Development of a real-time RT-PCR method for the detection of newly emerged highly pathogenic H7N9 influenza viruses

Journal of Integrative Agriculture 2017, 16(9): 2055–2061 Available online at www.sciencedirect.com

ScienceDirect

RESEARCH ARTICLE

Development of a real-time RT-PCR method for the detection of newly emerged highly pathogenic H7N9 influenza viruses WANG Xiu-rong*, GU Lin-lin*, SHI Jian-zhong, XU Hai-feng, ZHANG Ying, ZENG Xian-ying, DENG Guohua, LI Cheng-jun, CHEN Hua-lan State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150069, P.R.China

Abstract In 2013, a human influenza outbreak caused by a novel H7N9 virus occurred in China. Recently, the H7N9 virus acquired multiple basic amino acids at its hemagglutinin (HA) cleavage site, leading to the emergence of a highly pathogenic virus. The development of an effective diagnostic method is imperative for the prevention and control of highly pathogenic H7N9 influenza. Here, we designed and synthesized three pairs of primers based on the nucleotide sequence at the HA cleavage site of the newly emerged highly pathogenic H7N9 influenza virus. One of the primer pairs and the corresponding probe displayed a high level of amplification efficiency on which a real-time RT-PCR method was established. Amplification using this method resulted in a fluorescent signal for only the highly pathogenic H7N9 virus, and not for any of the H1–H15 subtype reference strains, thus demonstrating high specificity. The method detected as low as 39.1 copies of HA-positive plasmid and exhibited similar sensitivity to the virus isolation method using embryonated chicken eggs. Importantly, the real-time RT-PCR method exhibited 100% consistency with the virus isolation method in the diagnosis of field samples. Collectively, our data demonstrate that this real-time RT-PCR assay is a rapid, sensitive and specific method, and the application will greatly aid the surveillance, prevention, and control of highly pathogenic H7N9 influenza viruses. Keywords: H7N9, highly pathogenic influenza virus, real-time RT-PCR

continuously evolve and create new viruses, posing con-

1. Introduction Through mutation and gene reassortment, influenza viruses

stant threats to animal and human health. In February 2013, a previously undescribed H7N9 influenza virus caused a new human influenza outbreak in the Shanghai City and Anhui Province of China (Gao et al. 2013). Extensive studies have been conducted to characterize this novel pathogen, and live poultry markets have been shown

Received 16 May, 2017 Accepted 18 May, 2017 Correspondence LI Cheng-jun, Tel: +86-451-51051688, E-mail: [email protected]; CHEN Hua-lan, Tel: +86-451-51997168, E-mail: [email protected] * These authors contributed equally to this study. © 2017 CAAS. Publishing services by Elsevier B.V. All rights reserved. doi: 10.1016/S2095-3119(17)61655-1

to play a critical role in its emergence and spread (Shi et al. 2013). Importantly, the H7N9 viruses have acquired the ability to partially or fully bind to human-type receptors (Belser et al. 2013; Watanabe et al. 2013; Xiong et al. 2013; Zhang et al. 2013; Zhu et al. 2013), and to transmit among ferrets via respiratory droplet (Belser et al. 2013; Richard et al. 2013; Watanabe et al. 2013; Zhang et al.

2056

WANG Xiu-rong et al. Journal of Integrative Agriculture 2017, 16(9): 2055–2061

2013; Zhu et al. 2013). Since these viruses first emerged, upsurges of H7N9 human infections have occurred in the winter-spring season of each year, and there have now been five epidemic waves (Iuliano et al. 2017). As of April 20, 2017, a total of 1 393 laboratory-confirmed human infection cases, including 534 deaths, have been reported to the WHO (2017b). The H7 subtype of avian influenza viruses are predisposed to transform into highly pathogenic viruses during their circulation in poultry (Capua et al. 2000; Xu et al. 2017). During the circulation between 2013 and 2016, chickens and other poultry infected with H7N9 viruses did not show any observable symptoms (Zhang et al. 2013), thus enabling the viruses to spread silently and widely in avian species and to infect humans. Unfortunately, as a result of their continual circulation in poultry, they have now acquired an insertion of extra amino acids at the hemagglutinin (HA) cleavage site and have evolved into highly pathogenic viruses in 2017 (WOAH 2017). Several human cases of infection with the highly pathogenic H7N9 viruses have occurred during the fifth epidemic wave in Guangdong Province, China (WHO 2017a). To avoid the severe damage to both the poultry industry and human health posed by the newly emerged highly pathogenic H7N9 viruses, it is imperative to develop an effective diagnostic approach to ensure the early detection and containment of these viruses. At present in China, the diagnosis of avian influenza virus infection usually involves detecting viral nuclear acid in the specimen in provincial or local laboratories due to the lack of high-level biosafety facilities (Bao et al. 2012). The method of real-time RT-PCR has been widely used in the diagnosis of influenza due to its rapidness and accuracy. In the present study, we established a fast, specific, and sensitive real-time RT-PCR method for the diagnosis of the newly emerged highly pathogenic H7N9 viruses.

