides the electrophoresis time and real-time PCR needs 100 min (Pepin et al., 2008), whereas the LAMP assay could be performed within 1 h. In previous reports, a shorter reaction time (<30 min) was used because the LAMP reaction can be accelerated through the addition of specific loop
Fig. 6. Comparison of LAMP (A) and PCR (B) assays for detection of OsHV-1 in oyster. Lanes 2–6, DNA from oyster C. gigas infected with OsHV-1; lanes 8–12, DNA from OsHV-1 uninfected oyster C. gigas; lane 1, OsHV-1 DNA as a positive control; lane 7, no DNA template control; lane M, DNA size Marker (DL 2000).
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
primers (Nagamine et al., 2002; Blomström et al., 2008). However, the presence of specific loop primers can result in unstable reactions according to the other studies (Phillai et al., 2006; Teng et al., 2007). In this study, the loop primers were not designed and no LAMP products were detected when the time of duration was less than 45 min. In addition, the LAMP assay was carried out by incubation the mixture in a simple water bath, which highlights the potential application for the detection of OsHV-1 in the field. Therefore, the novel OsHV-1 LAMP assay would be more practical for routine diagnosis in fields conditions in contrast with the conventional PCR and real-time PCR assays. The LAMP assay was very sensitive for detecting OsHV-1, which demonstrated 100 times more sensitive than that of conventional PCR used in the present study with the same DNA template. The lower detection limit of the LAMP assay makes it a viable alternative to PCR for detection of OsHV-1 in asymptomatic samples, in which lower levels of virus may exist. Thus, infected samples can be determined during the early stages of infection and effectively controlled before the infection becomes epizootic. In previous study, real-time PCR was developed and also validated 100 times than that of single PCR, with a detection limit of four copies of viral genomic DNA (Pepin et al., 2008). Hence, the LAMP assay for detecting OsHV1 was slightly less sensitive as compared to the real-time PCR assay, which was in agreement with the previous reports (Kimura et al., 2005; Maeda et al., 2009). Although the LAMP assay is slightly less sensitive than real-time PCR, it is still considered superior because it is a comparatively simple and rapid method which can be performed both in the field and in the lab. Additionally, LAMP can amplify DNA with high efficiency, resulting in the large accumulation of products (109 copies of the target DNA) within 1 h (Notomi et al., 2000). Presence of LAMP positive amplicons can be confirmed by adding a fluorescent dsDNA intercalating dye to the reaction tubes, allowing observation with the naked eye (Iwamoto et al., 2003; Dukes et al., 2006). In this study, LAMP amplified products in the reaction tubes were confirmed by adding diluted GeneFinderTM to the reaction mix. Positive LAMP reactions exhibited a green color while a negative reaction corresponded to the original orange color (Fig. 4C). These results showed that simply judging by eye, the results of the LAMP assay correlated with the results seen after gel electrophoresis, which was in accordance with previous reports (Sun et al., 2006; En et al., 2008; Zhang et al., 2009; Xu et al., 2010). The visual inspection of LAMP products with fluorescent dyes was seen as advantageous as there was no need for electrophoresis and subsequent staining with carcinogenic ethidium bromide. Hence, fluorescent dying can substitute for the gel electrophoresis in LAMP assay to judge whether or not the target gene exists. These results could facilitate the implementation of LAMP assays as field tests in rural laboratories or aquaculture facilities. LAMP is highly specific for target DNA sequence. Using the OsHV-1 LAMP assay followed by electrophoresis of amplicons, no cross-reactions were found with other DNA viruses such as WSSV, PstDNV, TRBIV and LCDV found commonly in China, and no amplification products were detected with no-template control (Fig. 5). The LAMP products were also digested using restriction enzyme HinfI, and the sizes of the digested fragments accorded with the expected sizes of 71 and 150 bp, which demonstrated that the LAMP amplification was conducted by the target DNA of OsHV-1 and not by the unrelated oyster genome DNA. These findings indicated that the LAMP assay was specific for OsHV-1 DNA and could not be affected by the presence of non-target genomic DNA in the reaction. The high specificity and selectivity of LAMP assay are attributed to the specific primers designed, which recognize initially the target DNA by six independent sequences followed by four distinct sequences during the later stages of the amplification (Notomi et al., 2000). Thus, the OsHV-1 LAMP assay is highly credible in detecting OsHV-1 infection in oyster.
