- Email: [email protected]
Development of a time-resolved fluoroimmunoassay for measuring plasma growth hormone in Nile tilapia (Oreochromis niloticus)
General and Comparative Endocrinology 287 (2020) 113357
Contents lists available at ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Development of a time-resolved fluoroimmunoassay for measuring plasma growth hormone in Nile tilapia (Oreochromis niloticus)
T
⁎
Jingkai Qin, Xi Yuan, Chenguang Liu, Jirong Jia, Yazhou Zhang, Wensheng Li
State Key Laboratory of Biocontrol, Institute of Aquatic Economic Animals and Guangdong Province Key Laboratory for Aquatic Economic Animals, Guangdong Provincial Engineering Technology Research Center of Healthy Breeding in Important Economic Fish, School of Life Sciences, Sun Yat-Sen University, Guangzhou 510275, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Growth hormone Phage display antibody Single-chain variable fragment Time-resolved fluoroimmunoassay Oreochromis niloticus
Growth hormone is a hormone secreted from the pituitary and is involved in the regulation of most major physiological processes such as growth, development and metabolism. Therefore, an accurate and sensitive detection method is needed for the detection of tilapia serum Gh level. Phage display technology is widely used in the expression of antibody fragments, in which fragments of antibodies are expressed as a fusion with phage proteins and are displayed on the phage surface for easy screening. Time-resolved fluorescence immunoassay (TRFIA) is a microanalysis method developed nearly two decades ago and is one of the most sensitive analytical techniques. With the use of a special lanthanide, the detection background can be distinguished, which can greatly improve the sensitivity of detection. In this report, we cloned the VH and VL DNA fragments from the lymphocytes of rabbits immunized with recombinant Gh and assembled them with a linker to form a single-chain variable fragment (scFv) gene pool. Using phage display technology, we isolated scFv DNA fragments from the pool, which encode a protein that specifically binds to tilapia Gh. We then established Eu-DTTA-based TRFIA for measuring plasma Gh in tilapia. The sensitivity of double antibody sandwich Gh-TRFIA was 0.225 ng/ml, and the linear range of the standard curve was 0.225–250 ng/ml. The intra- and interassay coefficients of variation (CVs) were < 9.1 and < 4.5%, respectively. The cross-reactivities (CRs) of 1 μg/ml recombinant tilapia somatolactin (rtSl), prolactin (rtPrl) and thyroid-stimulating hormone beta subunit (rtTshb) were 0.042%, 0.472% and 0.036%, respectively. The sensitivity of direct competitive Gh-TRFIA was 0.208 ng/ml, and the linear range of the standard curve was 0.208–500 ng/ml. The intra- and interassay CVs were < 4.8 and < 7.1%, respectively. The CRs of 1 μg/ml rtSl, rtPrl and rtTshb were 0.041%, 0.079% and 0.073%, respectively. In conclusion, Gh-TRFIA is a safe (no concerns about radioactive isotopes), economical, and efficient detection method for the quantification of plasma Gh. Thus, the application of phage display technology for antibody screening and the use of TRFIA for tilapia Gh detection are conducive to research in the field of fish endocrinology.
1. Introduction The growth hormone/insulin-like growth factor axis plays a central role in the regulation of growth in teleosts. Growth hormone is an adenohypophysial hormone secreted from the anterior pituitary and is involved in the regulation of most major physiological processes such as growth, reproduction, development, osmoregulation, metabolism and feeding behavior (Madsen & Bern, 1993; McLean et al., 1993; Bhatta et al., 2012; Baroiller et al., 2014). The functions of growth hormone (Gh) are mediated by growth hormone receptors (Ghrs). There are two types of Ghrs in Nile tilapia (Oreochromis niloticus), Ghr1 and Ghr2, which are widely distributed among tissues (Ma et al., 2007). ⁎
Circulating Gh can bind to Ghr and stimulate the synthesis of insulinlike growth factor 1 (Igf1) in the liver. Igf1 is important to the regulation of growth and metabolism. (Frystyk, 2004; Bergan-Roller and Sheridan, 2018). The actions of the Gh-Igf1 axis are particularly complex because of the multiple isoforms of Ghs, Igfs and their receptors (Reinecke et al., 2005). It is well known that in tilapia, males present better growth performance than females. Precocious sexual maturity associated with continuous and asynchronous reproductive activity results in higher allocation of metabolic energy into gametogenesis in females compared with males (Toguyeni et al., 2002). The gonadosomatic index (GSI) is a parameter for providing a rough estimate of the maturation stage (Cayré and Laloë, 1986). The liver is one of the
Corresponding author at: School of Life Science, Sun Yat-Sen University, 135 Xin Gang West Road, Guangzhou 510275, China. E-mail address: [email protected] (W. Li).
https://doi.org/10.1016/j.ygcen.2019.113357 Received 16 August 2019; Received in revised form 12 November 2019; Accepted 6 December 2019 Available online 09 December 2019 0016-6480/ © 2019 Elsevier Inc. All rights reserved.
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
storage sites of lipids in fish; the lipid contents in fish liver can be 10–20% of the wet weight (Sheridan, 1994). Hepatic lipid stores are accessed during extended fasting periods (Magnoni et al., 2006; Sheridan, 1994). The hepotosomatic index (HSI) is an indirect index of energy status (Chellappa et al., 1995). The primary structures of fish Ghs are relatively conserved within the same order but become diversified between different orders and are even more different from tetrapod Ghs (37–58% identity) (Chang et al., 1992). For example, the homology of Gh between Nile tilapia (Oreochromis niloticus) and orange-spotted grouper (Epinephelus coioides) is relatively conserved (90% identity) (Li et al., 2005), but the homology is less conserved between tilapia and mammals (approximately 35% identity). Therefore, antibodies for mammal GHs may not be used in the detection of tilapia Gh. Phage display technology is widely used in the expression of peptides and proteins including antibody fragments (Lang et al., 1996), in which fragments of antibodies are expressed as fusions with phage proteins and are displayed on the surface of a phage. This technique has the potential to generate complex libraries exceeding 1014 phages and can screen and enrich for an antibody bound to a desired ligand (Winter et al., 1994). It has been known for decades that rabbits are excellent producers of polyclonal antibodies against a variety of antigens and haptens. Rabbits process multiple germline VH genes, but with more than 80% similarity, consequently these VH genes are members of one large VH gene family (McCormack et al., 1985). In normal rabbits, κ light chains represent 90–95% of total L chains and nearly all of them are derived from Cκ1 and are designated as κ-1 isotypes (Knight & Crane, 1994). Therefore, only a limited number of primers are needed to amplify most of the rabbit VH or VL fragments (Foti et al., 1998). Several immunoassay analytical methods such as radioimmunoassay (RIA), enzyme linked immunosorbent assay (ELISA) and chemiluminescence immune assay (CLIA) have been developed for the detection of serum Gh level. (Tannenbaum et al., 2001; Cook et al., 1983; Small and Peterson, 2005; Wu et al., 2008; Fukada et al., 1997b). Among these methods, RIA has excellent sensitivity, but the use of radioactive isotopes may be associated with safety risks. ELISA uses enzymes as biomarkers, such as horseradish peroxidase (HRP) and is economical and easy to apply. However, the detection capacity is limited, and the assay is sensitive to matrix interferences and assay conditions. CLIA uses a luminescent substance as label, and the luminescent substance is excited by a reactant (such as a peroxianion); thus, the chemiluminescence signal can be measured, but the fluorescence is unstable, and the measurement needs to be completed in a short time. Time-resolved fluorescence immunoassay (TRFIA) is a microanalysis method developed nearly two decades ago, and is one of the most sensitive analytical techniques. It uses a nonradioactive lanthanide, such as europium (Eu), terbium (Tb) or samarium (Sm), to form a lanthanide chelate as the label. The lanthanide chelates used in TRFIA have long decay times (103-106ns), large Stokes’ shifts (up to 278 nm), sharp emission peaks and high fluorescence intensities. These special properties make the fluorescence signal easy to distinguish from background fluorescence and improve the specificity and sensitivity of the detection (Soini & Kojola, 1983). One of the lanthanide chelates, N1-(pisothiocyanato-benzyl)-diethylene-triamine-N1,N2,N3,N4-tetraacetateEu3+ (Eu-DTTA or DTTA-Eu3+), is commonly used in TRFIA and suitable for the labeling of proteins. TRFIA is currently widely used in clinical diagnosis because of its stability and high sensitivity but is not commonly used in fish plasma Gh detection. In this report, we obtained a single-chain variable fragment (scFv) using phage display technology that can specifically bind to tilapia Gh. We then established a Eu-DTTAbased time-resolved fluoroimmunoassay for measuring plasma Gh in tilapia. In conclusion, the levels of circulating Gh could be important analytical targets for the study of the mechanism of the Gh-Igf1 axis. The aim of this work is to provide a safe (no concerns about radioactive isotopes), rapid and sensitive method for the detection of Gh in tilapia
serum and to explore the relationships between growth performance, circulating Gh level and mRNA levels of related genes in male and female tilapia. 2. Materials and methods 2.1. Animals Matured male and female Nile tilapia with body weights (BWs) in the range of 200–400 g were purchased from the tilapia breeding farm of Guangdong (Panyu, Guangdong, China). New Zealand rabbits were purchased from the Experimental Animal Center of Guangzhou University of Chinese Medicine (Panyu, Guangdong, China) and were raised in the Experimental Animal Center of Sun Yat-sen University. All experiments were in compliance with the license of the Government of the People’s Republic of China and were approved by the Animal Experimentation Ethics Committee of Sun Yat-sen University. 2.2. Production of recombinant protein by Escherichia coli The cDNA sequences encoding grouper growth hormone (gGh) (GenBank Accession NO. AY513647.1) and tilapia growth hormone (tGh) (GenBank Accession NO. M26916.1) were amplified by PCR with specific primers and were subcloned into the expression vector PQE30 (Qiagen, Germany) to form PQE30-gGh and PQE30-tGh vectors, respectively. The PQE30-gGh and PQE30-tGh vectors were transformed into competent M15 [pREP4] cells (Qiagen, Germany) to form the M15PQE30-gGh and M15-PQE30-tGh strains. The two strains produced recombinant proteins of grouper Gh (rgGh) and recombinant proteins of tilapia Gh (rtGh), respectively. These proteins contain a 6 × His tag on the N terminus. For protein expression, the M15-PQE30-gGh and M15-PQE30-tGh strains were cultured in LB medium with 100 μg/ml ampicillin and 25 μg/ml kanamycin for 2.5 h until the OD600 reached 0.6, and the cells were then induced with 1 mM IPTG for 4 h. After induction, cells were centrifuged and resuspended in Binding Buffer (20 mM PB, 500 mM NaCl, 10 mM imidazole, pH 7.4), and the target proteins were released from the cells by sonication and further purified with a HisTrap EXCEL column (GE Healcare). 2.3. Rabbit immunization A single New Zealand rabbit was immunized with rgGh with 4X administration by 6-point subcutaneous injection. The first immunization was performed with 500 μg of rgGh in a 1:1 emulsion of PBS and Freund’s complete adjuvant. Ten and 17 days post-immunization, the rabbit was immunized with 200 μg of rgGh in a 1:1 emulsion of PBS and Freund’s incomplete adjuvant, respectively. On day 25, the rabbit was immunized with 500 μg of rgGh in a 1:1 emulsion of PBS and Freund’s incomplete adjuvant. The rabbit was anaesthetized with urethane 10 days after the final injection, and the blood was harvested. 2.4. Phage library construction Peripheral blood lymphocytes (PBLs) were isolated by density gradient centrifugation using lymphocyte separation medium (Tianjin Haoyang Biological Manufacturing, China) following the instruction manual. The lymphocytes were mechanically homogenized in TRIzol reagent (Invitrogen, USA) and total RNA was extracted by standard phenol/chloroform phase separation. The first-strand cDNA was synthesized with M−MLV reverse transcriptase (Invitrogen, USA) according to the manufacturer’s protocol. Variable light (VL) and variable heavy (VH) genes were amplified independently using degenerate primers (Table 1). Equimolar mixtures of VL and VH genes were assembled into scFv linker (a sequence for a 2
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
were coated with 100 μL of 10 μg/ml purified scFv-3F7 protein in coating buffer (50 mM Tris-HCl, pH 8.0) in each well and incubated at 4 °C overnight. After washing with TBST (50 mM Tris-HCl, 0.9% NaCl, 0.2% Tween-20, pH 7.8) 3 times, the plates were blocked with 3% BSA in 50 mM Tris-HCl and incubated at 4 °C overnight. After blocking, the plates were washed with TBST 3 times, dried and stored at −20 °C before use. Purified rtGh was diluted with assay buffer (50 mM Tris-HCl, 0.9% NaCl, 0.3% BSA, 0.05% Tween-20, 20 μM EDTA, pH 7.8) to 0.4, 2, 10, 50, or 250 ng/ml and used as a standard. Blood was drawn from the caudal fin of the anaesthetized fish and collected in 1.5 ml tubes. The plasma samples were kept at room temperature for 2 h and centrifuged at 7,500 × g for 20 min at 25 °C. The supernatants were collected and stored at −80 °C before the assay. Quantitative determination of Gh in standards and fish plasma was conducted using a TRFIA according to dissociation enhanced lanthanide fluorescence immunoassay (DELFIA) methodology (Ref 12441126-06; Perkin-Elmer). Briefly, for the double antibody sandwich method, 100 μL of standard or sample solution in assay buffer was added to the coated plate. The plate was incubated at 25 °C for 1 h with gentle shaking and washed with TBST 6 times by microplate washer (ImmunoWashTM 1575, Bio-Rad). Then 100 μL of Eu3+-labeled antibody in assay buffer was added to each well. The plate was incubated at 25 °C for 1 h with gentle shaking, and washed with TBST 6 times. Finally, 200 μL of enhance solution was added and shaken for 5 min. The fluorescence intensity (cps) was measured with a Wallac 2030 VICTORTM X multilabel counter (Perkin-Elmer, USA). The results from double sandwich method Gh-TRFIA experiments were processed using the double logarithmic model to plot standard curves using the equation lg (Y) = A*lg(X) + B. A direct competitive TRFIA was also established. In brief, 50 μL of standard or sample and 50 μL of Eu3+-labeled rtGh in assay buffer was added to the coated plate. The plate was incubated at 25 °C for 1 h with gentle shaking, and was washed with TBST 6 times. Then, 200 μL of enhance solution was added and shaken for 5 min. The fluorescence intensity (cps) was then measured. The results from direct competitive Gh-TRFIA experiments were processed using the Log-Logit function to plot standard curves using the equation Logit Y = ln [Y/(1 − Y)], Y = B/B0, where B0 corresponds to the fluorescence counts at zero concentration.
