- Email: [email protected]
Development of a single-tube polymerase chain reaction assay for the simultaneous detection of Haemophilus influenzae, Pseudomonas aeruginosa, Staphylococcus aureus, and Streptococcus spp. directly in clinical samples
Available online at www.sciencedirect.com
Diagnostic Microbiology and Infectious Disease 63 (2009) 121 – 126 www.elsevier.com/locate/diagmicrobio
Bacteriology
Development of a single-tube polymerase chain reaction assay for the simultaneous detection of Haemophilus influenzae, Pseudomonas aeruginosa, Staphylococcus aureus, and Streptococcus spp. directly in clinical samples Athanasia Xirogiannia,b , Georgina Tzanakakia,⁎, Eleni Karagiannia , Panayiotis Markoulatosb , Jenny Kourea-Kremastinoua a National Meningitis Reference Laboratory, National School of Public Health, Athens, Greece Department of Biochemistry and Biotechnology, School of Health Science, University of Thessaly, Larissa, Greece Received 11 August 2008; accepted 30 September 2008
b
Abstract This study describes the development and evaluation of a multiplex single-tube polymerase chain reaction assay for the simultaneous detection of Haemophilus influenzae, Pseudomonas aeruginosa, Staphylococcus aureus, and Streptococcus spp. used as target speciesspecific or genus-specific genes. The assay enables the detection of 5 to 50 pg of bacterial DNA. The sensitivity of the assay was evaluated as 100% for P. aeruginosa, S. aureus, and Streptococcus spp., and 94.3% for H. influenzae; the specificity was 100% for all 4 microorganisms (positive predictive value, 100%; negative predictive value, 98.2%). The assay permits rapid and accurate detection of these 4 microorganisms in a wide range of clinical samples such as whole blood, cerebrospinal, ear, pleural and ophthalmic fluids, as well as bronchoalveolar lavage and bronchial secretions. © 2009 Published by Elsevier Inc. Keywords: Haemophilus influenzae; Streptococcus spp.; Pseudomonas aeruginosa; Staphylococcus aureus; Multiplex PCR; Clinical samples
1. Introduction Meningitis receives a high level of medical, public, and media attention because of its rapid onset and high level of morbidity and mortality (van Deuren et al., 2000). In addition to the 3 main microorganisms causing bacterial meningitis (Neisseria meningitidis, Haemophilus influenzae type b and Streptococcus pneumoniae), Staphylococcus aureus, H. influenzae, Streptococcus spp., and Pseudomonas aeruginosa can also cause severe infections such as septicemia, meningitis, and pneumonia, resulting high mortality rates worldwide (Berkley et al., 2005; Bert et al., 1998; Degani et al., 2008; Gill et al., 2005; Lu et al., 2002; Muyldermans et al., 1998; Pintado et al., 2002; Tsai et al., 2006). ⁎ Corresponding author. Tel.: +30-213-20-10-267; fax: +30-210-64-23041. E-mail address: [email protected] (G. Tzanakaki). 0732-8893/$ – see front matter © 2009 Published by Elsevier Inc. doi:10.1016/j.diagmicrobio.2008.09.017
For their identification, conventional methods such as culture or biochemical tests can be carried out; however, these are time-consuming and of low sensitivity, especially if the patient has been treated with antibiotics. In addition, culture methods sometimes cannot reveal 2 or more organisms in the same culture medium if there is overgrowth by a predominant species. For these reasons, there is a need of more accurate and rapid identification to guide accurate treatment. During the last decade, molecular techniques for diagnosis of infections have become more prevalent. Molecular techniques, such as polymerase chain reaction (PCR) methods, are more accurate and more sensitive (Cherian et al., 1998; Tzanakaki et al., 2003). In addition, the development of a multiplex PCR assay and its direct application in clinical samples permits rapid and accurate identification of more than 1 microorganism simultaneously in a single-tube PCR reaction.
122
A. Xirogianni et al. / Diagnostic Microbiology and Infectious Disease 63 (2009) 121–126
Herein, we describe the development of a rapid, sensitive, and accurate PCR assay for the simultaneous detection of S. aureus, H. influenzae, Streptococcus spp., and P. aeruginosa directly in clinical samples. The development of this assay initially aimed for the detection of the 4 aforementioned microorganisms causing meningitis and/or septicemia directly in clinical samples such as cerebrospinal fluid (CSF) and blood. Furthermore, the application of the assay was found to be a useful diagnostic tool when applied on a wide range of clinical samples such as ear, pleural, and ophthalmic fluids, bronchoalveolar lavage (BAL), and bronchial secretions.
2. Materials and methods 2.1. Patient specimens A total of 966 samples were sent to the National Meningitis Reference Laboratory, Athens, Greece, from hospitals throughout the country between January 2003 and February 2008. The samples included bacterial strains (n = 215) isolated from blood, CSF, bronchial fluid, ear fluid or swabs, pus and wound swabs, as well as clinical samples (n = 751) isolated from 607 patients; CSF (n = 262); whole blood (n = 272); pleural fluid (n = 8); bronchial secretions (n = 8); BAL (n = 61); ear fluid (n = 112); ophthalmic fluid (n = 22); blood cultures (n = 2); synovial fluid (n = 2); and hepatic abscesses (n = 2). 2.1.1. Bacterial isolates All 215 bacterial isolates were identified by Gram stain, agglutination tests, Microscan automate identification system (Dade Behring, Marburg, Germany), or API-20E test (Biomerieux, Marcy l' Etoile, France). These consisted of: 180 bacterial strains belonging to the 4 target species: H. influenzae (n = 25), S. aureus (n = 55), Streptococcus spp. (groups A, B, C, G, F, and S. pneumoniae) (n = 39), and P. aeruginosa (n = 61). In addition, there were 35 bacterial strains belonging to other species (Staphylococcus haemolyticus [n = 7), Staphylococcus epidermidis [n = 7) and other Staphylococcus spp. [Staphylococcus auricularis, Staphylococcus lugdunensis] [n = 3], Enterococcus spp. [Enterococcus faecium, Enterococcus faecalis] [n = 5], Escherichia coli [n = 3], Gardnerella vaginalis [n = 1], Enterobacter cloacae [n = 1], Xanthomonas maltophilia [n = 1], N. meningitidis [n = 1], Acinetobacter [n = 3], Citrobacter [n = 1], Proteus [n = 1], and Salmonella [n = 1]). H. influenzae isolates were cultured on chocolate agar and Streptococcus spp. isolates on blood agar (OXOID Columbia agar, CM 0331, OXOID, Hampshire, England). Staphylococcus spp. isolates were cultured on mannitol salt agar (OXOID CM0085); Pseudomonas and other Gram-negative bacterial isolates were cultured on McConkey agar (Lab 30, LabM, Lancashire, UK). The first 2 microorganisms were incubated at 37 °C at the presence of 5% CO2 (v/v); the others were incubated at 37 °C for 24 h.