Table 1 Reference virus strains used in the study Virus H1N1 H2N2 H3N2 H4N6 H5N1 H6N2 H7N9 H8N4 H9N2 H10N4 H11N9 H12N5 H13N6 H14N5 H15N8 NDV-1 NDV-2 IBV IBDV HP-H7N91) 1)

Isolate A/mallard/Sanjiang/390/2007 A/mallard/Heilongjiang/135/2006 A/mallard/Heilongjiang/90/2006 A/duck/Guangxi/S-2-248/2009 A/duck/Guangdong/S1322/2010 A/mallard/Heilongjiang/81/2006 A/pigeon/Shanghai/S1069/2013 A/turkey/Ontario/6118/1968 A/Turkey/Wisconsin/1/66 A/Turkey/England/384/1979 A/duck/Memphis/546/1976 A/duck/Alberta/60/1976 A/gull/Maryland/704/1977 A/mallard/Gurjer/263/1982 A/duck/Australia/341/83 LaSota F48E9 Lx4 Gt A/chicken/Guangdong/SD008/2017 (H7N9)

HP-H7N9 stands for the newly emerged highly pathogenic H7N9 influenza virus.

2.2. Reagents One-step real-time RT-PCR master mixes were purchased from Thermo Fisher Scientific (Waltham, MA). A TIANamp Virus RNA Kit, which was used for viral RNA extraction, was obtained from Tiangen Biotech (Beijing, China).

2.3. Viral RNA extraction

2. Materials and methods

Viral RNA was extracted by using the TIANamp Virus RNA Kit according to the manufacturer’s instructions. The extraction of viral RNA from H5N1 and H7N9 influenza viruses was performed in the BSL3 Laboratory at HVRI. The concentration of the extracted viral RNA was measured with a NanoDrop ND-1000 apparatus (Thermo Scientific, Wilmington, DE).

2.1. Viruses

2.4. Primer and probe design

H1–H15 reference influenza virus strains and the newly isolated highly pathogenic H7N9 virus strain, A/chicken/ Guangdong/SD008/2017 (GD/SD008, H7N9) (Table 1), were maintained in the National Avian Influenza Reference Laboratory at Harbin Veterinary Research Institute (HVRI), Chinese Academy of Agricultural Sciences. The Newcastle disease virus (NDV) strains (F48E9 and LaSota), avian infectious bronchitis virus (IBV), and infectious bursal disease virus (IBDV), which were used in the present study, were kindly provided by research teams at the State Key Laboratory of Veterinary Biotechnology, HVRI.

The nucleotide sequences of the H7N9 HA gene were aligned by using the MegAlign module of the DNAStar package (Madison, WI). Based on the inserted nucleotide sequences in the HA cleavage site of GD/SD008 (H7N9), three pairs of primers and three TaqMan probes pertaining to them were designed by using the Primer Express 3.0 Software (Applied Biosystems, Waltham, MA), and were screened by using the Blast function of NCBI to ensure their specificity. The probes, labelled with FAM and BHQ1 quencher groups at the 5´ and 3´ terminus, respectively, were synthesized by Jieli Technology Ltd. (Shanghai, China).