Table 1 Cloning primers of VH/VL and linker (5′-3′). Primer name
Sequence
VHF1 VHF2 VHR1 VHR2 VLF VLR Linker F Linker R VHR1-Linker VHR2-Linker VLF-Linker
ATGTCCGGGGGWSRCCT ATGGAGTCCGGGGGWSR TGARGAGAYGGTGACSAGGG GACTGATGGAGCCTTAGGTT GWKATGACCCAGACTCCA AGGTGCAACTGGATCACC GGCCAAGGCCACGGTCACCGT TGGAGACTGGGTGAGCTCAAT CCTSGTCACCRTCTCYTCAGGCCAAGGCCACGGTCACCGT ACCTAAGGCTCCATCAGTCGGCCAAGGCCACGGTCACCGT TGGAGTCTGGGTCATMWCTGGAGACTGGGTGAGCTCAAT
17-residue amino acid: SGGGSGGGGGGGSGGGG) using splice-byoverlap extension PCR. The PCR products and the phagemid vector pCANTAB5e were digested with a mix of NotI and SfiI enzyme and purified from a 1% agarose gel. The scFv gene pool was ligated into the pCANTAB5e phagemid and transformed into Escherichia coli TG1 (genotype: [F’ traD36 proAB lacIqZΔM15] supE thi-1 Δ(lac-proAB) Δ(mcrB-hsdSM)5(rK−mK−)) (Bio-View Shine Biotechnology, China). The library was propagated in SOC medium containing 10% glycerinum. 2.5. Selection of Gh-specific candidate scFv clone and screening of the scFv clones by ELISA The scFv library was ‘rescued’ using M13K07 helper phage (Bio-View Shine Biotechnology, China), which was then resuspended in PBS (containing 1% (w/v) BSA) and subjected to three rounds of biopanning in 5 ml tubes coated with successively decreasing concentrations (10, 5, 2.5 μg/ml, respectively) of rgGh. After each panning step, 2 ml of 0.1 M HCl was added to elute the antigen-bound phage. Six minutes later, 2 ml of 50 mM Tris-HCl (pH 7.4) was added, and phage was then reinfected into log phase E. coli TG1 cells. After the third panning, the polyclonal phage outputs in TG1 cells were stored in 8% glycerol at −80℃. The cells were serially diluted across the range of 10−1–10−8 in 2 × YT media, and 100 μL of each dilution was plated onto SOB-AG agar and grown overnight at 37 °C. Discrete colonies were selected for target-specific enrichment by phage ELISA using an anti-M13 HRP-labeled mouse monoclonal antibody (GE Healthcare, USA) and scFv ELISA using the soluble expression E. coli HB2151 (Bio-View Shine Biotechnology, China) and an anti-E Tag HRP-labeled rabbit polyclonal antibody (Abcam, USA) according to the manufacturer’s protocols. Positive clones were screened out of the library, and plasmids were purified from a 10 ml overnight culture using a Plasmid Mini Kit (OMEGA, China) for DNA sequencing (Invitrogen, USA). One of the positive clones, 3F7, was subcloned into pET32a+ and transformed into competent BL21 trxb cells (Novagen, Germany) to form a BL21pET32a+-3F7 strain. This strain can express a 46-kD scFv with a His-tag and a Trx-tag at the N-terminus.
2.7. RNA isolation and real-time quantitative PCR analysis Tissue samples were collected and snap-frozen in liquid nitrogen until RNA extraction or protein isolation. Total RNA was extracted according to the TRIzol manufacturer’s protocol. The first-strand cDNA was synthesized with M-MLV reverse transcriptase (Invitrogen, USA) according to the manufacturer’s protocol. Real-time quantitative PCR was performed with SYBR® Green realtime PCR Master Mix (Dongsheng, China), and the cycling parameters were as follow: 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s, 58 °C for 15 s, 72 °C for 15 s and then fluorescent signal collection at 82 °C for 15 s. Melting curves were generated at 95 °C for 10 s and ramping from 65 °C to 95 °C with an increment of 0.5 °C per 5 s. 18S rRNA and β-actin were used as reference genes. Primers for measuring the expression levels of tilapia genes are listed in Table 2.
2.6. Gh fluoroimmunoassay Purified scFv-3F7 and rtGh protein was conjugated with N1-(p-isothiocyanato-benzyl)-diethylene-triamine-N 1,N2,N3,N4-tetraacetateEu3+ (Eu-DTTA; Tianjin Radio-Medical Institute, Tianjin City, China) as a tracer. Briefly, 0.2 mg of Eu-DTTA was diluted in 20 μL of distilled water and mixed with 1 mg of scFv-3F7 or 500 μg of protein in 80 μL of 0.1 mol/L Na2CO3-NaHCO3 (pH 9.3), and the mixture was kept at 4 °C for 24 h. Excess europium and Eu-labeled protein were separated by Sephadex G-25 column with TSA buffer (50 mmol Tris-HCl, 0.9% BSA, 0.05% NaN3, pH 7.8). For the preparation of solid-phase antibody, clear 96-well plates
2.8. Statistical analysis All data are shown as the means ± S.E.M., and statistical analysis was performed with SPSS 1.8 software using either Student’s t test or one-way ANOVA. A probability of < 0.05 (P＜0.05) was considered a significant difference.
3
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
Table 2 Primers of Real-time PCR (5′-3′).
Table 3 Mass spectra identification of tilapia Gh IgG pull-down.
Primer name
Sequence
Accession
Description
Score
Coverage
GH-F GH-R IGF I-F IGF I-R GHR1-F GHR1-R GHR2-F GHR2-R βactin-F βactin-R 18S-F 18S-R
ACAGCCAGCGTTTGTTCTCCATTG GGAAACTCCCAGGACTCAACCAGT TGCGATGTGCTGTATCTCCTG GCCATAGCCTGTTGGTTTATTG CAAGTCCTTCCGGGCTAA ACTGTCGCTGAATGTCCAAT CAGCACCGAGACAACAGC TCAGGATGCCCACTAAAC ACCTTCTACAACGAGCTGAGAG GCCTGGATGGCAACGTACA AGAAACGGCTACCACATCC CACCAGACTTGCCCTCCA
M84774.1
Tilapia nilotica growth hormone gene, complete cds
32.04
37.75
A2
Sequence
# PSMs
High High High High High High High High High
DMHKVETYLTVAK LFSDFESSLQTEEQR DmHKVETYLTVAK IFLQDFcNSDYIISPIDK IFLQDFcNSDYIISPIDKHETQR VTHLHLLAQR TGILLLIR LFSIAVNR VETYLTVAK
1 1 2 1 1 2 1 1 1
3. Results 3.1. Expression of rgGh and rtGh proteins and preparation of polyclonal antibody
proteins extracted from tilapia pituitary. Mass spectrometry assay was performed on the band that appeared at approximately 22-23kD. Sequences of tilapia Gh were introduced into the MS Blas program, and the result suggested that Anti-rgGh IgG can bind to tilapia Gh (Table 3).
The M15-PQE30-gGh and M15-PQE30-tGh strains were constructed. The strains can express proteins with a 6 × HIS tag on the N terminus. The proteins were purified with Ni+-NTA resin. Proteins were verified by SDS-PAGE and Western blotting with HIS primary antibody. As expected, the molecular weights of rgGh and rtGh were 23.2kD and 22.8kD, respectively (Fig. 1A & B). The titer of serum anti-rgGh was approximately 1:10,000. Western blot analysis confirmed the specificity of anti-rgGh (Fig. 1C & D). AntirgGh IgG was purified from the serum and immunoreacted with
3.2. Construction of the anti-rgGh scFv library and production of anti-rgGh scFv protein The VL and VH genes were cloned (Fig. 2A) and assembled with linker (Fig. 2B & C), ligated into the pCANTAB5e phagemid and transformed into Escherichia coli TG1. After three rounds of
Fig. 1. Expression of recombinant Gh and verification of the specificity of anti-rgGh. (A) Expression of rgGh. M: marker; 1: control; 2: lysate after induction; 3: supernatant; 4: inclusion bodies; 5–6: purified protein; 7: control; 8: inclusion bodies; 9: purified protein. (B) Expression of rtGh. M: marker; 10: lysate after induction; 11: supernatant; 12: inclusion bodies; 13–14: purified protein; 15: inclusion bodies; 16: purified protein. (C) The dilution ratio of the anti-rgGh antibody is 1:3000. M: marker; P: 100 ng per well of rtGh; G: 5 µg total protein of grouper pituitary; T: 5 µg total protein of tilapia pituitary. (D) The dilution ratio of the control serum is 1:3000. M: marker; P: 100 ng per well of rtGh; G: 5 µg total protein of grouper pituitary; T: 5 µg of total protein of tilapia pituitary. 4
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
Fig. 2. Construction of the anti-rgGh scFv library and sequencing of GHab-3F7. (A) Cloning of rabbit VH and VL. M: 100 bp marker; N: negative control; VH: rabbit VH; VL: rabbit VL. (B) Cloning of Linker and Linker adapter. M1: 100 bp marker; N: negative control; 1: Linker; 2: Linker adapter; M2: 100 bp marker. (C) Assembled scFv fragment. M: 100 bp marker; N: negative control; scFv: scFv fragment. (D) Nucleotide and amino acid sequences of the GHab-3F7 scFv fragment. The linker sequences are indicated by underscores, and the asterisk indicates the termination codon.
molecular weight of scFv-3F7 was 46.6571kD and its isoelectric point was 6.21 (Fig. 3). The scFv-3F7 protein was immunoreacted with proteins extracted from tilapia pituitary. Mass spectrometry assay was performed on the band that appeared at approximately 22-23kD. Sequences of tilapia Gh were introduced into the MS Blas program, and the result suggested that scFv-3F7 can bind to tilapia Gh (Table 4).
biopanning, the capacity of tertiary antibody library was approximately 6.8 × 106. Positive clones were screened by phage ELISA and scFv ELISA, and one of the positive clones, 3F7, was subcloned into the pET32a+ vector. The Ghab-3F7 scFv DNA fragment was 798 bp in size (Fig. 2D). The BL21-pET32-3F7 strain was constructed and was determined to express a scFv with a 6 × HIS-tag and a Trx-tag at the N-terminus. The proteins were purified with Ni + -NTA resin and verified by SDS-PAGE and Western blotting with HIS primary antibody. As expected, the
Fig. 3. Expression and purification of BL21-pET32-3F7 scFv. M: marker; 1: control; 2: lysate after induction; 3: supernatant; 4: inclusion bodies; 5–6: purified protein; 7–8: Western blot of the protein. 5
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
Table 4 Mass spectra identification of tilapia Gh scFv (NO. 3F7) pull-down. Accession
Description
Score
Coverage
M84774.1
Tilapia nilotica growth hormone gene, complete cds
31.73
59.80
A2
Sequence
# PSMs
High High High High High High High High High
LFSDFESSLQTEEQR IFLQDFcNSDYIISPIDKHETQR IFLQDFcNSDYIISPIDK ANQDEAENYPDTDTLQHAPYGNYYQSLGGNESLR DmHKVETYLTVAK VTHLHLLAQR TGILLLIR LFSIAVNR QTYELLAcFKK
1 2 1 1 1 1 1 1 1
3.3. Establishment of Gh-TRFIA
4. Discussion
The sensitivity, detection range, and specificity of Gh-TRFIA were analyzed.