35
In conclusion, a simple, rapid and sensitive LAMP assay to detect OsHV-1 in oyster was developed and validated. In this simple diagnostic protocol, the reaction was carried out in a single tube and incubated for 60 min in a water bath or heating block at 64 ◦ C. Besides the high specificity, the detection limit of the LAMP assay was as low as 20 copies per reaction of the target gene, which was 100 times more sensitive than that of conventional PCR. LAMP products could be detected by agarose gel electrophoresis or using the naked eye with the aid of GenefinderTM , which could facilitate field implementation of the LAMP assay. Thus, the LAMP assay represents a rapid, specific, sensitive and reliable diagnostic protocol which can be applied in field conditions for detection and surveillance of OsHV-1 infection. This technique has massive potential for routine diagnosis in less well-equipped laboratories as well as in commercial brood stock facilities, hatcheries or shellfish farms. Acknowledgements This study was supported by grants from The National High Technology Research and Development Program of China (863 program; Grant 2006AA100307), Modern Agro-industry Technology Research System (Grant nycytx-47), the Research and Development Special Fund for Public Welfare Industry (Agriculture) of China (Grant nyhyzx07-047). References Arzul, I., Nicolas, J.L., Davison, A.J., Renault, T., 2001. French scallops: a new host for ostreid herpesvirus-1. Virology 290, 342–349. Arzul, I., Renault, T., Thébault, A., Gérard, A., 2002. Detection of oyster herpesvirus DNA and proteins in asymptomatic Crassostrea gigas adults. Virus Res. 84, 151–160. Barbosa-Solomieu, V., Miossec, L., Vázquez-Juárez, R., Ascencio-Valle, F., Renault, T., 2004. Diagnosis of Ostreid herpesvirus 1 in fixed paraffin embedded archival samples using PCR and in situ hybridisation. J. Virol. Methods 119, 65–72. Blomström, A.L., Hakhverdyan, M., Reid, S.M., Dukes, J.P., King, D.P., Belák, S., Berg, M., 2008. A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 147 (1), 188–193. Chang, P.H., Kuo, S.T., Lai, S.H., Yang, H.S., Ting, Y.Y., Hsu, C.L., Chen, H.C., 2005. Herpes-like virus infection causing mortality of cultured abalone Haliotis diversicolor supertexta in Taiwan. Dis. Aquat. Org. 65, 23–27. Comps, M., Cochennec, N., 1993. A herpes-like virus from the European oyster Ostrea edulis L. J. Invertebr. Pathol. 62, 201–203. Davison, A.J., Trus, B.L., Cheng, N., Steven, A.C., Watson, M.S., Cunningham, C., Le Deuff, R.M., Renault, T., 2005. A novel class of herpesvirus with bivalve hosts. J. Gen. Virol. 86, 41–53. Dukes, J.P., King, D.P., Alexandersen, S., 2006. Novel reverse transcription loopmediated isothermal amplification for rapid detection of foot-and-mouth disease virus. Arch. Virol. 151, 1093–1106. En, F.X., Xiao, W., Li, J., Chen, Q., 2008. Loop-mediated isothermal amplification establishment for detection of pseudorabies virus. J. Virol. Methods 151, 35–39. Gunimaladevi, I., Kono, T., LaPatra, S.E., Sakai, M., 2005. A loop mediated isothermal amplification (LAMP) method for detection of infectious hematopoietic necrosis virus (IHNV) in rainbow trout (Oncorhynchus mykiss). Arch. Virol. 150, 899– 909. Hine, P.M., Thorne, T., 1997. Replication of herpes-like viruses in haemocytes of adult flat oysters Ostrea angasi: an ultrastructural study. Dis. Aquat. Org. 29, 189–196. Hine, P.M., Wesney, B., Besant, P., 1998. Replication of a herpes-like virus in larvae of the flat oyster Tiostrea chilensis at ambient temperatures. Dis. Aquat. Org. 32, 161–171. Hine, P.M., Wesney, B., Hay, B.E., 1992. Herpesvirus associated with mortalities among hatchery-reared larval Pacific oysters Crassostrea gigas. Dis. Aquat. Org. 12, 135–142. Iwamoto, T., Sonobe, T., Hayashi, K., 2003. Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare in sputum samples. J. Clin. Microbiol. 41, 2616–2622. Kiatpathomchai, W., Jareonram, W., Jitrapakdee, S., Flegel, T.W., 2007. Rapid and sensitive detection of Taura syndrome virus by reverse transcription loop-mediated isothermal amplification. J. Virol. Methods 146, 125–128. Kimura, H., Ihira, M., Enomoto, Y., Kawada, J., Ito, Y., Morishima, T., Yoshikawa, T., Asano, Y., 2005. Rapid detection of herpes simplex virus DNA in cerebrospinal fluid: comparison between loop-mediated isothermal amplification and realtime PCR. Med. Microbiol. Immunol. 194, 181–185. Kono, T., Savan, R., Sakai, M., Itami, T., 2004. Detection of white spot syndrome virus in shrimp by loop-mediated isothermal amplification. J. Virol. Methods 115, 59–65.