WANG Xiu-rong et al. Journal of Integrative Agriculture 2017, 16(9): 2055–2061

2.5. TaqMan real-time RT-PCR The real-time RT-PCR was performed by using the onestep real-time RT-PCR master mixes in a 25-µL volume, including 12.5 µL of 2× RT-PCR buffer, 5.4 µL of RNasefree ddH2O, 1.25 µL of enhancer, 0.25 µL of RT-PCR enzyme mixture, 0.6 µL of forward primer (10 pmol), 0.6 µL of reverse primer (10 pmol), 0.4 µL of probe (10 pmol), and 4 µL of sample RNA. The reaction was carried out under the following conditions: an initial cycle at 50°C for 15 min, one cycle at 95°C for 15 min, followed by 40 cycles of 95°C for 15 s, 60°C 45 s. At the end of each annealing step, the fluorescent signal of FAM was collected. According to the real-time PCR amplification curve, an appropriate set of primers/probe was selected.

2.6. Specificity of TaqMan real-time RT-PCR The viral RNA of the H1–H15 reference influenza virus strains (including the low pathogenic H7N9 virus strain, A/pigeon/Shanghai/S1069/2013, SH/S1069), highly pathogenic H7N9 virus strain (GD/SD008), NDV strains (F48E9 and LaSota), IBV, and IBDV was extracted with the TIANamp Virus RNA Kit. The specificity of the established TaqMan real-time RT-PCR method was verified with these different viral RNAs and the selected primers and probes; ddH2O was used as a negative control.

2.7. Sensitivity of TaqMan real-time RT-PCR The viral RNA of GD/SD008 (H7N9) virus was subject to RT-PCR with the primer pair H7HA-up/H7HA-low. The HA PCR product was cloned into the pGEM-T vector and was confirmed by sequencing. The constructed plasmid was measured for its concentration and was then 10-fold serially diluted with ddH2O. The dilutions from 10–2 to 10–12 were used as samples to test the sensitivity of the established TaqMan real-time RT-PCR method.

2057

2.8. Comparison with virus isolation method from embryonated chicken eggs The GD/SD008 (H7N9) virus was grown in 10-day-old embryonated chicken eggs. The allantoic fluid was collected at 48 h post-inoculation, titrated for the 50% egg infective dose (EID50) in embryonated chicken eggs, and then 10-fold serially diluted with PBS. The dilutions from 10–1 to 10–10 were subject to viral RNA extraction and TaqMan real-time RT-PCR.

3. Results 3.1. Selection of the optimal pair of primers and probe We performed TaqMan real-time RT-PCR with the viral RNA of GD/SD008 (H7N9) or ddH2O control as a template by using three different pairs of primers and three probes that pertained to each primer pair (Table 2). We found that amplification of GD/SD008 (H7N9) RNA with all three pairs of primers resulted in the appearance of amplification curves with similar threshold cycle (Ct) values (Fig. 1). However, the amplification with set 2 of the primers and probe (i.e., HPH7N9-Forward-2/HPH7N9-Reverse-2 and HPH7N9probe-2), produced the highest fluorescent signal increment without showing any amplification peak in the negative ddH2O control. Therefore, primer/probe set 2 was selected for follow-up experiments. To evaluate the reproducibility of our TaqMan real-time RT-PCR method, we tested 10-fold serial dilutions of GD/ SD008 (H7N9) RNA in three independent experiments. The mean Ct values and coefficients of variation (CV) were calculated (Table 3). The CV values ranged from 0.31 to 1.51%, indicating that the assay is highly reproducible.

3.2. The established TaqMan real-time RT-PCR method shows high specificity By using the above-selected primers and probe, we per-

Table 2 Primers and probes used in this study Name HPH7N9-Forward-1 HPH7N9-Reverse-1 HPH7N9-Probe-1 HPH7N9-Forward-2 HPH7N9-Reverse-2 HPH7N9-Probe-2 HPH7N9-Forward-3 HPH7N9-Reverse-3 HPH7N9-Probe-3 H7-up H7-low 1)

Sequences (5´→3´)1) AAAGGGAAAACGGACTGCG CAATTAGGCCTTCCCATCCA FAM-CCTATTTGGTGCTATAGCGGGTTTCATTGAAA-BHQ1 CAAAGGAGTCTTCTGCTGGCA TAGGCCTCTCGCAGTCCGT FAM-CAGGGATGAAGAATGTTCCTGAGGTTCCAA-BHQ1 AAAGGAGTCTTCTGCTGGCAAC ACCAAATAGGCCTCTCGCAGT FAM-ATGAAGAATGTTCCTGAGGTTCCAAAGGGAAA-BHQ1 GAGGGACAATAATAAGTAACTTGC TTGGTTGGTTTTTGCTATAAGC

The nucleotide sequence underlined in the primer was derived from the inserted sequence at the HA cleavage site of the highly pathogenic H7N9 viruses.