In the present study, we expressed recombinant tilapia Gh and grouper Gh. The purified rgGh was used to immunize rabbit to prepare antiserum and peripheral blood lymphocytes. We then cloned the VH and VL DNA fragments from the lymphocytes and assembled them with a linker to form a scFv gene pool. Using phage display technology, we isolated a positive strain (NO. 3F7) from the pool and obtained a singlechain variable fragment (scFv), which can specifically bind to grouper and tilapia Gh. We then established a Eu-DTTA-based time-resolved fluoroimmunoassay for measuring plasma Gh in tilapia. Finally, we explore the relationships between growth performance, circulating Gh level and mRNA levels of related genes in male and female tilapia. Since the primary structures of Ghs are less conserved between tilapia and mammal (Rentier-Delrue et al., 1989), it is hard to find suitable commercialized antibodies to establish an assay. Phage display antibody (PDA) libraries are an alternative tool for the isolation of monoclonal antibodies (Kumar et al., 2019). The common display format in phage display antibody libraries is either scFv or fragment antigen-binding (Fab). The scFv format is more preferred over Fab because of their small size, high expression level and ease of screening (Arbabi-Ghahroudi et al., 2005). In this report, we used pCANTAB5e as a phagemid vector for scFv screening and the pET32a vector for scFv expression. The proteins expressed by the pET32a vector contains a 6 × His-tag and a Trx-tag at the N-terminus so that the proteins can be purified through Ni-chelating affinity chromatography to achieve a higher solubility. In this way, we can obtain specific antibody fragments without high-end instruments in a process that can be performed in basic molecular biology labs (Kumar et al., 2019). As one of the most important biological analytic methods, immunoassay is widely used in biological research and clinical diagnosis. Immunoassays encompass several methods, such as RIA, ELISA, CLIA, fluorescence immunoassay (FIA), fluorescence polarization immunoassay (FPIA) and TRFIA (Soini & Kojola, 1983). These technologies are based on the specific binding of antigen and antibody. In this report, we established two types of assay, a double antibody sandwich method and a direct competitive method. In general, the sandwich method is suitable for antigens with more than one epitope, and the direct competitive method is more suitable for haptens (Dickson et al., 1995). The molecular weight of Gh is approximately 22kD, thus, both sandwich and competitive methods can be used. For solution phase detection, the composition of assay buffer, the working concentrations of antibody/antigen/samples, the reaction temperature and the reaction time of the assay should be optimized. The serum Gh levels of teleosts are normally approximately a few to a dozen nanograms per milliliter. For example, the serum growth hormone concentration of humans is 0–24.5 × 10−3 U/L (by TRFIA) (Hang et al., 2006), that of rats is 11 ng/ml (by RIA) (Tannenbaum et al., 2001), that of grass carp is 12 ng/ml (by RIA) (Cook et al., 1983),
3.3.1. The double antibody sandwich method for Gh-TRFIA The sensitivity was 0.225 ng/ml (concentration of the blank + 2SD), and the linear range of the standard curve was 0.225–250 ng/ml (Fig. 4A). The intra- and interassay coefficients of variation (CVs) were < 9.1% and < 4.5%, respectively. Antibody specificity was determined, with serum from tilapia diluted in a 2-fold serial dilution manner, the dilution curve was parallel to the Gh standard curve (Fig. 4B) and recombinant tilapia somatolactin (rtSl), prolactin (rtPrl) and thyroid stimulating hormone beta subunit (rtTshb) proteins were diluted in a 5-fold serial dilution. None of the dilution curves was parallel to the Gh standard curve. (Fig. 4C). The cross-reactivities (CRs) of 1 μg/ml rtSl, rtPrl and rtTshb were 0.042%, 0.472% and 0.036%, respectively. 3.3.2. The direct competitive method for Gh-TRFIA The sensitivity was 0.208 ng/ml and the linear range of the standard curve was 0.208–500 ng/ml (Fig. 4D). The intra- and interassay coefficients of variation (CVs) were < 4.8% and < 7.1%, respectively. Antibody specificity was determined by a double antibody sandwich method, in which serum from tilapia was diluted in a 2-fold serial dilution manner, the dilution curve was parallel to the Gh standard curve (Fig. 4E), and recombinant tilapia somatolactin (rtSl), prolactin (rtPrl) and thyroid stimulating hormone beta subunit (rtTshb) proteins were diluted in a 5-fold serial dilution. None of the dilution curves was parallel to the Gh standard curve. (Fig. 4F). The cross-reactivities (CRs) of 1 μg/ml rtSl, rtPrl and rtTshb were 0.041%, 0.079% and 0.073%, respectively. Since rtGh-Eu3+-based direct competitive TRFIA provided a slightly better sensitivity and detection range and needed less time, it was used for the following experiments. 3.4. Detection of plasma Gh levels and gh/igf1/ghr1/ghr2 mRNA abundance in matured male and female tilapia The mature tilapia used in this assay were approximately 9 months old, and the weights of males were significantly higher than those of females (Fig. 5F). The GSIs were significantly lower in males (Fig. 5H), and no significant difference was found in the HSI (Fig. 5G). The average Gh concentration of tilapia in this assay was approximately 26.6 ± 2.3 ng/ml, with no significant difference in males and females (Fig. 5E). Real-time PCR showed that the gh mRNA expression level in the pituitary and that the igf1/ghr1 mRNA expression in the livers of females were not distinctly different from those of males (Fig. 5A–C), but ghr2 mRNA expression in the liver was higher in males (Fig. 5D). 6
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
Fig. 4. Gh standard curve and antibody specificity analysis. (A) Gh standard curve of the double sandwich method. (B) Gh standard curve (double sandwich method) and serum dilution curve; the dilution ratios of tilapia serum were 1:1, 1:2 and 1:4. (C) Cross-reactivity assay of the double sandwich method. The recombinant proteins were diluted in a 5-fold serial dilution (250/50/10/2 ng/ml). (D) Gh standard curve of the direct competitive method. (E) Gh standard curve (direct competitive method) and serum dilution curve; the dilution ratios of tilapia serum were 1:2, 1:4 and 1:8. (F) Cross-reactivity assay of the direct competitive method. The recombinant proteins were diluted in a 5-fold serial dilution (250/50/10/2 ng/ml).
that of Mozambique tilapia is 1 ng/ml (by RIA) (Takashi et al., 1994), that of African carp is 3.5 ng/ml (by RIA) (Lescroart et al., 1996), that of channel catfish is 15 ng/ml (by ELISA) (Small and Peterson, 2005),
that of carp is 5.04 ng/ml (by ELISA) (Wu et al., 2008), that of female salmon is approximately 12.42 ± 1.89 ng/ml (by ELISA) (Fukada et al., 1997a) or 21 ng/ml (by CLIA) (Fukada et al., 1997b). The 7
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
Fig. 5. Gh concentration, average weight, HSI, GSI and relative gh/igf1/ghr1/ghr2 mRNA expression levels of sexually mature males and females. The data are presented as the means ± S.E.M. (n = 8–10). Differences among groups were compared with the t test. “*” indicates P < 0.05, there is a significant difference between the two groups; “***” indicates P < 0.01, there is a very significant difference between the two groups.
males and females in this experiment were similar. In vitro and in vivo studies have indicated that ghr2 mRNA can be regulated by Gh administration (Pierce et al., 2012), Gh stimulated proliferation in CHO cells transfected with a salmonid Ghr2 (Benedet et al., 2005), and Gh can induce promoter activity in CHO cells transfected with Ghr2 in black sea bream and zebrafish (Chen et al., 2011; Jiao et al., 2006). The differences in body weight along with the differences in ghr2 mRNA levels between males and females may indicate that Ghr2 is more active in growth promotion and is partially responsible for sexual growth dimorphism. Ghr1 is more responsible for transmitting the lipolytic signal of Gh, while Ghr2 is more active in transmitting the growth-promoting signal of Gh (Pierce et al., 2012, Bergan-Roller and Sheridan, 2018). Further research is needed to determine the mechanism of sexual growth dimorphism in tilapia. TRFIA is a safe (no concerns about radioactive isotopes), sensitive and efficient assay method for the quantification of plasma Gh. Thus, the application of TRFIA for tilapia Gh detection is conducive to research in the field of fish physiology.
regulation of serum Gh varies with species, developmental stage, and environmental conditions (Yada et al., 1994; Björnsson et al., 1994; Bergan-Roller and Sheridan, 2018). In this experiment, the physiological concentration of tilapia serum Gh was approximately 26.6 ± 2.3 ng/ml. The Gh level of males was modestly, but nonsignificantly, higher than that of females. These results agree with previous research in Mozambique tilapia (Oreochromis mossambicus) (Bhatta et al., 2012; Davis et al., 2008). The serum Gh of tilapia may be affected by fasting (Toguyeni et al., 1996). The HSIs of males and females were not significantly different, indicating that the energy status of males and females in this experiment were similar. The GSI of females was higher, indicating that females spend more energy in gametogenesis. In addition, the body weight of males was significantly higher. We found no significant difference in gh/igf1/ghr1 mRNA levels between males and females except for ghr2 mRNA levels. Previous studies showed that the function of Ghr1 in different species was discrepant. For example, in salmon and tilapia, Ghr1 may be the receptor of somatolactin (Sl) (Fukada et al.,2005; Fukamachi and Meyer, 2007; Fukamachi et al., 2005; Pierce et al., 2007), while in zebra fish, Japanese eel and black sea bream, Ghr1 is not an Sl receptor (Chen et al., 2011; Jiao et al., 2006; Ozaki et al., 2006). Tilapia Ghr1 has a strong affinity for Gh, and the levels of igf1 and ghr1 mRNA are correlated in the liver and the ovary. However, there was no correlation between liver and ovarian ghr1 mRNA. An in vitro study of tilapia hepatocytes showed that ghr1 mRNA is regulated by cortisol, insulin and glucagon, but not by Gh, indicating that the level of ghr1 mRNA in tilapia hepatocytes may be regulated by the metabolic state. Ghr1 may mediate metabolic function (Pierce et al., 2012). The lack of a significant difference in ghr1 mRNA levels may indicate that the metabolic states of
Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments This study was supported by the National Key R&D Program of China 2018YFD0900101, the China Agriculture Research System (CARS-46), the Guangdong Provincial Science and Technology Program 8
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
(2015A020216006, 2012B020308001, 2014A020208021), Science and Technology Planning Project of Guangzhou (201607020014), and the Program for Chinese Outstanding Talents in Agricultural Scientific Research (2016–2020) to Dr. Wensheng Li.