2.1.2. Clinical samples Patient samples were classified into the following categories: Category 1 consisted of culture-confirmed cases with 1 of 4 bacterial targets isolated. Eighty-four samples were obtained from 79 patients: blood (n = 5), CSF (n = 9), ear fluids (n = 42), BAL (n = 28). Category 2 consisted of culture-confirmed cases for other bacterial species. Twenty-nine samples were obtained from 25 patients: blood samples (n = 10), CSF (n = 11), ear fluids (n = 4), and BAL (n = 4), from which the following were identified: Cryptococcus spp. (n = 1), Klebsiella pneumoniae (n = 3), Pasteurella spp. (n = 1), Mycobacterium tuberculosis (n = 1), E. coli (n = 3), Enterococcus spp. (n = 3), Staphylococcus hominis (n = 1), Moraxella catarrhalis (n = 3), S. auricularis (n = 1), Amoeba (n = 1), Serratia spp. (n = 1), Stenotrophomonas maltophilia (n = 2), Stenotrophomonas werneri (n = 1), N. meningitidis (n = 3). Category 3 consisted of culture-negative cases. Six hundred ten samples were obtained from 484 patients: blood (n = 244), CSF (n = 226), pleural fluid (n = 8), bronchial secretions (n = 8), BAL (n = 30), ear fluid (n = 66), ophthalmic fluid (n = 22), blood cultures (n = 2), synovial fluids (n = 2), hepatic abscesses (n = 2). Category 4 consisted of clinically diagnosed cases as viral meningitis. Twenty-nine samples were obtained from 19 patients: blood (n = 13) and CSF (n = 16). 2.2. DNA isolation DNA isolation from bacterial strains, blood, CSF, and blood culture was carried out as described previously (Shrestha et al., 2002; Tzanakaki et al., 2005). DNA isolation from pleural, synovial, and ear fluids was carried out by the same procedure as DNA isolation from CSF. DNA from BAL, bronchial secretion, and hepatic abscesses was extracted with QIAmp DNA Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions for DNA isolation from tissue with a slight modification in the 1st steps of the procedure (Strålin et al., 2005): 200 μL of the sample were centrifuged at 1700 × g for 10 min. The supernatant was discarded and 180 μL of buffer ATL (QIAamp DNA Mini kit buffer) and 25 μL of proteinase K were added to the pellet. 2.3. Polymerase chain reaction amplification Amplification reactions contained 0.4 μmol/L of each of PsaeL/R primers (VBC, Hamburg, Germany), 0.7 μmol/L each of F1/R1 primers, 0.3 μmol/L each of Str1/2 primers and nuc1/2 primers, 1 mmol/L dNTPs (ABgene, Epsom, UK), 1.5 U Hotstart Taq (Finnzymes, Finland), 1.4× reaction buffer, and 5 μL DNA template in a total volume 25 μL. Polymerase chain reaction conditions were 95 °C for 10 min; 95 °C for 25 s; 61 °C for 10 s; and 68 °C for 1.5 min for the first 10 cycles. This was followed by 26 cycles at 95 °C for 25 s, 59 °C for 10 s, 68 °C for 1.5 min, and a final step of 68 °C for 5 min (Apollo ATC 201 thermal cycler, Nyx
A. Xirogianni et al. / Diagnostic Microbiology and Infectious Disease 63 (2009) 121–126
Technik, San Diego, USA). Amplicons were visualized under ultraviolet fluorescence following electrophoresis in 2.5% (w/v) agarose gel stained with ethidium bromide. Positive controls from standard strains of P. aeruginosa, H. influenzae, S. aureus, Streptococcus pyogenes (5 ng of each DNA), as well as negative controls, were included in each assay. Specific primers for S. aureus nuc gene (nuc1/2) and Streptococcus spp. tuf gene (Str1/2) were based on those described previously (Picard et al., 2004; Zhang et al., 2004), with resulting amplicon sizes of 278 and 198 bp, respectively. To distinguish more readily between the amplicon sizes by electrophoresis for H. influenzae hel gene (F1/R1) (Yadav et al., 2003) and P. aeruginosa oprL gene (PsaeL/R) (De Vos et al., 1997), we designed new oligonucleotide primers using Primer3 software (http:// frodo.wi.mit.edu/cgi-bin/primer3/primer3_http://www.cgi) with resulting amplicon sizes of 545 and 438 bp, respectively (Table 1).
123
Fig. 1. Examples of the results observed when the multiplex PCR assay was applied on clinical samples. Lanes: L, φX174 HaeIII digest (100-bp ladder); 1, positive control for all 4 targets (5 ng of each DNA): H. influenzae (545 bp), P. aeruginosa (438 bp), S. aureus (278 bp), and Streptococcus spp. (198 bp); 2 and 3, negative controls (blood and CSF samples respectively); 4 to 8, clinical samples from blood (4) CSF (5), bronchial secretions (7), ear fluids (6.8); negative control (9).
2.4. Sensitivity and specificity assessment Sensitivity was tested with DNA extracted from samples belonging to category 1 (culture-confirmed cases). In addition, to determine the sensitivity of the assay, we amplified serial dilutions of spectrophotometrically quantified DNA (5 ng to 5 pg per reaction) from each microorganism. Specificity was tested with DNA extracted from the 35 bacteria other than the 4 target species, as well as with clinical samples belonging to categories 2 and 4. Clinical samples (such as whole blood) contain large amounts of human DNA, as well as inhibitors (such as hemoglobin) for the assay, and only a small amount of bacterial DNA. To evaluate the potential inhibition of amplification, we added amounts of 5.0 and 0.5 ng of bacterial DNA under investigation to blood samples obtained from healthy individuals.
organisms investigated, as determined by repeated experiments with serial diluted DNA samples, was 5 pg. The multiplex PCR assay identified successfully all 180 bacterial strains belonging to the 4 target species; moreover, no amplification products were detected for the 35 strains belonging to other species. In addition, the assay gave positive results for 262 (43.2%) of 607 cases tested. Table 2 summarizes the results obtained from clinical samples, according to the microorganism involved by sample category. 3.2. Sensitivity and specificity
3. Results
Sensitivity of the multiplex PCR assay was evaluated with data from culture-confirmed cases (category 1) for each microorganism individually. Sensitivity ranged from 100% for Streptococcus spp., P. aeruginosa, and S. aureus to 94.3% for H. influenzae. The positive predictive and negative predictive values were 100% to 92.6%, respectively
3.1. Polymerase chain reaction amplification Amplification of each target was unaffected by the presence of DNA from other 3 organisms (Fig. 1). In multiplex reactions, the detection limits for all 4 micro-
Table 1 Oligonucleotides used in multiplex PCR for the identification of H. influenzae, P. aeruginosa, S. aureus, and Streptococcus spp. Microorganism
Primary sequence (5′–3′)
Gene
GenBank accession no.