2058

WANG Xiu-rong et al. Journal of Integrative Agriculture 2017, 16(9): 2055–2061

ΔRn

Amplification plot 85 000 80 000 75 000 70 000 65 000 60 000 55 000 50 000 45 000 40 000 35 000 30 000 25 000 20 000 15 000 10 000 5 000 0 –5 000

2

4

6

8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Cycle

Fig. 1 Evaluation and selection of primers and probes used in the TaqMan real-time RT-PCR assay. The amplification curves for primer/probe sets 1, 2, and 3 are shown in blue, magenta, and green, respectively.

Table 3 Reproducibility of the TaqMan real-time RT-PCR method Experiment1) 1 2 3 Mean Ct SD CV (%) 1)

80 14.64 14.83 14.79 14.75 0.10 0.67

Threshold cycles (Ct) for the amount of RNA per reaction (ng) 8 0.8 0.08 –0.008 18.16 21.90 25.50 29.14 18.11 22.07 25.47 29.30 18.29 21.44 25.62 29.08 18.19 21.80 25.53 29.17 0.09 0.33 0.08 0.11 0.49 1.51 0.31 0.38

0.0008 33.19 33.59 33.17 33.32 0.24 0.72

0.00008 35.71 35.21 35.05 35.32 0.34 0.96

SD stands for standard deviation; CV stands for coefficients of variation.

formed TaqMan real-time RT-PCR amplifications with the viral RNA of H1–H15 reference influenza strains, a highly pathogenic H7N9 virus strain (GD/SD008), NDV strains (F48E9 and LaSota), IBV, or IBDV, together with a ddH2O negative control. We found that only the amplification with GD/SD008 (H7N9) viral RNA produced a standard amplification curve; amplification of all of the other samples resulted in straight lines, indicating a lack of amplification (Fig. 2). This result indicates that the established TaqMan real-time RT-PCR method is highly specific for the detection of the viral RNA of the highly pathogenic H7N9 virus.

the plasmid was 137 ng µL–1 and was calculated to contain 3.91×1010 copies of plasmid µL–1. The plasmid was 10-fold serially diluted with ddH2O, and dilutions from 10–2–10–12 were used in the TaqMan real-time RT-PCR assay. We found that amplification with the dilution of 10–9 still gave rise to a specific amplification curve (Fig. 3), thereby indicating that the established method can detect a plasmid copy number as low as 39.1. In addition, the amplification curves of the plasmid dilutions from 10–2 to 10–7 were linearly correlated, displaying a slope of –3.295, a correlation coefficient of 0.999, and an amplification efficiency of 101.15%.

3.3. The established TaqMan real-time RT-PCR method is highly sensitive

3.4. Comparison with the virus isolation method using embryonated chicken eggs

A 332-bp HA fragment of the GD/SD008 (H7N9) virus was amplified with the primer pair H7-up/H7-low, and was then cloned into the pGEM-T vector. The constructed plasmid was sequenced to confirm its identity. The concentration of

The GD/SD008 (H7N9) virus was inoculated into the allantoic cavity of 10-day-old embryonated chicken eggs. The allantoic fluid was harvested at 30 h post-inoculation to prepare a virus stock, the titer of which was determined

2059

WANG Xiu-rong et al. Journal of Integrative Agriculture 2017, 16(9): 2055–2061

Amplification plot 120 000 110 000 100 000 90 000 80 000 ΔRn

70 000 60 000 50 000 40 000 30 000 20 000 10 000 0 2

4

6

8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Cycle

00 0

0 00

0 00

00 0 0 00

10

00 0 1

Quantity

00 0

0 10 0

00 0

00

0

00 0 10

1

00 0

00

00 0

00 0

10 0

00 0

Cycle

1

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40

Standard curve

37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 10

Amplification plot

Ct

90 000 85 000 80 000 75 000 70 000 65 000 60 000 55 000 50 000 45 000 40 000 35 000 30 000 25 000 20 000 15 000 10 000 5 000 0 –5 000