Kumar, R., Parray, H.A., Shrivastava, T., Sinha, S., Luthra, K., 2019. Phage display antibody libraries: A robust approach for generation of recombinant human monoclonal antibodies. Int. J. Biol. Macromol. 135, 907–918. Lang, I.M., Barbasi, C.F.I., Schleef, R.R., 1996. Recombinant rabbit Fab with binding activity to type-1 plasminogen activator inhibitor derived from a phage-display library against human alpha-granules. Gene (Amsterdam) 172 (2), 295–298. Lescroart, O., Roelants, I., Mikolajczyk, T., Bosma, P.T., Schulz, R.W., Kuhn, E.R., Ollevier, F., 1996. A radioimmunoassay for African catfish growth hormone: Validation and effects of substances modulating the release of growth hormone. Gen. Comp. Endocrinol. 104 (2), 147–155. Li, W.S., Chen, D., Wong, A.O.L., Lin, H.R., 2005. Molecular cloning, tissue distribution, and ontogeny of mRNA expression of growth hormone in orange-spotted grouper (Epinephelus coioides). Gen. Comp. Endocrinol. 144 (1), 78–89. Ma, X.L., Liu, X.C., Zhang, Y., Zhu, P., Ye, W., Lin, H.R., 2007. Two growth hormone receptors in Nile tilapia (Oreochromis niloticus): Molecular characterization, tissue distribution and expression profiles in the gonad during the reproductive cycle. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 147 (2), 325–339. Madsen, S.S., Bern, H.A., 1993. In-vitro effects of insulin-like growth factor-I on gill Na+, K(+)-ATPase in coho salmon, Oncorhynchus kisutch. J. Endocrinol. 138 (1), 23–30. Magnoni, L.J., Patterson, D.A., Farrell, A.P., Weber, J.-M., 2006. Effects of long-distance migration on circulating lipids of sockeye salmon (Oncorhynchus nerka). Can. J. Fish. Aquat. Sci. 63 (8), 1822–1829. McCormack, W.T., Laster, S.M., Marzluff, W.F., Roux, K.H., 1985. Dynamic gene interactions in the evolution of rabbit VH genes: a four codon duplication and block homologies provide evidence for intergenic exchange. Nucleic Acids Res. 13 (19), 7041–7054. McLean, E., Donaldson, E.M., Teskeredzic, E., Souza, L.M., 1993. Growth enhancement following dietary delivery of recombinant porcine somatotropin to diploid and triploid coho salmon (Oncorhynchus kisutch). Fish Physiol. Biochem. 11 (1–6), 363–369. Ozaki, Y., Fukada, H., Kazeto, Y., Adachi, S., Hara, A., Yamauchi, K., 2006. Molecular cloning and characterization of growth hormone receptor and its homologue in the Japanese eel (Anguilla japonica). Compar. Biochem. Physiol. B Biochem. Mol. Biol. 143 (4), 422–431. Pierce, A.L., Breves, J.P., Moriyama, S., Uchida, K., Grau, E.G., 2012. Regulation of growth hormone (GH) receptor (GHR1 and GHR2) mRNA level by GH and metabolic hormones in primary cultured tilapia hepatocytes. Gen. Comp. Endocrinol. 179 (1), 22–29. Pierce, A.L., Fox, B.K., Davis, L.K., Visitacion, N., Kitahashi, T., Hirano, T., Grau, E.G., 2007. Prolactin receptor, growth hormone receptor, and putative somatolactin receptor in Mozambique tilapia: Tissue specific expression and differential regulation by salinity and fasting. Gen. Comp. Endocrinol. 154 (1–3), 31–40. Reinecke, M., Bjornsson, B.T., Dickhoff, W.W., McCormick, S.D., Navarro, I., Power, D.M., Gutierrez, J., 2005. Growth hormone and insulin-like growth factors in fish: Where we are and where to go. Gen. Comp. Endocrinol. 142 (1–2), 20–24. Rentier-Delrue, F., Swennen, D., Philippart, J.C., L'Hoir, C., Lion, M., Benrubi, O., Martial, J.A., 1989. Tilapia growth hormone: molecular cloning of cDNA and expression in Escherichia coli. DNA (Mary Ann Liebert, Inc.) 8 (4), 271–278. Sheridan, M.A., 1994. Regulation of lipid metabolism in poikilothermic vertebrates. Compar. Biochem. Physiol. B Compar. Biochem. Mol. Biol. 107 (4), 495–508. Small, B.C., Peterson, B.C., 2005. Establishment of a time-resolved fluoroimmunoassay for measuring plasma insulin-like growth factor I (IGF-I) in fish: effect of fasting on plasma concentrations and tissue mRNA expression of IGF-I and growth hormone (GH) in channel catfish (Ictalurus punctatus). Domest. Anim. Endocrinol. 28 (2), 202–215. Soini, E., Kojola, H., 1983. Time-resolved fluorometer for lanthanide chelates–a new generation of nonisotopic immunoassays. Clin. Chem. 29 (1), 65–68. Takashi, Y., Tetsuya, H., Gordon, E.G., 1994. Changes in plasma levels of the two prolactins and growth hormone during adaptation of different salinities in the euryhaline tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol. 93, 214–223. Tannenbaum, G.S., Choi, H.K., Gurd, W., Waxman, D.J., 2001. Temporal relationship between the sexually dimorphic spontaneous GH secretory profiles and hepatic STAT5 activity. Endocrinology 142 (11), 4599–4606. Toguyeni, A., Baroiller, J.-F., Fostier, A., Le Bail, P.-Y., Kuhn, E.R., Mol, K.A., Fauconneau, B., 1996. Consequences of food restriction on short-term growth variation and on plasma circulating hormones in Oreochromis niloticus in relation to sex. Gen. Compar. Endocrinol. 103 (2), 167–175. Toguyeni, A., Fauconneau, B., Fostier, A., Abucay, J., Mair, G., Baroiller, J.F., 2002. Influence of sexual phenotype and genotype, and sex ratio on growth performances in tilapia Oreochromis niloticus. Aquaculture 207 (3–4), 249–261. Winter, G., Griffiths, A.D., Hawkins, R.E., Hoogenboom, H.R., 1994. Making antibodies by phage display technology. Annu. Rev. Immunol. 12, 433–455. Wu, G., Chen, L., Zhong, S., Li, Q., Song, C., Jin, B., Zhu, Z., 2008. Enzyme-linked immunosorbent assay of changes in serum levels of growth hormone (cGH) in common carps (Cyprinus carpio). Sci. China Ser. C Life Sci. 51 (2), 157–163. Yada, T., Hirano, T., Grau, E.G., 1994. Changes in plasma levels of the two prolactins and growth hormone during adaptation to different salinities in the euryhaline tilapia, Oreochromis mossambicus. Gen. Compar. Endocrinol. 93 (2), 214–223.
References Arbabi-Ghahroudi, M., Tanha, J., MacKenzie, R., 2005. Prokaryotic expression of antibodies. Cancer Metastasis Rev. 24 (4), 501–519. Baroiller, J.-F., D'Cotta, H., Shved, N., Berishvili, G., Toguyeni, A., Fostier, A., Eppler, E., Reinecke, M., 2014. Oestrogen and insulin-like growth factors during the reproduction and growth of the tilapia Oreochromis niloticus and their interactions. Gen. Comp. Endocrinol. 205, 142–150. Benedet, S., Johansson, V., Sweeney, G., Galay-Burgos, M., Bjornsson, B.T., 2005. Cloning of two Atlantic salmon growth hormone receptor isoforms and in vitro ligand-binding response. Fish Physiol. Biochem. 31 (4), 315–329. Bergan-Roller, H.E., Sheridan, M.A., 2018. The growth hormone signaling system: Insights into coordinating the anabolic and catabolic actions of growth hormone. Gen. Comp. Endocrinol. 258, 119–133. Bhatta, S., Iwai, T., Miura, C., Higuchi, M., Shimizu-Yamaguchi, S., Fukada, H., Miura, T., 2012. Gonads directly regulate growth in teleosts. PNAS 109 (28), 11408–11412. Björnsson, B.T., Taranger, G.L., Hansen, T., Stefansson, S.O., Haux, C., 1994. The Interrelation between Photoperiod, Growth Hormone, and Sexual Maturation of Adult Atlantic Salmon (Salmo salar). Gen. Comp. Endocrinol. 93 (1), 70–81. Cayré, P., Laloë, F., 1986. Review of the Gonad Index (GI) and an introduction to the concept of its “critical value”: application to the skipjack tuna Katsuwonus pelamis in the Atlantic Ocean. Mar. Biol. 90 (3), 345–351. Chang, Y.S., Liu, C.S., Huang, F.L., Lo, T.B., 1992. The primary structures of growth hormones of three cyprinid species: bighead carp, silver carp, and grass carp. Gen. Comp. Endocrinol. 87 (3), 385–393. Chellappa, S., Huntingford, F.A., Strang, R.H.C., Thomson, R.Y., 1995. Condition factor and hepatosomatic index as estimates of energy status in male three-spined stickleback. J. Fish Biol. 47 (5), 775–787. Chen, M., Huang, X., Yuen, D.S.H., Cheng, C.H.K., 2011. A study on the functional interaction between the GH/PRL family of polypeptides with their receptors in zebrafish: Evidence against GHR1 being the receptor for somatolactin. Mol. Cell. Endocrinol. 337 (1–2), 114–121. Cook, A.F., Wilson, S.W., Peter, R.E., 1983. Development and validation of a carp growth hormone radioimmunoassay. Gen. Compar. Endocrinol. 50 (3), 335–347. Davis, L.K., Pierce, A.L., Hiramatsu, N., Sullivan, C.V., Hirano, T., Grau, E.G., 2008. Gender-specific expression of multiple estrogen receptors, growth hormone receptors, insulin-like growth factors and vitellogenins, and effects of 17 beta-estradiol in the male tilapia (Oreochromis mossambicus). Gen. Comp. Endocrinol. 156 (3), 544–551. Dickson, E.F.G., Pollak, A., Diamandis, E.P., 1995. Ultrasensitive bioanalytical assays using time-resolved fluorescence detection. Pharmacol. Ther. 66 (2), 207–235. Foti, M., Granucci, F., Ricciardi-Castagnoli, P., Spreafico, A., Ackermann, M., Suter, M., 1998. Rabbit monoclonal Fab derived from a phage display library. J. Immunol. Methods 213 (2), 201–212. Frystyk, J., 2004. Free insulin-like growth factors - measurements and relationships to growth hormone secretion and glucose homeostasis. Growth Hormon. IGF Res. 14 (5), 337–375. Fukada, H., Hiramatsu, N., Gen, K., Hara, A., 1997a. Development of an ELISA for chum salmon (Oncorhynchus keta) growth hormone. Compar. Biochem. Physiol. B 117 (3), 387–392. Fukada, H., Hiramatsu, N., Kitamura, M., Chiba, H., Hara, A., 1997b. Chemiluminescent immunoassay (CLIA) for salmon growth hormone (GH). J. Biolumin. Chemilumin. 12 (6), 271–275. Fukada, H., Ozaki, Y., Pierce, A.L., Adachi, S., Yamauchi, K., Hara, A., Swanson, P., Dickhoff, W.W., 2005. Identification of the salmon somatolactin receptor, a new member of the cytokine receptor family. Endocrinology 146 (5), 2354–2361. Fukamachi, S., Meyer, A., 2007. Evolution of receptors for growth hormone and somatolactin in fish and land vertebrates: Lessons from the lungfish and sturgeon orthologues. J. Mol. Evol. 65 (4), 359–372. Fukamachi, S., Yada, T., Mitani, H., 2005. Medaka receptors for somatolactin and growth hormone: Phylogenetic paradox among fish growth hormone receptors. Genetics 171 (4), 1875–1883. Hang, J.F., Wu, Y.S., Xu, W.W., Zhou, Z.C., Huang, Y., Li, M., 2006. Time-resolved fluoroimmunoassay of human growth hormone and preparation of its diagnostic reagent. J. Sun Yat-sen Univ. Med. Sci. 27 (4), 472–475 (in Chinese). Jiao, B.W., Huang, X.G., Chan, C.B., Zhang, L., Wang, D.S., Cheng, C.H.K., 2006. The coexistence of two growth hormone receptors in teleost fish and their differential signal transduction, tissue distribution and hormonal regulation of expression in seabream. J. Mol. Endocrinol. 36 (1), 23–40. Knight, K.L., Crane, M.A., 1994. Generating the antibody repertoire in rabbit. Adv. Immunol. 56, 179–218.