Product size (bp)
Publication
H. influenzae
F1:TGATCAAAACCAAGGCAAAT R1:CCCAAGCTTGTACTGCATCT PsaeL:GCGATCACCACCTTCTACTT PsaeR:CAACGCCGTCATACACAG nuc1:GCGATTGATGGTGATACGGTT nuc2:AGCCAAGCCTTGACGAACTAAAGC Str1: GTACAGTTGCTTCAGGACGTATC Str2:ACGTTCGATTTCATC ACGTTG
hel
M68502
545
This study
oprL
Z50191
418
This study
nuc
V01281
279
Zhang et al. (2004)
tuf
AY267003
197
Picard et al. (2004)
P. aeruginosa S. aureus Streptococcus spp.
124
A. Xirogianni et al. / Diagnostic Microbiology and Infectious Disease 63 (2009) 121–126
Table 2 Polymerase chain reaction results according to patients, clinical sample, and microorganism Sample categories (no. of samples/ no. of patients)
PCR positive Samples (no.)
H. influenzae
P. aeruginosa
S. aureus
Streptococcus spp.
(1) Culture confirmed (84/79)
Blood (5) CSF (9) BAL (28) Ear fluids (42) Blood (10) CSF (11) BAL (4) Ear fluids (4) Blood (244) CSF (226) Pleural fluids (8) Bronchial secretions (8) BAL (30) Ear fluids (66) Ophthalmic fluids (22) Blood cultures (2) Synovial fluids (2) Hepatic abscesses (2) Blood (13) CSF (16)
2 2 23 9 0 0 0 0 0 3 1 1 4 8 8 0 0 0 0 0
1 2 2 7 0 0 0 0 1 2 0 6 4 9 0 0 0 0 0 0
1 0 1 15 0 0 0 0 3 2 1 0 5 11 7 0 0 0 0 0
1 5 2 9 0 0 0 0 50 30 2 1 10 21 3 1 2 1 0 0
(2) Culture other bacteria (29/25)
(3) Culture negative (610/484)
(4) Viral (29/19)
PCR negative
(Table 3). The specificity of the assay was evaluated in relation to data from 44 patients classified as suffering from viral meningitis (n = 19; category 4) or infections due to other bacteria (n = 25; category 2) as well as from DNA samples isolated from the 35 other bacterial strains that were not related to the microorganisms under investigation. No amplicons were obtained in any of the above samples/ isolates, suggesting that the specificity of the assay was 100% (positive predictive value [PPV], 100%; negative predictive value [NPV], 98.3%). Positive results were obtained even in blood samples containing as little as 0.005 ng of bacterial DNA per 1 μL of blood. These findings indicate that the presence of human DNA does not effect the detection limit of the assay even when very small amount of bacterial DNA is present.
4. Discussion The present study combined successfully the simultaneous detection of H. influenzae, S. aureus, P. aeruginosa, and Streptococcus spp. directly in clinical samples with a multiplex PCR assay, used as target genus- or species-
0 0 0 2 10 11 4 4 190 189 4 0 7 17 4 1 1 13 16
specific genes. Although several PCR and real-time PCR methods have been developed, to obtain more accurate and sensitive identification of the above bacterial species in clinical samples (Balganesh et al., 2000; Costa et al., 2005; Palomares et al., 2003; Xu et al., 2004), none refers to the simultaneous assessment of the 4 species in the same sample. Many prior publications were based on broad-range PCR and hybridization of primers on 16S rRNA gene; however, broad-range PCR is usually followed by other techniques for further identification, such as restriction fragment length polymorphism (Lu et al., 2000), sequencing (Tsai and Teng, 2004; Xu et al., 2005), fluorescence in situ hybridization (Poppert et al., 2005), or single strand conformation polymorphism (Turenne et al., 2000). All these methods are cost effective and time-consuming for routine microbiology laboratory practice. In addition, broad-range PCR can yield false-positive results due to nonspecific amplification from Taq polymerases (Corless et al., 2000; Schuurman et al., 2004). Considering the limitations described for the studies above, primer pairs used in the PCR assay hybridize with species-specific genes. Polymerase chain reaction amplification was 1st applied with single reactions, then it was
Table 3 Sensitivity of the multiplex PCR assay for detection of 4 targets Organism
Culture-confirmed cases
Sensitivity (%)
PPV (%)
NPV (%)
H. influenzae P. aeruginosa S. aureus Streptococcus spp.
33/35 11/11 17/17 16/16
94.3 100 100 100
100 (95% CI, 93.2–100) 100 (95% CI, 84.5–100) 100 (95% CI, 89.7–100) 100 (95% CI, 89.7–100)
92.6 (95% CI, 84.2–92.6) 100 (95% CI, 93.2–100) 100 (95% CI, 93–100) 100 (95% CI, 93–100)
CI = confidence interval.
A. Xirogianni et al. / Diagnostic Microbiology and Infectious Disease 63 (2009) 121–126
optimized as a multiplex reaction (Henegariu et al., 1997), and finally, it was applied to clinical samples. The PCR assay was positive for 262 of 607 cases tested (43.2%). Positive results included 77 of 79 cultureconfirmed cases tested (category 1). The lowest sensitivity of the 4 reactions was recorded for H. influenzae hel gene. Two ear fluid specimens were PCR negative, although these were confirmed by culture; consequently, the sensitivity of the assay for this microorganism was calculated to be 94.3%, reducing the overall NPV to 98.2%. The 4 primer pairs did not yield cross-reactions. Among the 345 PCR-negative cases, 25 had been culture confirmed as other bacteria species (category 2) and 19 had been clinically diagnosed as viral meningitis (category 4). As a result, the specificity of the technique showed to be as high as 100%. Overall, the single-tube PCR assay described is a simple, reliable, and easily implemented method for further identification of microorganisms causing bacterial meningitis and/or septicemia. In addition, the proposed multiplex PCR assay can be implemented in a wide range of samples such as ear, pleural, synovial, and ophthalmic fluids, bronchial secretions, BAL, blood cultures, and hepatic abscesses. The high specificity and sensitivity are useful for the rapid identification of causative agents and, consequently, the diagnosis of respiratory tract disease, meningitis, and septicemia, particularly when early treatment with antibiotics impairs detection by culture. Acknowledgments The authors would like to thank Professor Caroline Blackwell for helpful comments and discussions. They would also like to thank the following microbiologists: A. Voyiatzi and A. Makri from Penteli's Children's Hospital, Athens, Greece, A. Argiropoulou from “Evangelismos” General Hospital of Athens, Greece and F. Markou form General Hospital of Serres, Greece and the pediatrician M. Tsolia from “P. and A. Kyriakou” Children's Hospital of Athens, Greece for sending samples to the National Meningitis Reference Laboratory, Athens, Greece.