10 0 20 0

ΔRn

Fig. 2 Specificity test of the TaqMan real-time RT-PCR method. The amplification curve is shown in red for the highly pathogenic H7N9 virus, whereas the ddH2O negative control and all other viruses, including H1–H15 subtype reference influenza strains, Newcastle disease virus (NDV) strains (F48E9 and LaSota), avian infectious bronchitis virus (IBV), and infectious bursal disease virus (IBDV) are shown in green.

Fig. 3 Sensitivity test of the TaqMan real-time RT-PCR method. The hemagglutinin (HA) plasmid of a highly pathogenic H7N9 virus (GD/SD008) was 10-fold serially diluted with ddH2O, and 10–2–10–12 dilutions were used to evaluate the TaqMan real-time RTPCR method. Amplification curves are shown in the left panel in descending order of the template concentration with the highest concentration (10–2) on the far left. The standard curve is shown in the right panel.

to be 108.63 EID50 mL–1. Dilutions from 10–1 to 10–10 of the virus stock were subject to viral RNA extraction and TaqMan real-time RT-PCR amplification (Fig. 4). The amplification curves displayed good linear correlations for the dilutions between 10–1 and 10–6 with a slope of –3.746, a correlation coefficient of 0.999, and an amplification efficiency of

84.906%. The real-time RT-PCR reaction with the dilutions between 10–7 and 10–9 of the virus stock also produced amplification curves although the amplification curves and viral RNA concentrations were no longer linearly correlated. These data indicate that the TaqMan real-time RT-PCR method exhibits similar sensitivity to that of the virus isolation

2060

0

0

00

1

00

0

00

0

00

0 00 0 10

Quantity

0

00

0 10

00

0

00

0

0 1

00

0 00

0

00 0

10

10

Cycle

1

2 4 6 8 10121416182022242628303234363840

Standard curve

38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 00

Amplification plot

Ct

85 000 80 000 75 000 70 000 65 000 60 000 55 000 50 000 45 000 40 000 35 000 30 000 25 000 20 000 15 000 10 000 5 000 0 –5 000

10 20 30 10 200 0

ΔRn

WANG Xiu-rong et al. Journal of Integrative Agriculture 2017, 16(9): 2055–2061

Fig. 4 Comparison of the TaqMan real-time RT-PCR method with the virus isolation method using embryonated chicken eggs. The allantoic fluid of GD/SD008 (H7N9) virus grown in 10-day-old embryonated chicken eggs was 10-fold serially diluted. Dilutions from 10–1 to 10–10 were subjected to viral RNA extraction and TaqMan real-time RT-PCR amplification. The amplification curves are shown in the left panel in descending order of the template concentration with the highest concentration (10–1) on the far left. The standard curve is shown in the right panel.

method using embryonated chicken eggs.

3.5. Field sample testing with the established TaqMan real-time RT-PCR method We selected 88 field samples to test the efficacy of the established TaqMan real-time RT-PCR method. Of these samples, seven were positive for the highly pathogenic H7N9 virus, and 81 were negative for H7N9 virus. We found that the TaqMan real-time RT-PCR method not only identified all seven positive samples but also showed no false positives for any of the 81 negative samples, displaying 100% consistency with the virus isolation method using embryonated chicken eggs.

4. Discussion In early 2013, a novel H7N9 influenza virus emerged in China and caused human infections (Gao et al. 2013). Although this virus showed low pathogenicity in poultry (Zhang et al. 2013), its infection of humans resulted in severe disease and even death (Gao et al. 2013; Yu et al. 2013). Since the emergence of H7N9 human infections, considerable efforts and measures have been taken to control and prevent H7N9 virus infection of poultry and humans. However, the low pathogenic nature of the virus restricted its surveillance and eradication, enabling it to continue to circulate and evolve. In early 2017, the insertion of multiple basic amino acids at the HA cleavage site was reported to have occurred in contemporary H7N9 field isolates, converting the virus from low pathogenic to highly pathogenic in poultry (WOAH 2017). To strengthen the monitoring of the newly emerged