36
W. Ren et al. / Journal of Virological Methods 170 (2010) 30–36
Le Deuff, R.M., Renault, T., 1999. Purification and partial genome characterization of a herpes-like virus infecting the Japanese oyster, Crassostrea gigas. J. Gen. Virol. 80, 1317–1322. Lipart, C., Renault, T., 2002. Herpes-like virus detection in infected Crassostrea gigas spat using DIG-labelled probes. J. Virol. Methods 101, 1–10. Maeda, J., Inoue, M., Nakabayashi, K., Otomo, Y., Shintani, Y., Ohta, M., Okumura, M., Matsuura, N., 2009. Rapid diagnosis of lymph node metastasis in lung cancer with loop-mediated isothermal amplification assay using carcinoembryonic antigen-mRNA. Lung Cancer 65, 324–327. Mori, Y., Nagamine, K., Tomita, N., Notomi, T., 2001. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res. Commun. 289, 150–154. Moss, J.A., Burreson, E.M., Cordes, J.F., Dungan, C.F., Brown, G.D., Wang, A., Wu, X., Reece, K.S., 2007. Pathogens in Crassostrea ariakensis and other Asian oyster species: implications for non-native oyster introduction to Chesapeake Bay. Dis. Aquat. Org. 77, 207–223. Nagamine, K., Hase, T., Notomi, T., 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell Probes 16, 223–229. Nicolas, J.L., Comps, M., Cochennec, N., 1992. Herpes-like virus infecting Pacificoyster larvae, Crassostrea gigas. Bull. Eur. Assoc. Fish Pathol. 12, 11–13. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, e63. Pepin, J.F., Riou, A., Renault, T., 2008. Rapid and sensitive detection of ostreid herpesvirus 1 in oyster samples by real-time PCR. J. Virol. Methods 149, 269–276. Phillai, D., Bonami, J.R., Sri Widada, J., 2006. Rapid detection of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV), the pathogenic agents of white tail disease of Macrobrachium rosenbergii (De Man), by loop-mediated isothermal amplification. J. Fish Dis. 29, 275–283. Renault, T., Le Deuff, R.M., Cochennec, N., Maffart, P., 1994. Herpesviruses associated with mortalities among Pacific oyster, Crassostrea gigas, in France-comparative study. Rev. Med. Vet. 145, 735–742. Renault, T., Lipart, C., 1998. Diagnosis of herpes-like virus infections in oysters using molecular techniques. Eur. Aquacult. Soc. Spec. Publ. 26, 235–236.
Renault, T., Le Deuff, R.M., Chollet, B., Cochennec, N., Gérard, A., 2000a. Concomitant herpes-like virus infections in hatchery-reared larvae and nursery-cultured spat Crassostrea gigas and Ostrea edulis. Dis. Aquat. Org. 42, 173–183. Renault, T., Le Deuff, R.M., Lipart, C., Delsert, C., 2000b. Development of a PCR procedure for the detection of a herpes-like virus infecting oysters in France. J. Virol. Methods 88, 41–50. Renault, T., Lipart, C., Arzul, I., 2001. A herpes-like virus infects a non ostreid bivalve species: Virus replication in Ruditapes philippinarum larvae. Dis. Aquat. Org. 45, 1–7. Shivappa, R.B., Savan, R., Kono, T., Sakai, M., Emmenegger, E., Kurath, G., Levine, J.F., 2008. Detection of spring viraemia of carp virus (SVCV) by loop-mediated isothermal amplification (LAMP) in koi carp, Cyprinus carpio L. J. Fish Dis. 31, 249–258. Sun, Z.F., Hu, C.Q., Ren, C.H., Shen, Q., 2006. Sensitive and rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) in shrimps by loop-mediated isothermal amplification. J. Virol. Methods 131, 41–46. Tan, J., Lancaster, M., Hyatt, A., Van Driel, R., Wong, F., Warner, S., 2008. Purification of a herpes-like virus from abalone (Haliotis spp.) with ganglioneuritis and detection by transmission electron microscopy. J. Virol. Methods 149, 338– 341. Teng, P.H., Chen, C.L., Sung, P.F., Lee, F.C., Ou, B.R., Lee, P.Y., 2007. Specific detection of reverse transcription-loop-mediated isothermal amplification amplicons for Taura syndrome virus by colorimetric dot-blot hybridization. J. Virol. Methods 146, 317–326. Xu, H.D., Feng, J., Guo, Z.X., Ou, Y.J., Wang, J.Y., 2010. Detection of red-spotted grouper nervous necrosis virus by loop-mediated isothermal amplification. J. Virol. Methods 163, 123–128. Yeh, H.Y., Shoemaker, C.A., Klesius, P.H., 2006. Sensitive and rapid detection of Flavobacterium columnare in channel catfish Ictalurus punctatus by a loopmediated isothermal amplification method. J. Appl. Microbiol. 100, 919–925. Zhang, Q.L., Shi, C.Y., Huang, J., Jia, K.T., Chen, X.H., Liu, H., 2009. Rapid diagnosis of turbot reddish body iridovirus in turbot using the loop-mediated isothermal amplification method. J. Virol. Methods 158, 18–23.