References Balganesh M, Lalitha MK, Nathaniel R (2000) Rapid diagnosis of acute pyogenic meningitis by a combined dot-blot assay. Mol Cell Probes 14: 61–69. Berkley JA, Lowe BS, Mwangi I, Williams T, Bauni E, Mwarumba S, Ngetsa C, Slack MP, Njenga S, Hart CA, Maitland K, English M, Marsh K, Scott JA (2005) Bacteraemia among children admitted to a rural hospital in Kenya. N Engl J Med 352:39–47. Bert F, Maubec E, Bruneau B, Berry P, Lambert-Zechovsky N (1998) Multiresistant Pseudomonas aeruginosa outbreak associated with contaminated tap water in a neurosurgery intensive care unit. J Hosp Infect 39: 53–62. Cherian T, Lalitha MK, Manoharan A, Thomas K, Yolken RH, Steinhoff MC (1998) PCR-enzyme immunoassay for detection of S. pneumoniae DNA
125
in cerebrospinal fluid samples from patients with culture-negative meningitis. J Clin Microbiol 36:3605–3608. Corless CE, Guiver M, Borrow R, Edwards-Jones V, Kaczmarski EB, Fox AJ (2000) Contamination and sensitivity issues with a real-time universal 16S rRNA PCR. J Clin Microbiol 38:1747–1752. Costa AM, Kay I, Palladino S (2005) Rapid detection of mecA and nuc genes in staphylococci by real-time multiplex polymerase chain reaction. Diagn Microb Infect Dis 51:13–17. De Vos D, Lim A, Pirnay JP, Struelens M, Vandelvelde C, et al. (1997) Direct detection and identification of Pseudomonas aeruginosa in clinical samples such as skin biopsy specimens and expectorations by multiplex PCR based on two major outer membrane lipoprotein genes. oprI and oprL. J Clin Microbiol 35:1295–1299. Degani N, Navarro C, Deeks SL, Lovgren M (2008) Invasive bacterial diseases in northern Canada Jan. Emerg Infect Dis 14:34–40. Gill SR, Fouts DE, Archer GL, Mongodin EF, Deboy RT, et al. (2005) Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing methicillin-resistant Staphylococcus epidermidis strain. J Bacteriol 187:2426–2438. Henegariu O, Heerema NA, Dlouhy SR, Vance GH, Vogt PH (1997) Multiplex PCR: critical parameters and step-by-step protocol. Biotechniques 23:504–511. Lu JJ, Perng CL, Lee SY, Wan CC (2000) Use of PCR with universal primers and restriction endonuclease digestions for detection and identification of common bacterial pathogens in cerebrospinal fluid. J Clin Microbiol 38:2076–2080. Lu CH, Huang CR, Chang WN, Chang CJ, Cheng BC, Lee PY, Lin MW, Chang HW (2002) Community-acquired bacterial meningitis in adults: the epidemiology, timing of appropriate antimicrobial therapy, and prognostic factors. Clin Neurol Neurosurg 104:352–358. Muyldermans G, de Smet F, Pierard D, Steenssens L, Stevens D, Bougatef A, Lauwers S (1998) Neonatal infections with Pseudomonas aeruginosa associated with a water-bath used to thaw fresh frozen plasma. J Hosp Infect 39:309–314. Palomares C, Torres MJ, Torres A, Aznar J, Palomares JC (2003) Rapid detection and identification of Staphylococcus aureus from blood culture specimens using real-time fluorescence PCR. Diagn Microb Infect Dis 45:183–189. Picard F, Ke D, Boudreau D, Boissinot M, Huletsky A, Richard D, Ouellette M, Roy PH, Bergeron MG (2004) Use of tuf sequences for genus-specific PCR detection and phylogenetic analysis of 28 streptococcal species. J Clin Microbiol 42:3686–3695. Pintado V, Meseguer MA, Fortún J, Cobo J, Navas EQuereda C, Corral I, Moreno S (2002) Clinical study of 44 cases of Staphylococcus aureus meningitis. Eur J Clin Microbiol Infect Dis 21:864–868. Poppert S, Essig A, Stoehr B, Steingruber A, Wirths B, Juretschko S, Reischl U, Wellinghausen N (2005) Rapid diagnosis of bacterial meningitis by real-time PCR and fluorescence in situ hybridization. J Clin Microbiol 43:3390–3397. Shrestha NK, Tuohy MJ, Hall GS, Isada CM, Procop GW (2002) Rapid identification of Staphylococcus aureus and the mecA gene from BacT/ ALERT blood culture bottles by using the LightCycler system. J Clin Microbiol 40:2659–2661. Strålin K, Bäckman A, Holmberg H, Fredlund H, Olcén P (2005) Design of a multiplex PCR for Streptococcus pneumoniae, Haemophilus influenzae, Mycoplasma pneumoniae and Chlamydophila pneumoniae to be used on sputum samples. APMIS 113:99–111. Schuurman T, de Boer RF, Kooistra Smid AMD, van Zwet AA (2004) Prospective study of use of PCR amplification and sequencing of 16S ribosomal DNA from cerebrospinal fluid for diagnosis of bacterial meningitis in a clinical setting. J Clin Microbiol 42: 734–740. Tsai JC, Teng LJ (2004) Direct detection of bacterial pathogens in brain abscesses by PCR amplification and sequencing of partial 16S ribosomal deoxyribonucleic acid fragments. Neurosurgery 55: 1154–1162.
126
A. Xirogianni et al. / Diagnostic Microbiology and Infectious Disease 63 (2009) 121–126
Tsai MH, Lu CH, Huang CR, Chuang YC, Tsai NW, Tsai HH, Chen SF, Li CS, Chang HW, Chien CC, Chang WN (2006) Infection. Bacterial meningitis in young adults in Southern Taiwan: clinical characteristics and therapeutic outcomes. Infection 34:2–8. Turenne CY, Witwicki E, Hoban DJ, Karlowsky JA, Kabani AM (2000) Rapid identification of bacteria from positive blood cultures by fluorescence-based PCR-single-strand conformation polymorphism analysis of the 16S rRNA gene. J Clin Microbiol 38:513–520. Tzanakaki G, Tsolia M, Vlachou V, Theodoridou M, Pangalis A, Foustoukou M, Karpathios T, Blackwell CC, Kremastinou J (2003) Evaluation of non-culture diagnosis of invasive meningococcal disease by polymerase chain reaction (PCR). FEMS Immunol Med Microbiol 39:31–36. Tzanakaki G, Tsopanomichalou M, Kesanopoulos K, Matzourani R, Sioumala M, Tabaki A, Kremastinou J (2005) Simultaneous singletube PCR assay for the detection of Neisseria meningitidis, Haemophilus influenzae type b and Streptococcus pneumoniae. Clin Microbiol Infect 11:386–390.
van Deuren M, Brandtzaeg P, van der Meer JW (2000) Update on meningococcal disease with emphasis on pathogenesis and clinical management. Clin Microbiol Rev 13:144–166. Xu J, Moore JE, Murphy PG, Millar BC, Elborn JS (2004) Early detection of Pseudomonas aeruginosa—comparison of conventional versus molecular (PCR) detection directly from adult patients with cystic fibrosis (CF). Ann Clin Microbiol Antimicrob 3:21. Xu J, Moore JE, Millar BC, Webb H, Shields MD, Goldsmith CE (2005) Employment of broad range 16S rDNA PCR and sequencing in the detection of aetiological agents of meningitis. New Microbiol 28:135–143. Yadav MC, Chakraborti A, Ray P, Sapru S, Majumdar S, Narang A (2003) Rapid detection of Haemophilus influenzae by hel gene polymerase chain reaction. Lett Appl Microbiol 37:190–195. Zhang K, Sparling J, Chow BL, Elsayed S, Hussain Z, Church DL, Gregson DB, Louie T, Conly JM (2004) New quadriplex PCR assay for detection of methicillin and mupirocin resistance and simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci. J Clin Microbiol 42:4947–4955.