highly pathogenic H7N9 virus, it is essential to develop a rapid and accurate detection method. To this end, here, we established a specific TaqMan real-time RT-PCR method. Based on the HA sequences of the newly emerged highly pathogenic H7N9 viruses, three pairs of primers and three probes were designed and synthesized in which the 3´-terminus of the forward primer (HPH7N9-Forward-1) or reverse primer (HPH7N9-Reverse-2, HPH7N9-Reverse-3) contained part of the inserted nucleotide sequences observed in the HA cleavage site. The performance of the three sets of primers and probe was evaluated in the TaqMan real-time RT-PCR reaction by using the viral RNA template of the highly pathogenic H7N9 virus GD/SD008. Amplifications with all three sets of primers and probe resulted in amplification curves with similar Ct values. However, the fluorescent signal increment of set 2 was the highest among all three sets of primers and probes tested. These results indicated that set 2 was optimal for the amplification of the viral RNA of highly pathogenic H7N9 viruses. Specificity is a critical factor in evaluating the performance of a diagnostic tool. The use of primer/probe set 2 in the real-time RT-PCR amplification produced a specific amplification curve only for the viral RNA of highly pathogenic H7N9 virus; negative results were obtained when the assay was performed with RNA from any other virus, including H1–H15 reference influenza strains (the H5 reference strain is characterized by the insertion of multiple basic amino acids at the HA cleavage site, and the low pathogenic H7N9 virus emerged in 2013), NDV, IBV, and IBDV. These results demonstrate that the real-time RT-PCR method established by using primer/probe set 2 is highly specific in the detection

WANG Xiu-rong et al. Journal of Integrative Agriculture 2017, 16(9): 2055–2061

of highly pathogenic H7N9 influenza viruses. This method also showed superb sensitivity with a lower detection limit of 39.1 copies of positive plasmid. The effectiveness of the established method in detecting highly pathogenic H7N9 viruses in field samples was validated by comparing it with the virus isolation method using embryonated chicken eggs. Importantly, the real-time RT-PCR method exhibited 100% consistency with the virus isolation method, which is a critical property for the application of a diagnostic method. This high level of consistency indicates that the real-time RT-PCR method we have established could essentially eliminate the likelihood of obtaining false positive or false negative results.

5. Conclusion We successfully established a TaqMan real-time RT-PCR method for the rapid detection of the newly emerged highly pathogenic H7N9 influenza viruses. This method is highly sensitive and specific, and its application will greatly aid in the surveillance, prevention, and control of the highly pathogenic H7N9 influenza viruses.

Acknowledgements This study was supported by the National Key R&D Program of China (2016YFD0500800) and the International Science & Technology Cooperation Program of China (2014DFR31260).

References Bao H, Wang X, Zhao Y, Sun X, Li Y, Xiong Y, Chen H. 2012. Development of a reverse transcription loop-mediated isothermal amplification method for the rapid detection of avian influenza virus subtype H7. Journal of Virological Methods, 179, 33–37. Belser J A, Gustin K M, Pearce M B, Maines T R, Zeng H, Pappas C, Sun X, Carney P J, Villanueva J M, Stevens J, Katz J M, Tumpey T M. 2013. Pathogenesis and transmission of avian influenza A (H7N9) virus in ferrets and mice. Nature, 501, 556–559. Capua I, Mutinelli F, Marangon S, Alexander D J. 2000. H7N1 avian influenza in Italy (1999 to 2000) in intensively reared chickens and turkeys. Avian Pathology: Journal of the W.V.P.A, 29, 537–543. Gao R, Cao B, Hu Y, Feng Z, Wang D, Hu W, Chen J, Jie Z, Qiu H, Xu K, Xu X, Lu H, Zhu W, Gao Z, Xiang N, Shen Y, He Z, Gu Y, Zhang Z, Yang Y, et al. 2013. Human infection with a novel avian-origin influenza A (H7N9) virus. The New England Journal of Medicine, 368, 1888–1897. Iuliano A D, Jang Y, Jones J, Davis C T, Wentworth D E, Uyeki T M, Roguski K, Thompson M G, Gubareva L, Fry A M, Burns E, Trock S, Zhou S, Katz J M, Jernigan D B. 2017. Increase in Human infections with avian influenza A (H7N9) virus