9
Contents lists available at ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Development of a time-resolved fluoroimmunoassay for measuring plasma growth hormone in Nile tilapia (Oreochromis niloticus)
T
⁎
Jingkai Qin, Xi Yuan, Chenguang Liu, Jirong Jia, Yazhou Zhang, Wensheng Li
State Key Laboratory of Biocontrol, Institute of Aquatic Economic Animals and Guangdong Province Key Laboratory for Aquatic Economic Animals, Guangdong Provincial Engineering Technology Research Center of Healthy Breeding in Important Economic Fish, School of Life Sciences, Sun Yat-Sen University, Guangzhou 510275, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Growth hormone Phage display antibody Single-chain variable fragment Time-resolved fluoroimmunoassay Oreochromis niloticus
Growth hormone is a hormone secreted from the pituitary and is involved in the regulation of most major physiological processes such as growth, development and metabolism. Therefore, an accurate and sensitive detection method is needed for the detection of tilapia serum Gh level. Phage display technology is widely used in the expression of antibody fragments, in which fragments of antibodies are expressed as a fusion with phage proteins and are displayed on the phage surface for easy screening. Time-resolved fluorescence immunoassay (TRFIA) is a microanalysis method developed nearly two decades ago and is one of the most sensitive analytical techniques. With the use of a special lanthanide, the detection background can be distinguished, which can greatly improve the sensitivity of detection. In this report, we cloned the VH and VL DNA fragments from the lymphocytes of rabbits immunized with recombinant Gh and assembled them with a linker to form a single-chain variable fragment (scFv) gene pool. Using phage display technology, we isolated scFv DNA fragments from the pool, which encode a protein that specifically binds to tilapia Gh. We then established Eu-DTTA-based TRFIA for measuring plasma Gh in tilapia. The sensitivity of double antibody sandwich Gh-TRFIA was 0.225 ng/ml, and the linear range of the standard curve was 0.225–250 ng/ml. The intra- and interassay coefficients of variation (CVs) were < 9.1 and < 4.5%, respectively. The cross-reactivities (CRs) of 1 μg/ml recombinant tilapia somatolactin (rtSl), prolactin (rtPrl) and thyroid-stimulating hormone beta subunit (rtTshb) were 0.042%, 0.472% and 0.036%, respectively. The sensitivity of direct competitive Gh-TRFIA was 0.208 ng/ml, and the linear range of the standard curve was 0.208–500 ng/ml. The intra- and interassay CVs were < 4.8 and < 7.1%, respectively. The CRs of 1 μg/ml rtSl, rtPrl and rtTshb were 0.041%, 0.079% and 0.073%, respectively. In conclusion, Gh-TRFIA is a safe (no concerns about radioactive isotopes), economical, and efficient detection method for the quantification of plasma Gh. Thus, the application of phage display technology for antibody screening and the use of TRFIA for tilapia Gh detection are conducive to research in the field of fish endocrinology.
1. Introduction The growth hormone/insulin-like growth factor axis plays a central role in the regulation of growth in teleosts. Growth hormone is an adenohypophysial hormone secreted from the anterior pituitary and is involved in the regulation of most major physiological processes such as growth, reproduction, development, osmoregulation, metabolism and feeding behavior (Madsen & Bern, 1993; McLean et al., 1993; Bhatta et al., 2012; Baroiller et al., 2014). The functions of growth hormone (Gh) are mediated by growth hormone receptors (Ghrs). There are two types of Ghrs in Nile tilapia (Oreochromis niloticus), Ghr1 and Ghr2, which are widely distributed among tissues (Ma et al., 2007). ⁎
Circulating Gh can bind to Ghr and stimulate the synthesis of insulinlike growth factor 1 (Igf1) in the liver. Igf1 is important to the regulation of growth and metabolism. (Frystyk, 2004; Bergan-Roller and Sheridan, 2018). The actions of the Gh-Igf1 axis are particularly complex because of the multiple isoforms of Ghs, Igfs and their receptors (Reinecke et al., 2005). It is well known that in tilapia, males present better growth performance than females. Precocious sexual maturity associated with continuous and asynchronous reproductive activity results in higher allocation of metabolic energy into gametogenesis in females compared with males (Toguyeni et al., 2002). The gonadosomatic index (GSI) is a parameter for providing a rough estimate of the maturation stage (Cayré and Laloë, 1986). The liver is one of the
Corresponding author at: School of Life Science, Sun Yat-Sen University, 135 Xin Gang West Road, Guangzhou 510275, China. E-mail address: [email protected] (W. Li).
https://doi.org/10.1016/j.ygcen.2019.113357 Received 16 August 2019; Received in revised form 12 November 2019; Accepted 6 December 2019 Available online 09 December 2019 0016-6480/ © 2019 Elsevier Inc. All rights reserved.
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
storage sites of lipids in fish; the lipid contents in fish liver can be 10–20% of the wet weight (Sheridan, 1994). Hepatic lipid stores are accessed during extended fasting periods (Magnoni et al., 2006; Sheridan, 1994). The hepotosomatic index (HSI) is an indirect index of energy status (Chellappa et al., 1995). The primary structures of fish Ghs are relatively conserved within the same order but become diversified between different orders and are even more different from tetrapod Ghs (37–58% identity) (Chang et al., 1992). For example, the homology of Gh between Nile tilapia (Oreochromis niloticus) and orange-spotted grouper (Epinephelus coioides) is relatively conserved (90% identity) (Li et al., 2005), but the homology is less conserved between tilapia and mammals (approximately 35% identity). Therefore, antibodies for mammal GHs may not be used in the detection of tilapia Gh. Phage display technology is widely used in the expression of peptides and proteins including antibody fragments (Lang et al., 1996), in which fragments of antibodies are expressed as fusions with phage proteins and are displayed on the surface of a phage. This technique has the potential to generate complex libraries exceeding 1014 phages and can screen and enrich for an antibody bound to a desired ligand (Winter et al., 1994). It has been known for decades that rabbits are excellent producers of polyclonal antibodies against a variety of antigens and haptens. Rabbits process multiple germline VH genes, but with more than 80% similarity, consequently these VH genes are members of one large VH gene family (McCormack et al., 1985). In normal rabbits, κ light chains represent 90–95% of total L chains and nearly all of them are derived from Cκ1 and are designated as κ-1 isotypes (Knight & Crane, 1994). Therefore, only a limited number of primers are needed to amplify most of the rabbit VH or VL fragments (Foti et al., 1998). Several immunoassay analytical methods such as radioimmunoassay (RIA), enzyme linked immunosorbent assay (ELISA) and chemiluminescence immune assay (CLIA) have been developed for the detection of serum Gh level. (Tannenbaum et al., 2001; Cook et al., 1983; Small and Peterson, 2005; Wu et al., 2008; Fukada et al., 1997b). Among these methods, RIA has excellent sensitivity, but the use of radioactive isotopes may be associated with safety risks. ELISA uses enzymes as biomarkers, such as horseradish peroxidase (HRP) and is economical and easy to apply. However, the detection capacity is limited, and the assay is sensitive to matrix interferences and assay conditions. CLIA uses a luminescent substance as label, and the luminescent substance is excited by a reactant (such as a peroxianion); thus, the chemiluminescence signal can be measured, but the fluorescence is unstable, and the measurement needs to be completed in a short time. Time-resolved fluorescence immunoassay (TRFIA) is a microanalysis method developed nearly two decades ago, and is one of the most sensitive analytical techniques. It uses a nonradioactive lanthanide, such as europium (Eu), terbium (Tb) or samarium (Sm), to form a lanthanide chelate as the label. The lanthanide chelates used in TRFIA have long decay times (103-106ns), large Stokes’ shifts (up to 278 nm), sharp emission peaks and high fluorescence intensities. These special properties make the fluorescence signal easy to distinguish from background fluorescence and improve the specificity and sensitivity of the detection (Soini & Kojola, 1983). One of the lanthanide chelates, N1-(pisothiocyanato-benzyl)-diethylene-triamine-N1,N2,N3,N4-tetraacetateEu3+ (Eu-DTTA or DTTA-Eu3+), is commonly used in TRFIA and suitable for the labeling of proteins. TRFIA is currently widely used in clinical diagnosis because of its stability and high sensitivity but is not commonly used in fish plasma Gh detection. In this report, we obtained a single-chain variable fragment (scFv) using phage display technology that can specifically bind to tilapia Gh. We then established a Eu-DTTAbased time-resolved fluoroimmunoassay for measuring plasma Gh in tilapia. In conclusion, the levels of circulating Gh could be important analytical targets for the study of the mechanism of the Gh-Igf1 axis. The aim of this work is to provide a safe (no concerns about radioactive isotopes), rapid and sensitive method for the detection of Gh in tilapia
serum and to explore the relationships between growth performance, circulating Gh level and mRNA levels of related genes in male and female tilapia. 2. Materials and methods 2.1. Animals Matured male and female Nile tilapia with body weights (BWs) in the range of 200–400 g were purchased from the tilapia breeding farm of Guangdong (Panyu, Guangdong, China). New Zealand rabbits were purchased from the Experimental Animal Center of Guangzhou University of Chinese Medicine (Panyu, Guangdong, China) and were raised in the Experimental Animal Center of Sun Yat-sen University. All experiments were in compliance with the license of the Government of the People’s Republic of China and were approved by the Animal Experimentation Ethics Committee of Sun Yat-sen University. 2.2. Production of recombinant protein by Escherichia coli The cDNA sequences encoding grouper growth hormone (gGh) (GenBank Accession NO. AY513647.1) and tilapia growth hormone (tGh) (GenBank Accession NO. M26916.1) were amplified by PCR with specific primers and were subcloned into the expression vector PQE30 (Qiagen, Germany) to form PQE30-gGh and PQE30-tGh vectors, respectively. The PQE30-gGh and PQE30-tGh vectors were transformed into competent M15 [pREP4] cells (Qiagen, Germany) to form the M15PQE30-gGh and M15-PQE30-tGh strains. The two strains produced recombinant proteins of grouper Gh (rgGh) and recombinant proteins of tilapia Gh (rtGh), respectively. These proteins contain a 6 × His tag on the N terminus. For protein expression, the M15-PQE30-gGh and M15-PQE30-tGh strains were cultured in LB medium with 100 μg/ml ampicillin and 25 μg/ml kanamycin for 2.5 h until the OD600 reached 0.6, and the cells were then induced with 1 mM IPTG for 4 h. After induction, cells were centrifuged and resuspended in Binding Buffer (20 mM PB, 500 mM NaCl, 10 mM imidazole, pH 7.4), and the target proteins were released from the cells by sonication and further purified with a HisTrap EXCEL column (GE Healcare). 2.3. Rabbit immunization A single New Zealand rabbit was immunized with rgGh with 4X administration by 6-point subcutaneous injection. The first immunization was performed with 500 μg of rgGh in a 1:1 emulsion of PBS and Freund’s complete adjuvant. Ten and 17 days post-immunization, the rabbit was immunized with 200 μg of rgGh in a 1:1 emulsion of PBS and Freund’s incomplete adjuvant, respectively. On day 25, the rabbit was immunized with 500 μg of rgGh in a 1:1 emulsion of PBS and Freund’s incomplete adjuvant. The rabbit was anaesthetized with urethane 10 days after the final injection, and the blood was harvested. 2.4. Phage library construction Peripheral blood lymphocytes (PBLs) were isolated by density gradient centrifugation using lymphocyte separation medium (Tianjin Haoyang Biological Manufacturing, China) following the instruction manual. The lymphocytes were mechanically homogenized in TRIzol reagent (Invitrogen, USA) and total RNA was extracted by standard phenol/chloroform phase separation. The first-strand cDNA was synthesized with M−MLV reverse transcriptase (Invitrogen, USA) according to the manufacturer’s protocol. Variable light (VL) and variable heavy (VH) genes were amplified independently using degenerate primers (Table 1). Equimolar mixtures of VL and VH genes were assembled into scFv linker (a sequence for a 2
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
were coated with 100 μL of 10 μg/ml purified scFv-3F7 protein in coating buffer (50 mM Tris-HCl, pH 8.0) in each well and incubated at 4 °C overnight. After washing with TBST (50 mM Tris-HCl, 0.9% NaCl, 0.2% Tween-20, pH 7.8) 3 times, the plates were blocked with 3% BSA in 50 mM Tris-HCl and incubated at 4 °C overnight. After blocking, the plates were washed with TBST 3 times, dried and stored at −20 °C before use. Purified rtGh was diluted with assay buffer (50 mM Tris-HCl, 0.9% NaCl, 0.3% BSA, 0.05% Tween-20, 20 μM EDTA, pH 7.8) to 0.4, 2, 10, 50, or 250 ng/ml and used as a standard. Blood was drawn from the caudal fin of the anaesthetized fish and collected in 1.5 ml tubes. The plasma samples were kept at room temperature for 2 h and centrifuged at 7,500 × g for 20 min at 25 °C. The supernatants were collected and stored at −80 °C before the assay. Quantitative determination of Gh in standards and fish plasma was conducted using a TRFIA according to dissociation enhanced lanthanide fluorescence immunoassay (DELFIA) methodology (Ref 12441126-06; Perkin-Elmer). Briefly, for the double antibody sandwich method, 100 μL of standard or sample solution in assay buffer was added to the coated plate. The plate was incubated at 25 °C for 1 h with gentle shaking and washed with TBST 6 times by microplate washer (ImmunoWashTM 1575, Bio-Rad). Then 100 μL of Eu3+-labeled antibody in assay buffer was added to each well. The plate was incubated at 25 °C for 1 h with gentle shaking, and washed with TBST 6 times. Finally, 200 μL of enhance solution was added and shaken for 5 min. The fluorescence intensity (cps) was measured with a Wallac 2030 VICTORTM X multilabel counter (Perkin-Elmer, USA). The results from double sandwich method Gh-TRFIA experiments were processed using the double logarithmic model to plot standard curves using the equation lg (Y) = A*lg(X) + B. A direct competitive TRFIA was also established. In brief, 50 μL of standard or sample and 50 μL of Eu3+-labeled rtGh in assay buffer was added to the coated plate. The plate was incubated at 25 °C for 1 h with gentle shaking, and was washed with TBST 6 times. Then, 200 μL of enhance solution was added and shaken for 5 min. The fluorescence intensity (cps) was then measured. The results from direct competitive Gh-TRFIA experiments were processed using the Log-Logit function to plot standard curves using the equation Logit Y = ln [Y/(1 − Y)], Y = B/B0, where B0 corresponds to the fluorescence counts at zero concentration.