Diagnostic Microbiology and Infectious Disease 63 (2009) 121 – 126 www.elsevier.com/locate/diagmicrobio
Bacteriology
Development of a single-tube polymerase chain reaction assay for the simultaneous detection of Haemophilus influenzae, Pseudomonas aeruginosa, Staphylococcus aureus, and Streptococcus spp. directly in clinical samples Athanasia Xirogiannia,b , Georgina Tzanakakia,⁎, Eleni Karagiannia , Panayiotis Markoulatosb , Jenny Kourea-Kremastinoua a National Meningitis Reference Laboratory, National School of Public Health, Athens, Greece Department of Biochemistry and Biotechnology, School of Health Science, University of Thessaly, Larissa, Greece Received 11 August 2008; accepted 30 September 2008
b
Abstract This study describes the development and evaluation of a multiplex single-tube polymerase chain reaction assay for the simultaneous detection of Haemophilus influenzae, Pseudomonas aeruginosa, Staphylococcus aureus, and Streptococcus spp. used as target speciesspecific or genus-specific genes. The assay enables the detection of 5 to 50 pg of bacterial DNA. The sensitivity of the assay was evaluated as 100% for P. aeruginosa, S. aureus, and Streptococcus spp., and 94.3% for H. influenzae; the specificity was 100% for all 4 microorganisms (positive predictive value, 100%; negative predictive value, 98.2%). The assay permits rapid and accurate detection of these 4 microorganisms in a wide range of clinical samples such as whole blood, cerebrospinal, ear, pleural and ophthalmic fluids, as well as bronchoalveolar lavage and bronchial secretions. © 2009 Published by Elsevier Inc. Keywords: Haemophilus influenzae; Streptococcus spp.; Pseudomonas aeruginosa; Staphylococcus aureus; Multiplex PCR; Clinical samples
1. Introduction Meningitis receives a high level of medical, public, and media attention because of its rapid onset and high level of morbidity and mortality (van Deuren et al., 2000). In addition to the 3 main microorganisms causing bacterial meningitis (Neisseria meningitidis, Haemophilus influenzae type b and Streptococcus pneumoniae), Staphylococcus aureus, H. influenzae, Streptococcus spp., and Pseudomonas aeruginosa can also cause severe infections such as septicemia, meningitis, and pneumonia, resulting high mortality rates worldwide (Berkley et al., 2005; Bert et al., 1998; Degani et al., 2008; Gill et al., 2005; Lu et al., 2002; Muyldermans et al., 1998; Pintado et al., 2002; Tsai et al., 2006). ⁎ Corresponding author. Tel.: +30-213-20-10-267; fax: +30-210-64-23041. E-mail address: [email protected] (G. Tzanakaki). 0732-8893/$ – see front matter © 2009 Published by Elsevier Inc. doi:10.1016/j.diagmicrobio.2008.09.017
For their identification, conventional methods such as culture or biochemical tests can be carried out; however, these are time-consuming and of low sensitivity, especially if the patient has been treated with antibiotics. In addition, culture methods sometimes cannot reveal 2 or more organisms in the same culture medium if there is overgrowth by a predominant species. For these reasons, there is a need of more accurate and rapid identification to guide accurate treatment. During the last decade, molecular techniques for diagnosis of infections have become more prevalent. Molecular techniques, such as polymerase chain reaction (PCR) methods, are more accurate and more sensitive (Cherian et al., 1998; Tzanakaki et al., 2003). In addition, the development of a multiplex PCR assay and its direct application in clinical samples permits rapid and accurate identification of more than 1 microorganism simultaneously in a single-tube PCR reaction.
122
A. Xirogianni et al. / Diagnostic Microbiology and Infectious Disease 63 (2009) 121–126
Herein, we describe the development of a rapid, sensitive, and accurate PCR assay for the simultaneous detection of S. aureus, H. influenzae, Streptococcus spp., and P. aeruginosa directly in clinical samples. The development of this assay initially aimed for the detection of the 4 aforementioned microorganisms causing meningitis and/or septicemia directly in clinical samples such as cerebrospinal fluid (CSF) and blood. Furthermore, the application of the assay was found to be a useful diagnostic tool when applied on a wide range of clinical samples such as ear, pleural, and ophthalmic fluids, bronchoalveolar lavage (BAL), and bronchial secretions.
2. Materials and methods 2.1. Patient specimens A total of 966 samples were sent to the National Meningitis Reference Laboratory, Athens, Greece, from hospitals throughout the country between January 2003 and February 2008. The samples included bacterial strains (n = 215) isolated from blood, CSF, bronchial fluid, ear fluid or swabs, pus and wound swabs, as well as clinical samples (n = 751) isolated from 607 patients; CSF (n = 262); whole blood (n = 272); pleural fluid (n = 8); bronchial secretions (n = 8); BAL (n = 61); ear fluid (n = 112); ophthalmic fluid (n = 22); blood cultures (n = 2); synovial fluid (n = 2); and hepatic abscesses (n = 2). 2.1.1. Bacterial isolates All 215 bacterial isolates were identified by Gram stain, agglutination tests, Microscan automate identification system (Dade Behring, Marburg, Germany), or API-20E test (Biomerieux, Marcy l' Etoile, France). These consisted of: 180 bacterial strains belonging to the 4 target species: H. influenzae (n = 25), S. aureus (n = 55), Streptococcus spp. (groups A, B, C, G, F, and S. pneumoniae) (n = 39), and P. aeruginosa (n = 61). In addition, there were 35 bacterial strains belonging to other species (Staphylococcus haemolyticus [n = 7), Staphylococcus epidermidis [n = 7) and other Staphylococcus spp. [Staphylococcus auricularis, Staphylococcus lugdunensis] [n = 3], Enterococcus spp. [Enterococcus faecium, Enterococcus faecalis] [n = 5], Escherichia coli [n = 3], Gardnerella vaginalis [n = 1], Enterobacter cloacae [n = 1], Xanthomonas maltophilia [n = 1], N. meningitidis [n = 1], Acinetobacter [n = 3], Citrobacter [n = 1], Proteus [n = 1], and Salmonella [n = 1]). H. influenzae isolates were cultured on chocolate agar and Streptococcus spp. isolates on blood agar (OXOID Columbia agar, CM 0331, OXOID, Hampshire, England). Staphylococcus spp. isolates were cultured on mannitol salt agar (OXOID CM0085); Pseudomonas and other Gram-negative bacterial isolates were cultured on McConkey agar (Lab 30, LabM, Lancashire, UK). The first 2 microorganisms were incubated at 37 °C at the presence of 5% CO2 (v/v); the others were incubated at 37 °C for 24 h.