2061

during the fifth epidemic - China, October 2016–February 2017. Morbidity and Mortality Weekly Report, 66, 254–255. Richard M, Schrauwen E J A, de Graaf M, Bestebroer T M, Spronken M I J, van Boheemen S, de Meulder D, Lexmond P, Linster M, Herfst S, Smith D J, van den Brand J M, Burke D F, Kuiken T, Rimmelzwaan G F, Osterhaus A D M E, Fouchier R A M. 2013. Limited airborne transmission of H7N9 influenza A virus between ferrets. Nature, 501, 560. Shi J, Deng G, Liu P, Zhou J, Guan L, Li W, Li X, Guo J, Wang G, Fan J, Wang J, Li Y, Jiang Y, Liu L, Tian G, Li C, Chen H. 2013. Isolation and characterization of H7N9 viruses from live poultry markets-implication of the source of current H7N9 infection in humans. Chinese Science Bulletin, 58, 1857–1863. Watanabe T, Kiso M, Fukuyama S, Nakajima N, Imai M, Yamada S, Murakami S, Yamayoshi S, Iwatsuki-Horimoto K, Sakoda Y, Takashita E, McBride R, Noda T, Hatta M, Imai H, Zhao D, Kishida N, Shirakura M, de Vries R P, Shichinohe S, et al. 2013. Characterization of H7N9 influenza A viruses isolated from humans. Nature, 501, 551–555. WHO (World Health Organization). 2017a. Human infection with avian influenza A (H7N9) virus - China. http://www.who.int/ csr/don/27-february–2017-ah7n9-china/en/ WHO (World Health Organization). 2017b. Influenza at the human-animal interface. http://www.who.int/influenza/ human_animal_interface/Influenza_Summary_IRA_HA_ interface_04_20_2017.pdf WOAH (World Organization for Animal Health). 2017. Immediate notifications and follow-up reports of highly pathogenic avian influenza (types H5 and H7). http:// www.oie.int/wahis_2/public%5C..%5Ctemp%5Creports/ en_imm_0000023367_20170324_164234.pdf Xiong X, Martin S R, Haire L F, Wharton S A, Daniels R S, Bennett M S, McCauley J W, Collins P J, Walker P A, Skehel J J, Gamblin S J. 2013. Receptor binding by an H7N9 influenza virus from humans. Nature, 499, 496–499. Xu Y, Ramey A M, Bowman A S, DeLiberto T J, Killian M L, Krauss S, Nolting J M, Torchetti M K, Reeves A B, Webby R J, Stallknecht D E, Wan X F. 2017. Low pathogenic influenza a viruses in North American diving ducks contribute to the emergence of a novel highly pathogenic influenza a (H7N8) virus. Journal of Virology, doi: 10.1128/JVI.02208-16 Yu H, Cowling B J, Feng L, Lau E H, Liao Q, Tsang T K, Peng Z, Wu P, Liu F, Fang V J, Zhang H, Li M, Zeng L, Xu Z, Li Z, Luo H, Li Q, Feng Z, Cao B, Yang W, et al. 2013. Human infection with avian influenza A H7N9 virus: An assessment of clinical severity. Lancet, 382, 138–145. Zhang Q, Shi J, Deng G, Guo J, Zeng X, He X, Kong H, Gu C, Li X, Liu J, Wang G, Chen Y, Liu L, Liang L, Li Y, Fan J, Wang J, Li W, Guan L, Li Q, et al. 2013. H7N9 influenza viruses are transmissible in ferrets by respiratory droplet. Science, 341, 410–414. Zhu H, Wang D, Kelvin D J, Li L, Zheng Z, Yoon S W, Wong S S, Farooqui A, Wang J, Banner D, Chen R, Zheng R, Zhou J, Zhang Y, Hong W, Dong W, Cai Q, Roehrl M H, Huang S S, Kelvin A A, et al. 2013. Infectivity, transmission, and pathology of human-isolated H7N9 influenza virus in ferrets and pigs. Science, 341, 183–186. (Managing editor ZHANG Juan)