Table 1 Cloning primers of VH/VL and linker (5′-3′). Primer name
Sequence
VHF1 VHF2 VHR1 VHR2 VLF VLR Linker F Linker R VHR1-Linker VHR2-Linker VLF-Linker
ATGTCCGGGGGWSRCCT ATGGAGTCCGGGGGWSR TGARGAGAYGGTGACSAGGG GACTGATGGAGCCTTAGGTT GWKATGACCCAGACTCCA AGGTGCAACTGGATCACC GGCCAAGGCCACGGTCACCGT TGGAGACTGGGTGAGCTCAAT CCTSGTCACCRTCTCYTCAGGCCAAGGCCACGGTCACCGT ACCTAAGGCTCCATCAGTCGGCCAAGGCCACGGTCACCGT TGGAGTCTGGGTCATMWCTGGAGACTGGGTGAGCTCAAT
17-residue amino acid: SGGGSGGGGGGGSGGGG) using splice-byoverlap extension PCR. The PCR products and the phagemid vector pCANTAB5e were digested with a mix of NotI and SfiI enzyme and purified from a 1% agarose gel. The scFv gene pool was ligated into the pCANTAB5e phagemid and transformed into Escherichia coli TG1 (genotype: [F’ traD36 proAB lacIqZΔM15] supE thi-1 Δ(lac-proAB) Δ(mcrB-hsdSM)5(rK−mK−)) (Bio-View Shine Biotechnology, China). The library was propagated in SOC medium containing 10% glycerinum. 2.5. Selection of Gh-specific candidate scFv clone and screening of the scFv clones by ELISA The scFv library was ‘rescued’ using M13K07 helper phage (Bio-View Shine Biotechnology, China), which was then resuspended in PBS (containing 1% (w/v) BSA) and subjected to three rounds of biopanning in 5 ml tubes coated with successively decreasing concentrations (10, 5, 2.5 μg/ml, respectively) of rgGh. After each panning step, 2 ml of 0.1 M HCl was added to elute the antigen-bound phage. Six minutes later, 2 ml of 50 mM Tris-HCl (pH 7.4) was added, and phage was then reinfected into log phase E. coli TG1 cells. After the third panning, the polyclonal phage outputs in TG1 cells were stored in 8% glycerol at −80℃. The cells were serially diluted across the range of 10−1–10−8 in 2 × YT media, and 100 μL of each dilution was plated onto SOB-AG agar and grown overnight at 37 °C. Discrete colonies were selected for target-specific enrichment by phage ELISA using an anti-M13 HRP-labeled mouse monoclonal antibody (GE Healthcare, USA) and scFv ELISA using the soluble expression E. coli HB2151 (Bio-View Shine Biotechnology, China) and an anti-E Tag HRP-labeled rabbit polyclonal antibody (Abcam, USA) according to the manufacturer’s protocols. Positive clones were screened out of the library, and plasmids were purified from a 10 ml overnight culture using a Plasmid Mini Kit (OMEGA, China) for DNA sequencing (Invitrogen, USA). One of the positive clones, 3F7, was subcloned into pET32a+ and transformed into competent BL21 trxb cells (Novagen, Germany) to form a BL21pET32a+-3F7 strain. This strain can express a 46-kD scFv with a His-tag and a Trx-tag at the N-terminus.
2.7. RNA isolation and real-time quantitative PCR analysis Tissue samples were collected and snap-frozen in liquid nitrogen until RNA extraction or protein isolation. Total RNA was extracted according to the TRIzol manufacturer’s protocol. The first-strand cDNA was synthesized with M-MLV reverse transcriptase (Invitrogen, USA) according to the manufacturer’s protocol. Real-time quantitative PCR was performed with SYBR® Green realtime PCR Master Mix (Dongsheng, China), and the cycling parameters were as follow: 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s, 58 °C for 15 s, 72 °C for 15 s and then fluorescent signal collection at 82 °C for 15 s. Melting curves were generated at 95 °C for 10 s and ramping from 65 °C to 95 °C with an increment of 0.5 °C per 5 s. 18S rRNA and β-actin were used as reference genes. Primers for measuring the expression levels of tilapia genes are listed in Table 2.
2.6. Gh fluoroimmunoassay Purified scFv-3F7 and rtGh protein was conjugated with N1-(p-isothiocyanato-benzyl)-diethylene-triamine-N 1,N2,N3,N4-tetraacetateEu3+ (Eu-DTTA; Tianjin Radio-Medical Institute, Tianjin City, China) as a tracer. Briefly, 0.2 mg of Eu-DTTA was diluted in 20 μL of distilled water and mixed with 1 mg of scFv-3F7 or 500 μg of protein in 80 μL of 0.1 mol/L Na2CO3-NaHCO3 (pH 9.3), and the mixture was kept at 4 °C for 24 h. Excess europium and Eu-labeled protein were separated by Sephadex G-25 column with TSA buffer (50 mmol Tris-HCl, 0.9% BSA, 0.05% NaN3, pH 7.8). For the preparation of solid-phase antibody, clear 96-well plates
2.8. Statistical analysis All data are shown as the means ± S.E.M., and statistical analysis was performed with SPSS 1.8 software using either Student’s t test or one-way ANOVA. A probability of < 0.05 (P＜0.05) was considered a significant difference.
3
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
Table 2 Primers of Real-time PCR (5′-3′).
Table 3 Mass spectra identification of tilapia Gh IgG pull-down.
Primer name
Sequence
Accession
Description
Score
Coverage
GH-F GH-R IGF I-F IGF I-R GHR1-F GHR1-R GHR2-F GHR2-R βactin-F βactin-R 18S-F 18S-R
ACAGCCAGCGTTTGTTCTCCATTG GGAAACTCCCAGGACTCAACCAGT TGCGATGTGCTGTATCTCCTG GCCATAGCCTGTTGGTTTATTG CAAGTCCTTCCGGGCTAA ACTGTCGCTGAATGTCCAAT CAGCACCGAGACAACAGC TCAGGATGCCCACTAAAC ACCTTCTACAACGAGCTGAGAG GCCTGGATGGCAACGTACA AGAAACGGCTACCACATCC CACCAGACTTGCCCTCCA
M84774.1
Tilapia nilotica growth hormone gene, complete cds
32.04
37.75
A2
Sequence
# PSMs
High High High High High High High High High
DMHKVETYLTVAK LFSDFESSLQTEEQR DmHKVETYLTVAK IFLQDFcNSDYIISPIDK IFLQDFcNSDYIISPIDKHETQR VTHLHLLAQR TGILLLIR LFSIAVNR VETYLTVAK
1 1 2 1 1 2 1 1 1
3. Results 3.1. Expression of rgGh and rtGh proteins and preparation of polyclonal antibody
proteins extracted from tilapia pituitary. Mass spectrometry assay was performed on the band that appeared at approximately 22-23kD. Sequences of tilapia Gh were introduced into the MS Blas program, and the result suggested that Anti-rgGh IgG can bind to tilapia Gh (Table 3).
The M15-PQE30-gGh and M15-PQE30-tGh strains were constructed. The strains can express proteins with a 6 × HIS tag on the N terminus. The proteins were purified with Ni+-NTA resin. Proteins were verified by SDS-PAGE and Western blotting with HIS primary antibody. As expected, the molecular weights of rgGh and rtGh were 23.2kD and 22.8kD, respectively (Fig. 1A & B). The titer of serum anti-rgGh was approximately 1:10,000. Western blot analysis confirmed the specificity of anti-rgGh (Fig. 1C & D). AntirgGh IgG was purified from the serum and immunoreacted with
3.2. Construction of the anti-rgGh scFv library and production of anti-rgGh scFv protein The VL and VH genes were cloned (Fig. 2A) and assembled with linker (Fig. 2B & C), ligated into the pCANTAB5e phagemid and transformed into Escherichia coli TG1. After three rounds of
Fig. 1. Expression of recombinant Gh and verification of the specificity of anti-rgGh. (A) Expression of rgGh. M: marker; 1: control; 2: lysate after induction; 3: supernatant; 4: inclusion bodies; 5–6: purified protein; 7: control; 8: inclusion bodies; 9: purified protein. (B) Expression of rtGh. M: marker; 10: lysate after induction; 11: supernatant; 12: inclusion bodies; 13–14: purified protein; 15: inclusion bodies; 16: purified protein. (C) The dilution ratio of the anti-rgGh antibody is 1:3000. M: marker; P: 100 ng per well of rtGh; G: 5 µg total protein of grouper pituitary; T: 5 µg total protein of tilapia pituitary. (D) The dilution ratio of the control serum is 1:3000. M: marker; P: 100 ng per well of rtGh; G: 5 µg total protein of grouper pituitary; T: 5 µg of total protein of tilapia pituitary. 4
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
Fig. 2. Construction of the anti-rgGh scFv library and sequencing of GHab-3F7. (A) Cloning of rabbit VH and VL. M: 100 bp marker; N: negative control; VH: rabbit VH; VL: rabbit VL. (B) Cloning of Linker and Linker adapter. M1: 100 bp marker; N: negative control; 1: Linker; 2: Linker adapter; M2: 100 bp marker. (C) Assembled scFv fragment. M: 100 bp marker; N: negative control; scFv: scFv fragment. (D) Nucleotide and amino acid sequences of the GHab-3F7 scFv fragment. The linker sequences are indicated by underscores, and the asterisk indicates the termination codon.
molecular weight of scFv-3F7 was 46.6571kD and its isoelectric point was 6.21 (Fig. 3). The scFv-3F7 protein was immunoreacted with proteins extracted from tilapia pituitary. Mass spectrometry assay was performed on the band that appeared at approximately 22-23kD. Sequences of tilapia Gh were introduced into the MS Blas program, and the result suggested that scFv-3F7 can bind to tilapia Gh (Table 4).
biopanning, the capacity of tertiary antibody library was approximately 6.8 × 106. Positive clones were screened by phage ELISA and scFv ELISA, and one of the positive clones, 3F7, was subcloned into the pET32a+ vector. The Ghab-3F7 scFv DNA fragment was 798 bp in size (Fig. 2D). The BL21-pET32-3F7 strain was constructed and was determined to express a scFv with a 6 × HIS-tag and a Trx-tag at the N-terminus. The proteins were purified with Ni + -NTA resin and verified by SDS-PAGE and Western blotting with HIS primary antibody. As expected, the
Fig. 3. Expression and purification of BL21-pET32-3F7 scFv. M: marker; 1: control; 2: lysate after induction; 3: supernatant; 4: inclusion bodies; 5–6: purified protein; 7–8: Western blot of the protein. 5
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
Table 4 Mass spectra identification of tilapia Gh scFv (NO. 3F7) pull-down. Accession
Description
Score
Coverage
M84774.1
Tilapia nilotica growth hormone gene, complete cds
31.73
59.80
A2
Sequence
# PSMs
High High High High High High High High High
LFSDFESSLQTEEQR IFLQDFcNSDYIISPIDKHETQR IFLQDFcNSDYIISPIDK ANQDEAENYPDTDTLQHAPYGNYYQSLGGNESLR DmHKVETYLTVAK VTHLHLLAQR TGILLLIR LFSIAVNR QTYELLAcFKK
1 2 1 1 1 1 1 1 1
3.3. Establishment of Gh-TRFIA
4. Discussion
The sensitivity, detection range, and specificity of Gh-TRFIA were analyzed.