2.1.2. Clinical samples Patient samples were classified into the following categories: Category 1 consisted of culture-confirmed cases with 1 of 4 bacterial targets isolated. Eighty-four samples were obtained from 79 patients: blood (n = 5), CSF (n = 9), ear fluids (n = 42), BAL (n = 28). Category 2 consisted of culture-confirmed cases for other bacterial species. Twenty-nine samples were obtained from 25 patients: blood samples (n = 10), CSF (n = 11), ear fluids (n = 4), and BAL (n = 4), from which the following were identified: Cryptococcus spp. (n = 1), Klebsiella pneumoniae (n = 3), Pasteurella spp. (n = 1), Mycobacterium tuberculosis (n = 1), E. coli (n = 3), Enterococcus spp. (n = 3), Staphylococcus hominis (n = 1), Moraxella catarrhalis (n = 3), S. auricularis (n = 1), Amoeba (n = 1), Serratia spp. (n = 1), Stenotrophomonas maltophilia (n = 2), Stenotrophomonas werneri (n = 1), N. meningitidis (n = 3). Category 3 consisted of culture-negative cases. Six hundred ten samples were obtained from 484 patients: blood (n = 244), CSF (n = 226), pleural fluid (n = 8), bronchial secretions (n = 8), BAL (n = 30), ear fluid (n = 66), ophthalmic fluid (n = 22), blood cultures (n = 2), synovial fluids (n = 2), hepatic abscesses (n = 2). Category 4 consisted of clinically diagnosed cases as viral meningitis. Twenty-nine samples were obtained from 19 patients: blood (n = 13) and CSF (n = 16). 2.2. DNA isolation DNA isolation from bacterial strains, blood, CSF, and blood culture was carried out as described previously (Shrestha et al., 2002; Tzanakaki et al., 2005). DNA isolation from pleural, synovial, and ear fluids was carried out by the same procedure as DNA isolation from CSF. DNA from BAL, bronchial secretion, and hepatic abscesses was extracted with QIAmp DNA Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions for DNA isolation from tissue with a slight modification in the 1st steps of the procedure (Strålin et al., 2005): 200 μL of the sample were centrifuged at 1700 × g for 10 min. The supernatant was discarded and 180 μL of buffer ATL (QIAamp DNA Mini kit buffer) and 25 μL of proteinase K were added to the pellet. 2.3. Polymerase chain reaction amplification Amplification reactions contained 0.4 μmol/L of each of PsaeL/R primers (VBC, Hamburg, Germany), 0.7 μmol/L each of F1/R1 primers, 0.3 μmol/L each of Str1/2 primers and nuc1/2 primers, 1 mmol/L dNTPs (ABgene, Epsom, UK), 1.5 U Hotstart Taq (Finnzymes, Finland), 1.4× reaction buffer, and 5 μL DNA template in a total volume 25 μL. Polymerase chain reaction conditions were 95 °C for 10 min; 95 °C for 25 s; 61 °C for 10 s; and 68 °C for 1.5 min for the first 10 cycles. This was followed by 26 cycles at 95 °C for 25 s, 59 °C for 10 s, 68 °C for 1.5 min, and a final step of 68 °C for 5 min (Apollo ATC 201 thermal cycler, Nyx
A. Xirogianni et al. / Diagnostic Microbiology and Infectious Disease 63 (2009) 121–126
Technik, San Diego, USA). Amplicons were visualized under ultraviolet fluorescence following electrophoresis in 2.5% (w/v) agarose gel stained with ethidium bromide. Positive controls from standard strains of P. aeruginosa, H. influenzae, S. aureus, Streptococcus pyogenes (5 ng of each DNA), as well as negative controls, were included in each assay. Specific primers for S. aureus nuc gene (nuc1/2) and Streptococcus spp. tuf gene (Str1/2) were based on those described previously (Picard et al., 2004; Zhang et al., 2004), with resulting amplicon sizes of 278 and 198 bp, respectively. To distinguish more readily between the amplicon sizes by electrophoresis for H. influenzae hel gene (F1/R1) (Yadav et al., 2003) and P. aeruginosa oprL gene (PsaeL/R) (De Vos et al., 1997), we designed new oligonucleotide primers using Primer3 software (http:// frodo.wi.mit.edu/cgi-bin/primer3/primer3_http://www.cgi) with resulting amplicon sizes of 545 and 438 bp, respectively (Table 1).
123
Fig. 1. Examples of the results observed when the multiplex PCR assay was applied on clinical samples. Lanes: L, φX174 HaeIII digest (100-bp ladder); 1, positive control for all 4 targets (5 ng of each DNA): H. influenzae (545 bp), P. aeruginosa (438 bp), S. aureus (278 bp), and Streptococcus spp. (198 bp); 2 and 3, negative controls (blood and CSF samples respectively); 4 to 8, clinical samples from blood (4) CSF (5), bronchial secretions (7), ear fluids (6.8); negative control (9).
2.4. Sensitivity and specificity assessment Sensitivity was tested with DNA extracted from samples belonging to category 1 (culture-confirmed cases). In addition, to determine the sensitivity of the assay, we amplified serial dilutions of spectrophotometrically quantified DNA (5 ng to 5 pg per reaction) from each microorganism. Specificity was tested with DNA extracted from the 35 bacteria other than the 4 target species, as well as with clinical samples belonging to categories 2 and 4. Clinical samples (such as whole blood) contain large amounts of human DNA, as well as inhibitors (such as hemoglobin) for the assay, and only a small amount of bacterial DNA. To evaluate the potential inhibition of amplification, we added amounts of 5.0 and 0.5 ng of bacterial DNA under investigation to blood samples obtained from healthy individuals.
organisms investigated, as determined by repeated experiments with serial diluted DNA samples, was 5 pg. The multiplex PCR assay identified successfully all 180 bacterial strains belonging to the 4 target species; moreover, no amplification products were detected for the 35 strains belonging to other species. In addition, the assay gave positive results for 262 (43.2%) of 607 cases tested. Table 2 summarizes the results obtained from clinical samples, according to the microorganism involved by sample category. 3.2. Sensitivity and specificity
3. Results
Sensitivity of the multiplex PCR assay was evaluated with data from culture-confirmed cases (category 1) for each microorganism individually. Sensitivity ranged from 100% for Streptococcus spp., P. aeruginosa, and S. aureus to 94.3% for H. influenzae. The positive predictive and negative predictive values were 100% to 92.6%, respectively
3.1. Polymerase chain reaction amplification Amplification of each target was unaffected by the presence of DNA from other 3 organisms (Fig. 1). In multiplex reactions, the detection limits for all 4 micro-
Table 1 Oligonucleotides used in multiplex PCR for the identification of H. influenzae, P. aeruginosa, S. aureus, and Streptococcus spp. Microorganism
Primary sequence (5′–3′)
Gene
GenBank accession no.
Product size (bp)
Publication
H. influenzae
F1:TGATCAAAACCAAGGCAAAT R1:CCCAAGCTTGTACTGCATCT PsaeL:GCGATCACCACCTTCTACTT PsaeR:CAACGCCGTCATACACAG nuc1:GCGATTGATGGTGATACGGTT nuc2:AGCCAAGCCTTGACGAACTAAAGC Str1: GTACAGTTGCTTCAGGACGTATC Str2:ACGTTCGATTTCATC ACGTTG
hel
M68502
545
This study
oprL
Z50191
418
This study
nuc
V01281
279
Zhang et al. (2004)
tuf
AY267003
197
Picard et al. (2004)
P. aeruginosa S. aureus Streptococcus spp.
124
A. Xirogianni et al. / Diagnostic Microbiology and Infectious Disease 63 (2009) 121–126
Table 2 Polymerase chain reaction results according to patients, clinical sample, and microorganism Sample categories (no. of samples/ no. of patients)
PCR positive Samples (no.)