In the present study, we expressed recombinant tilapia Gh and grouper Gh. The purified rgGh was used to immunize rabbit to prepare antiserum and peripheral blood lymphocytes. We then cloned the VH and VL DNA fragments from the lymphocytes and assembled them with a linker to form a scFv gene pool. Using phage display technology, we isolated a positive strain (NO. 3F7) from the pool and obtained a singlechain variable fragment (scFv), which can specifically bind to grouper and tilapia Gh. We then established a Eu-DTTA-based time-resolved fluoroimmunoassay for measuring plasma Gh in tilapia. Finally, we explore the relationships between growth performance, circulating Gh level and mRNA levels of related genes in male and female tilapia. Since the primary structures of Ghs are less conserved between tilapia and mammal (Rentier-Delrue et al., 1989), it is hard to find suitable commercialized antibodies to establish an assay. Phage display antibody (PDA) libraries are an alternative tool for the isolation of monoclonal antibodies (Kumar et al., 2019). The common display format in phage display antibody libraries is either scFv or fragment antigen-binding (Fab). The scFv format is more preferred over Fab because of their small size, high expression level and ease of screening (Arbabi-Ghahroudi et al., 2005). In this report, we used pCANTAB5e as a phagemid vector for scFv screening and the pET32a vector for scFv expression. The proteins expressed by the pET32a vector contains a 6 × His-tag and a Trx-tag at the N-terminus so that the proteins can be purified through Ni-chelating affinity chromatography to achieve a higher solubility. In this way, we can obtain specific antibody fragments without high-end instruments in a process that can be performed in basic molecular biology labs (Kumar et al., 2019). As one of the most important biological analytic methods, immunoassay is widely used in biological research and clinical diagnosis. Immunoassays encompass several methods, such as RIA, ELISA, CLIA, fluorescence immunoassay (FIA), fluorescence polarization immunoassay (FPIA) and TRFIA (Soini & Kojola, 1983). These technologies are based on the specific binding of antigen and antibody. In this report, we established two types of assay, a double antibody sandwich method and a direct competitive method. In general, the sandwich method is suitable for antigens with more than one epitope, and the direct competitive method is more suitable for haptens (Dickson et al., 1995). The molecular weight of Gh is approximately 22kD, thus, both sandwich and competitive methods can be used. For solution phase detection, the composition of assay buffer, the working concentrations of antibody/antigen/samples, the reaction temperature and the reaction time of the assay should be optimized. The serum Gh levels of teleosts are normally approximately a few to a dozen nanograms per milliliter. For example, the serum growth hormone concentration of humans is 0–24.5 × 10−3 U/L (by TRFIA) (Hang et al., 2006), that of rats is 11 ng/ml (by RIA) (Tannenbaum et al., 2001), that of grass carp is 12 ng/ml (by RIA) (Cook et al., 1983),
3.3.1. The double antibody sandwich method for Gh-TRFIA The sensitivity was 0.225 ng/ml (concentration of the blank + 2SD), and the linear range of the standard curve was 0.225–250 ng/ml (Fig. 4A). The intra- and interassay coefficients of variation (CVs) were < 9.1% and < 4.5%, respectively. Antibody specificity was determined, with serum from tilapia diluted in a 2-fold serial dilution manner, the dilution curve was parallel to the Gh standard curve (Fig. 4B) and recombinant tilapia somatolactin (rtSl), prolactin (rtPrl) and thyroid stimulating hormone beta subunit (rtTshb) proteins were diluted in a 5-fold serial dilution. None of the dilution curves was parallel to the Gh standard curve. (Fig. 4C). The cross-reactivities (CRs) of 1 μg/ml rtSl, rtPrl and rtTshb were 0.042%, 0.472% and 0.036%, respectively. 3.3.2. The direct competitive method for Gh-TRFIA The sensitivity was 0.208 ng/ml and the linear range of the standard curve was 0.208–500 ng/ml (Fig. 4D). The intra- and interassay coefficients of variation (CVs) were < 4.8% and < 7.1%, respectively. Antibody specificity was determined by a double antibody sandwich method, in which serum from tilapia was diluted in a 2-fold serial dilution manner, the dilution curve was parallel to the Gh standard curve (Fig. 4E), and recombinant tilapia somatolactin (rtSl), prolactin (rtPrl) and thyroid stimulating hormone beta subunit (rtTshb) proteins were diluted in a 5-fold serial dilution. None of the dilution curves was parallel to the Gh standard curve. (Fig. 4F). The cross-reactivities (CRs) of 1 μg/ml rtSl, rtPrl and rtTshb were 0.041%, 0.079% and 0.073%, respectively. Since rtGh-Eu3+-based direct competitive TRFIA provided a slightly better sensitivity and detection range and needed less time, it was used for the following experiments. 3.4. Detection of plasma Gh levels and gh/igf1/ghr1/ghr2 mRNA abundance in matured male and female tilapia The mature tilapia used in this assay were approximately 9 months old, and the weights of males were significantly higher than those of females (Fig. 5F). The GSIs were significantly lower in males (Fig. 5H), and no significant difference was found in the HSI (Fig. 5G). The average Gh concentration of tilapia in this assay was approximately 26.6 ± 2.3 ng/ml, with no significant difference in males and females (Fig. 5E). Real-time PCR showed that the gh mRNA expression level in the pituitary and that the igf1/ghr1 mRNA expression in the livers of females were not distinctly different from those of males (Fig. 5A–C), but ghr2 mRNA expression in the liver was higher in males (Fig. 5D). 6
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
Fig. 4. Gh standard curve and antibody specificity analysis. (A) Gh standard curve of the double sandwich method. (B) Gh standard curve (double sandwich method) and serum dilution curve; the dilution ratios of tilapia serum were 1:1, 1:2 and 1:4. (C) Cross-reactivity assay of the double sandwich method. The recombinant proteins were diluted in a 5-fold serial dilution (250/50/10/2 ng/ml). (D) Gh standard curve of the direct competitive method. (E) Gh standard curve (direct competitive method) and serum dilution curve; the dilution ratios of tilapia serum were 1:2, 1:4 and 1:8. (F) Cross-reactivity assay of the direct competitive method. The recombinant proteins were diluted in a 5-fold serial dilution (250/50/10/2 ng/ml).
that of Mozambique tilapia is 1 ng/ml (by RIA) (Takashi et al., 1994), that of African carp is 3.5 ng/ml (by RIA) (Lescroart et al., 1996), that of channel catfish is 15 ng/ml (by ELISA) (Small and Peterson, 2005),
that of carp is 5.04 ng/ml (by ELISA) (Wu et al., 2008), that of female salmon is approximately 12.42 ± 1.89 ng/ml (by ELISA) (Fukada et al., 1997a) or 21 ng/ml (by CLIA) (Fukada et al., 1997b). The 7
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
Fig. 5. Gh concentration, average weight, HSI, GSI and relative gh/igf1/ghr1/ghr2 mRNA expression levels of sexually mature males and females. The data are presented as the means ± S.E.M. (n = 8–10). Differences among groups were compared with the t test. “*” indicates P < 0.05, there is a significant difference between the two groups; “***” indicates P < 0.01, there is a very significant difference between the two groups.
males and females in this experiment were similar. In vitro and in vivo studies have indicated that ghr2 mRNA can be regulated by Gh administration (Pierce et al., 2012), Gh stimulated proliferation in CHO cells transfected with a salmonid Ghr2 (Benedet et al., 2005), and Gh can induce promoter activity in CHO cells transfected with Ghr2 in black sea bream and zebrafish (Chen et al., 2011; Jiao et al., 2006). The differences in body weight along with the differences in ghr2 mRNA levels between males and females may indicate that Ghr2 is more active in growth promotion and is partially responsible for sexual growth dimorphism. Ghr1 is more responsible for transmitting the lipolytic signal of Gh, while Ghr2 is more active in transmitting the growth-promoting signal of Gh (Pierce et al., 2012, Bergan-Roller and Sheridan, 2018). Further research is needed to determine the mechanism of sexual growth dimorphism in tilapia. TRFIA is a safe (no concerns about radioactive isotopes), sensitive and efficient assay method for the quantification of plasma Gh. Thus, the application of TRFIA for tilapia Gh detection is conducive to research in the field of fish physiology.
regulation of serum Gh varies with species, developmental stage, and environmental conditions (Yada et al., 1994; Björnsson et al., 1994; Bergan-Roller and Sheridan, 2018). In this experiment, the physiological concentration of tilapia serum Gh was approximately 26.6 ± 2.3 ng/ml. The Gh level of males was modestly, but nonsignificantly, higher than that of females. These results agree with previous research in Mozambique tilapia (Oreochromis mossambicus) (Bhatta et al., 2012; Davis et al., 2008). The serum Gh of tilapia may be affected by fasting (Toguyeni et al., 1996). The HSIs of males and females were not significantly different, indicating that the energy status of males and females in this experiment were similar. The GSI of females was higher, indicating that females spend more energy in gametogenesis. In addition, the body weight of males was significantly higher. We found no significant difference in gh/igf1/ghr1 mRNA levels between males and females except for ghr2 mRNA levels. Previous studies showed that the function of Ghr1 in different species was discrepant. For example, in salmon and tilapia, Ghr1 may be the receptor of somatolactin (Sl) (Fukada et al.,2005; Fukamachi and Meyer, 2007; Fukamachi et al., 2005; Pierce et al., 2007), while in zebra fish, Japanese eel and black sea bream, Ghr1 is not an Sl receptor (Chen et al., 2011; Jiao et al., 2006; Ozaki et al., 2006). Tilapia Ghr1 has a strong affinity for Gh, and the levels of igf1 and ghr1 mRNA are correlated in the liver and the ovary. However, there was no correlation between liver and ovarian ghr1 mRNA. An in vitro study of tilapia hepatocytes showed that ghr1 mRNA is regulated by cortisol, insulin and glucagon, but not by Gh, indicating that the level of ghr1 mRNA in tilapia hepatocytes may be regulated by the metabolic state. Ghr1 may mediate metabolic function (Pierce et al., 2012). The lack of a significant difference in ghr1 mRNA levels may indicate that the metabolic states of
Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments This study was supported by the National Key R&D Program of China 2018YFD0900101, the China Agriculture Research System (CARS-46), the Guangdong Provincial Science and Technology Program 8
General and Comparative Endocrinology 287 (2020) 113357
J. Qin, et al.
(2015A020216006, 2012B020308001, 2014A020208021), Science and Technology Planning Project of Guangzhou (201607020014), and the Program for Chinese Outstanding Talents in Agricultural Scientific Research (2016–2020) to Dr. Wensheng Li.
Kumar, R., Parray, H.A., Shrivastava, T., Sinha, S., Luthra, K., 2019. Phage display antibody libraries: A robust approach for generation of recombinant human monoclonal antibodies. Int. J. Biol. Macromol. 135, 907–918. Lang, I.M., Barbasi, C.F.I., Schleef, R.R., 1996. Recombinant rabbit Fab with binding activity to type-1 plasminogen activator inhibitor derived from a phage-display library against human alpha-granules. Gene (Amsterdam) 172 (2), 295–298. Lescroart, O., Roelants, I., Mikolajczyk, T., Bosma, P.T., Schulz, R.W., Kuhn, E.R., Ollevier, F., 1996. A radioimmunoassay for African catfish growth hormone: Validation and effects of substances modulating the release of growth hormone. Gen. Comp. Endocrinol. 104 (2), 147–155. Li, W.S., Chen, D., Wong, A.O.L., Lin, H.R., 2005. Molecular cloning, tissue distribution, and ontogeny of mRNA expression of growth hormone in orange-spotted grouper (Epinephelus coioides). Gen. Comp. Endocrinol. 144 (1), 78–89. Ma, X.L., Liu, X.C., Zhang, Y., Zhu, P., Ye, W., Lin, H.R., 2007. Two growth hormone receptors in Nile tilapia (Oreochromis niloticus): Molecular characterization, tissue distribution and expression profiles in the gonad during the reproductive cycle. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 147 (2), 325–339. Madsen, S.S., Bern, H.A., 1993. In-vitro effects of insulin-like growth factor-I on gill Na+, K(+)-ATPase in coho salmon, Oncorhynchus kisutch. J. Endocrinol. 138 (1), 23–30. Magnoni, L.J., Patterson, D.A., Farrell, A.P., Weber, J.-M., 2006. Effects of long-distance migration on circulating lipids of sockeye salmon (Oncorhynchus nerka). Can. J. Fish. Aquat. Sci. 63 (8), 1822–1829. McCormack, W.T., Laster, S.M., Marzluff, W.F., Roux, K.H., 1985. Dynamic gene interactions in the evolution of rabbit VH genes: a four codon duplication and block homologies provide evidence for intergenic exchange. Nucleic Acids Res. 13 (19), 7041–7054. McLean, E., Donaldson, E.M., Teskeredzic, E., Souza, L.M., 1993. Growth enhancement following dietary delivery of recombinant porcine somatotropin to diploid and triploid coho salmon (Oncorhynchus kisutch). Fish Physiol. Biochem. 11 (1–6), 363–369. Ozaki, Y., Fukada, H., Kazeto, Y., Adachi, S., Hara, A., Yamauchi, K., 2006. Molecular cloning and characterization of growth hormone receptor and its homologue in the Japanese eel (Anguilla japonica). Compar. Biochem. Physiol. B Biochem. Mol. Biol. 143 (4), 422–431. Pierce, A.L., Breves, J.P., Moriyama, S., Uchida, K., Grau, E.G., 2012. Regulation of growth hormone (GH) receptor (GHR1 and GHR2) mRNA level by GH and metabolic hormones in primary cultured tilapia hepatocytes. Gen. Comp. Endocrinol. 179 (1), 22–29. Pierce, A.L., Fox, B.K., Davis, L.K., Visitacion, N., Kitahashi, T., Hirano, T., Grau, E.G., 2007. Prolactin receptor, growth hormone receptor, and putative somatolactin receptor in Mozambique tilapia: Tissue specific expression and differential regulation by salinity and fasting. Gen. Comp. Endocrinol. 154 (1–3), 31–40. Reinecke, M., Bjornsson, B.T., Dickhoff, W.W., McCormick, S.D., Navarro, I., Power, D.M., Gutierrez, J., 2005. Growth hormone and insulin-like growth factors in fish: Where we are and where to go. Gen. Comp. Endocrinol. 142 (1–2), 20–24. Rentier-Delrue, F., Swennen, D., Philippart, J.C., L'Hoir, C., Lion, M., Benrubi, O., Martial, J.A., 1989. Tilapia growth hormone: molecular cloning of cDNA and expression in Escherichia coli. DNA (Mary Ann Liebert, Inc.) 8 (4), 271–278. Sheridan, M.A., 1994. Regulation of lipid metabolism in poikilothermic vertebrates. Compar. Biochem. Physiol. B Compar. Biochem. Mol. Biol. 107 (4), 495–508. Small, B.C., Peterson, B.C., 2005. Establishment of a time-resolved fluoroimmunoassay for measuring plasma insulin-like growth factor I (IGF-I) in fish: effect of fasting on plasma concentrations and tissue mRNA expression of IGF-I and growth hormone (GH) in channel catfish (Ictalurus punctatus). Domest. Anim. Endocrinol. 28 (2), 202–215. Soini, E., Kojola, H., 1983. Time-resolved fluorometer for lanthanide chelates–a new generation of nonisotopic immunoassays. Clin. Chem. 29 (1), 65–68. Takashi, Y., Tetsuya, H., Gordon, E.G., 1994. Changes in plasma levels of the two prolactins and growth hormone during adaptation of different salinities in the euryhaline tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol. 93, 214–223. Tannenbaum, G.S., Choi, H.K., Gurd, W., Waxman, D.J., 2001. Temporal relationship between the sexually dimorphic spontaneous GH secretory profiles and hepatic STAT5 activity. Endocrinology 142 (11), 4599–4606. Toguyeni, A., Baroiller, J.-F., Fostier, A., Le Bail, P.-Y., Kuhn, E.R., Mol, K.A., Fauconneau, B., 1996. Consequences of food restriction on short-term growth variation and on plasma circulating hormones in Oreochromis niloticus in relation to sex. Gen. Compar. Endocrinol. 103 (2), 167–175. Toguyeni, A., Fauconneau, B., Fostier, A., Abucay, J., Mair, G., Baroiller, J.F., 2002. Influence of sexual phenotype and genotype, and sex ratio on growth performances in tilapia Oreochromis niloticus. Aquaculture 207 (3–4), 249–261. Winter, G., Griffiths, A.D., Hawkins, R.E., Hoogenboom, H.R., 1994. Making antibodies by phage display technology. Annu. Rev. Immunol. 12, 433–455. Wu, G., Chen, L., Zhong, S., Li, Q., Song, C., Jin, B., Zhu, Z., 2008. Enzyme-linked immunosorbent assay of changes in serum levels of growth hormone (cGH) in common carps (Cyprinus carpio). Sci. China Ser. C Life Sci. 51 (2), 157–163. Yada, T., Hirano, T., Grau, E.G., 1994. Changes in plasma levels of the two prolactins and growth hormone during adaptation to different salinities in the euryhaline tilapia, Oreochromis mossambicus. Gen. Compar. Endocrinol. 93 (2), 214–223.
References Arbabi-Ghahroudi, M., Tanha, J., MacKenzie, R., 2005. Prokaryotic expression of antibodies. Cancer Metastasis Rev. 24 (4), 501–519. Baroiller, J.-F., D'Cotta, H., Shved, N., Berishvili, G., Toguyeni, A., Fostier, A., Eppler, E., Reinecke, M., 2014. Oestrogen and insulin-like growth factors during the reproduction and growth of the tilapia Oreochromis niloticus and their interactions. Gen. Comp. Endocrinol. 205, 142–150. Benedet, S., Johansson, V., Sweeney, G., Galay-Burgos, M., Bjornsson, B.T., 2005. Cloning of two Atlantic salmon growth hormone receptor isoforms and in vitro ligand-binding response. Fish Physiol. Biochem. 31 (4), 315–329. Bergan-Roller, H.E., Sheridan, M.A., 2018. The growth hormone signaling system: Insights into coordinating the anabolic and catabolic actions of growth hormone. Gen. Comp. Endocrinol. 258, 119–133. Bhatta, S., Iwai, T., Miura, C., Higuchi, M., Shimizu-Yamaguchi, S., Fukada, H., Miura, T., 2012. Gonads directly regulate growth in teleosts. PNAS 109 (28), 11408–11412. Björnsson, B.T., Taranger, G.L., Hansen, T., Stefansson, S.O., Haux, C., 1994. The Interrelation between Photoperiod, Growth Hormone, and Sexual Maturation of Adult Atlantic Salmon (Salmo salar). Gen. Comp. Endocrinol. 93 (1), 70–81. Cayré, P., Laloë, F., 1986. Review of the Gonad Index (GI) and an introduction to the concept of its “critical value”: application to the skipjack tuna Katsuwonus pelamis in the Atlantic Ocean. Mar. Biol. 90 (3), 345–351. Chang, Y.S., Liu, C.S., Huang, F.L., Lo, T.B., 1992. The primary structures of growth hormones of three cyprinid species: bighead carp, silver carp, and grass carp. Gen. Comp. Endocrinol. 87 (3), 385–393. Chellappa, S., Huntingford, F.A., Strang, R.H.C., Thomson, R.Y., 1995. Condition factor and hepatosomatic index as estimates of energy status in male three-spined stickleback. J. Fish Biol. 47 (5), 775–787. Chen, M., Huang, X., Yuen, D.S.H., Cheng, C.H.K., 2011. A study on the functional interaction between the GH/PRL family of polypeptides with their receptors in zebrafish: Evidence against GHR1 being the receptor for somatolactin. Mol. Cell. Endocrinol. 337 (1–2), 114–121. Cook, A.F., Wilson, S.W., Peter, R.E., 1983. Development and validation of a carp growth hormone radioimmunoassay. Gen. Compar. Endocrinol. 50 (3), 335–347. Davis, L.K., Pierce, A.L., Hiramatsu, N., Sullivan, C.V., Hirano, T., Grau, E.G., 2008. Gender-specific expression of multiple estrogen receptors, growth hormone receptors, insulin-like growth factors and vitellogenins, and effects of 17 beta-estradiol in the male tilapia (Oreochromis mossambicus). Gen. Comp. Endocrinol. 156 (3), 544–551. Dickson, E.F.G., Pollak, A., Diamandis, E.P., 1995. Ultrasensitive bioanalytical assays using time-resolved fluorescence detection. Pharmacol. Ther. 66 (2), 207–235. Foti, M., Granucci, F., Ricciardi-Castagnoli, P., Spreafico, A., Ackermann, M., Suter, M., 1998. Rabbit monoclonal Fab derived from a phage display library. J. Immunol. Methods 213 (2), 201–212. Frystyk, J., 2004. Free insulin-like growth factors - measurements and relationships to growth hormone secretion and glucose homeostasis. Growth Hormon. IGF Res. 14 (5), 337–375. Fukada, H., Hiramatsu, N., Gen, K., Hara, A., 1997a. Development of an ELISA for chum salmon (Oncorhynchus keta) growth hormone. Compar. Biochem. Physiol. B 117 (3), 387–392. Fukada, H., Hiramatsu, N., Kitamura, M., Chiba, H., Hara, A., 1997b. Chemiluminescent immunoassay (CLIA) for salmon growth hormone (GH). J. Biolumin. Chemilumin. 12 (6), 271–275. Fukada, H., Ozaki, Y., Pierce, A.L., Adachi, S., Yamauchi, K., Hara, A., Swanson, P., Dickhoff, W.W., 2005. Identification of the salmon somatolactin receptor, a new member of the cytokine receptor family. Endocrinology 146 (5), 2354–2361. Fukamachi, S., Meyer, A., 2007. Evolution of receptors for growth hormone and somatolactin in fish and land vertebrates: Lessons from the lungfish and sturgeon orthologues. J. Mol. Evol. 65 (4), 359–372. Fukamachi, S., Yada, T., Mitani, H., 2005. Medaka receptors for somatolactin and growth hormone: Phylogenetic paradox among fish growth hormone receptors. Genetics 171 (4), 1875–1883. Hang, J.F., Wu, Y.S., Xu, W.W., Zhou, Z.C., Huang, Y., Li, M., 2006. Time-resolved fluoroimmunoassay of human growth hormone and preparation of its diagnostic reagent. J. Sun Yat-sen Univ. Med. Sci. 27 (4), 472–475 (in Chinese). Jiao, B.W., Huang, X.G., Chan, C.B., Zhang, L., Wang, D.S., Cheng, C.H.K., 2006. The coexistence of two growth hormone receptors in teleost fish and their differential signal transduction, tissue distribution and hormonal regulation of expression in seabream. J. Mol. Endocrinol. 36 (1), 23–40. Knight, K.L., Crane, M.A., 1994. Generating the antibody repertoire in rabbit. Adv. Immunol. 56, 179–218.
9