H. influenzae
P. aeruginosa
S. aureus
Streptococcus spp.
(1) Culture confirmed (84/79)
Blood (5) CSF (9) BAL (28) Ear fluids (42) Blood (10) CSF (11) BAL (4) Ear fluids (4) Blood (244) CSF (226) Pleural fluids (8) Bronchial secretions (8) BAL (30) Ear fluids (66) Ophthalmic fluids (22) Blood cultures (2) Synovial fluids (2) Hepatic abscesses (2) Blood (13) CSF (16)
2 2 23 9 0 0 0 0 0 3 1 1 4 8 8 0 0 0 0 0
1 2 2 7 0 0 0 0 1 2 0 6 4 9 0 0 0 0 0 0
1 0 1 15 0 0 0 0 3 2 1 0 5 11 7 0 0 0 0 0
1 5 2 9 0 0 0 0 50 30 2 1 10 21 3 1 2 1 0 0
(2) Culture other bacteria (29/25)
(3) Culture negative (610/484)
(4) Viral (29/19)
PCR negative
(Table 3). The specificity of the assay was evaluated in relation to data from 44 patients classified as suffering from viral meningitis (n = 19; category 4) or infections due to other bacteria (n = 25; category 2) as well as from DNA samples isolated from the 35 other bacterial strains that were not related to the microorganisms under investigation. No amplicons were obtained in any of the above samples/ isolates, suggesting that the specificity of the assay was 100% (positive predictive value [PPV], 100%; negative predictive value [NPV], 98.3%). Positive results were obtained even in blood samples containing as little as 0.005 ng of bacterial DNA per 1 μL of blood. These findings indicate that the presence of human DNA does not effect the detection limit of the assay even when very small amount of bacterial DNA is present.
4. Discussion The present study combined successfully the simultaneous detection of H. influenzae, S. aureus, P. aeruginosa, and Streptococcus spp. directly in clinical samples with a multiplex PCR assay, used as target genus- or species-
0 0 0 2 10 11 4 4 190 189 4 0 7 17 4 1 1 13 16
specific genes. Although several PCR and real-time PCR methods have been developed, to obtain more accurate and sensitive identification of the above bacterial species in clinical samples (Balganesh et al., 2000; Costa et al., 2005; Palomares et al., 2003; Xu et al., 2004), none refers to the simultaneous assessment of the 4 species in the same sample. Many prior publications were based on broad-range PCR and hybridization of primers on 16S rRNA gene; however, broad-range PCR is usually followed by other techniques for further identification, such as restriction fragment length polymorphism (Lu et al., 2000), sequencing (Tsai and Teng, 2004; Xu et al., 2005), fluorescence in situ hybridization (Poppert et al., 2005), or single strand conformation polymorphism (Turenne et al., 2000). All these methods are cost effective and time-consuming for routine microbiology laboratory practice. In addition, broad-range PCR can yield false-positive results due to nonspecific amplification from Taq polymerases (Corless et al., 2000; Schuurman et al., 2004). Considering the limitations described for the studies above, primer pairs used in the PCR assay hybridize with species-specific genes. Polymerase chain reaction amplification was 1st applied with single reactions, then it was
Table 3 Sensitivity of the multiplex PCR assay for detection of 4 targets Organism
Culture-confirmed cases
Sensitivity (%)
PPV (%)
NPV (%)
H. influenzae P. aeruginosa S. aureus Streptococcus spp.
33/35 11/11 17/17 16/16
94.3 100 100 100
100 (95% CI, 93.2–100) 100 (95% CI, 84.5–100) 100 (95% CI, 89.7–100) 100 (95% CI, 89.7–100)
92.6 (95% CI, 84.2–92.6) 100 (95% CI, 93.2–100) 100 (95% CI, 93–100) 100 (95% CI, 93–100)
CI = confidence interval.
A. Xirogianni et al. / Diagnostic Microbiology and Infectious Disease 63 (2009) 121–126
optimized as a multiplex reaction (Henegariu et al., 1997), and finally, it was applied to clinical samples. The PCR assay was positive for 262 of 607 cases tested (43.2%). Positive results included 77 of 79 cultureconfirmed cases tested (category 1). The lowest sensitivity of the 4 reactions was recorded for H. influenzae hel gene. Two ear fluid specimens were PCR negative, although these were confirmed by culture; consequently, the sensitivity of the assay for this microorganism was calculated to be 94.3%, reducing the overall NPV to 98.2%. The 4 primer pairs did not yield cross-reactions. Among the 345 PCR-negative cases, 25 had been culture confirmed as other bacteria species (category 2) and 19 had been clinically diagnosed as viral meningitis (category 4). As a result, the specificity of the technique showed to be as high as 100%. Overall, the single-tube PCR assay described is a simple, reliable, and easily implemented method for further identification of microorganisms causing bacterial meningitis and/or septicemia. In addition, the proposed multiplex PCR assay can be implemented in a wide range of samples such as ear, pleural, synovial, and ophthalmic fluids, bronchial secretions, BAL, blood cultures, and hepatic abscesses. The high specificity and sensitivity are useful for the rapid identification of causative agents and, consequently, the diagnosis of respiratory tract disease, meningitis, and septicemia, particularly when early treatment with antibiotics impairs detection by culture. Acknowledgments The authors would like to thank Professor Caroline Blackwell for helpful comments and discussions. They would also like to thank the following microbiologists: A. Voyiatzi and A. Makri from Penteli's Children's Hospital, Athens, Greece, A. Argiropoulou from “Evangelismos” General Hospital of Athens, Greece and F. Markou form General Hospital of Serres, Greece and the pediatrician M. Tsolia from “P. and A. Kyriakou” Children's Hospital of Athens, Greece for sending samples to the National Meningitis Reference Laboratory, Athens, Greece.
References Balganesh M, Lalitha MK, Nathaniel R (2000) Rapid diagnosis of acute pyogenic meningitis by a combined dot-blot assay. Mol Cell Probes 14: 61–69. Berkley JA, Lowe BS, Mwangi I, Williams T, Bauni E, Mwarumba S, Ngetsa C, Slack MP, Njenga S, Hart CA, Maitland K, English M, Marsh K, Scott JA (2005) Bacteraemia among children admitted to a rural hospital in Kenya. N Engl J Med 352:39–47. Bert F, Maubec E, Bruneau B, Berry P, Lambert-Zechovsky N (1998) Multiresistant Pseudomonas aeruginosa outbreak associated with contaminated tap water in a neurosurgery intensive care unit. J Hosp Infect 39: 53–62. Cherian T, Lalitha MK, Manoharan A, Thomas K, Yolken RH, Steinhoff MC (1998) PCR-enzyme immunoassay for detection of S. pneumoniae DNA
125
in cerebrospinal fluid samples from patients with culture-negative meningitis. J Clin Microbiol 36:3605–3608. Corless CE, Guiver M, Borrow R, Edwards-Jones V, Kaczmarski EB, Fox AJ (2000) Contamination and sensitivity issues with a real-time universal 16S rRNA PCR. J Clin Microbiol 38:1747–1752. Costa AM, Kay I, Palladino S (2005) Rapid detection of mecA and nuc genes in staphylococci by real-time multiplex polymerase chain reaction. Diagn Microb Infect Dis 51:13–17. De Vos D, Lim A, Pirnay JP, Struelens M, Vandelvelde C, et al. (1997) Direct detection and identification of Pseudomonas aeruginosa in clinical samples such as skin biopsy specimens and expectorations by multiplex PCR based on two major outer membrane lipoprotein genes. oprI and oprL. J Clin Microbiol 35:1295–1299. Degani N, Navarro C, Deeks SL, Lovgren M (2008) Invasive bacterial diseases in northern Canada Jan. Emerg Infect Dis 14:34–40. Gill SR, Fouts DE, Archer GL, Mongodin EF, Deboy RT, et al. (2005) Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing methicillin-resistant Staphylococcus epidermidis strain. J Bacteriol 187:2426–2438. Henegariu O, Heerema NA, Dlouhy SR, Vance GH, Vogt PH (1997) Multiplex PCR: critical parameters and step-by-step protocol. Biotechniques 23:504–511. Lu JJ, Perng CL, Lee SY, Wan CC (2000) Use of PCR with universal primers and restriction endonuclease digestions for detection and identification of common bacterial pathogens in cerebrospinal fluid. J Clin Microbiol 38:2076–2080. Lu CH, Huang CR, Chang WN, Chang CJ, Cheng BC, Lee PY, Lin MW, Chang HW (2002) Community-acquired bacterial meningitis in adults: the epidemiology, timing of appropriate antimicrobial therapy, and prognostic factors. Clin Neurol Neurosurg 104:352–358. Muyldermans G, de Smet F, Pierard D, Steenssens L, Stevens D, Bougatef A, Lauwers S (1998) Neonatal infections with Pseudomonas aeruginosa associated with a water-bath used to thaw fresh frozen plasma. J Hosp Infect 39:309–314. Palomares C, Torres MJ, Torres A, Aznar J, Palomares JC (2003) Rapid detection and identification of Staphylococcus aureus from blood culture specimens using real-time fluorescence PCR. Diagn Microb Infect Dis 45:183–189. Picard F, Ke D, Boudreau D, Boissinot M, Huletsky A, Richard D, Ouellette M, Roy PH, Bergeron MG (2004) Use of tuf sequences for genus-specific PCR detection and phylogenetic analysis of 28 streptococcal species. J Clin Microbiol 42:3686–3695. Pintado V, Meseguer MA, Fortún J, Cobo J, Navas EQuereda C, Corral I, Moreno S (2002) Clinical study of 44 cases of Staphylococcus aureus meningitis. Eur J Clin Microbiol Infect Dis 21:864–868. Poppert S, Essig A, Stoehr B, Steingruber A, Wirths B, Juretschko S, Reischl U, Wellinghausen N (2005) Rapid diagnosis of bacterial meningitis by real-time PCR and fluorescence in situ hybridization. J Clin Microbiol 43:3390–3397. Shrestha NK, Tuohy MJ, Hall GS, Isada CM, Procop GW (2002) Rapid identification of Staphylococcus aureus and the mecA gene from BacT/ ALERT blood culture bottles by using the LightCycler system. J Clin Microbiol 40:2659–2661. Strålin K, Bäckman A, Holmberg H, Fredlund H, Olcén P (2005) Design of a multiplex PCR for Streptococcus pneumoniae, Haemophilus influenzae, Mycoplasma pneumoniae and Chlamydophila pneumoniae to be used on sputum samples. APMIS 113:99–111. Schuurman T, de Boer RF, Kooistra Smid AMD, van Zwet AA (2004) Prospective study of use of PCR amplification and sequencing of 16S ribosomal DNA from cerebrospinal fluid for diagnosis of bacterial meningitis in a clinical setting. J Clin Microbiol 42: 734–740. Tsai JC, Teng LJ (2004) Direct detection of bacterial pathogens in brain abscesses by PCR amplification and sequencing of partial 16S ribosomal deoxyribonucleic acid fragments. Neurosurgery 55: 1154–1162.
126
A. Xirogianni et al. / Diagnostic Microbiology and Infectious Disease 63 (2009) 121–126
Tsai MH, Lu CH, Huang CR, Chuang YC, Tsai NW, Tsai HH, Chen SF, Li CS, Chang HW, Chien CC, Chang WN (2006) Infection. Bacterial meningitis in young adults in Southern Taiwan: clinical characteristics and therapeutic outcomes. Infection 34:2–8. Turenne CY, Witwicki E, Hoban DJ, Karlowsky JA, Kabani AM (2000) Rapid identification of bacteria from positive blood cultures by fluorescence-based PCR-single-strand conformation polymorphism analysis of the 16S rRNA gene. J Clin Microbiol 38:513–520. Tzanakaki G, Tsolia M, Vlachou V, Theodoridou M, Pangalis A, Foustoukou M, Karpathios T, Blackwell CC, Kremastinou J (2003) Evaluation of non-culture diagnosis of invasive meningococcal disease by polymerase chain reaction (PCR). FEMS Immunol Med Microbiol 39:31–36. Tzanakaki G, Tsopanomichalou M, Kesanopoulos K, Matzourani R, Sioumala M, Tabaki A, Kremastinou J (2005) Simultaneous singletube PCR assay for the detection of Neisseria meningitidis, Haemophilus influenzae type b and Streptococcus pneumoniae. Clin Microbiol Infect 11:386–390.
van Deuren M, Brandtzaeg P, van der Meer JW (2000) Update on meningococcal disease with emphasis on pathogenesis and clinical management. Clin Microbiol Rev 13:144–166. Xu J, Moore JE, Murphy PG, Millar BC, Elborn JS (2004) Early detection of Pseudomonas aeruginosa—comparison of conventional versus molecular (PCR) detection directly from adult patients with cystic fibrosis (CF). Ann Clin Microbiol Antimicrob 3:21. Xu J, Moore JE, Millar BC, Webb H, Shields MD, Goldsmith CE (2005) Employment of broad range 16S rDNA PCR and sequencing in the detection of aetiological agents of meningitis. New Microbiol 28:135–143. Yadav MC, Chakraborti A, Ray P, Sapru S, Majumdar S, Narang A (2003) Rapid detection of Haemophilus influenzae by hel gene polymerase chain reaction. Lett Appl Microbiol 37:190–195. Zhang K, Sparling J, Chow BL, Elsayed S, Hussain Z, Church DL, Gregson DB, Louie T, Conly JM (2004) New quadriplex PCR assay for detection of methicillin and mupirocin resistance and simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci. J Clin Microbiol 42:4947–4955.