- Email: [email protected]
Development of molecular assays for the identification of the 11 Eimeria species of the domestic rabbit (Oryctolagus cuniculus)
Veterinary Parasitology 176 (2011) 275–280
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Short communication
Development of molecular assays for the identification of the 11 Eimeria species of the domestic rabbit (Oryctolagus cuniculus) Ursula C. Oliveira a , Jane S. Fraga a , Dominique Licois b,1 , Michal Pakandl c,2 , Arthur Gruber a,∗ a b c
Departamento de Parasitologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo SP 05508-000, Brazil INRA, UR 1282 Infectiologie Animale et Santé Publique, Laboratory of Animal Infection and Public Health, F-37380 Nouzilly, France ˇ Institute of Parasitology, Biology Centre of the Academy of Sciences of the Czech Republic, Braniˇsovská 31, 370 05 Ceské Budˇejovice, Czech Republic
a r t i c l e
i n f o
Article history: Received 24 August 2010 Received in revised form 20 October 2010 Accepted 27 October 2010 Keywords: Eimeria Rabbit Coccidiosis ITS1 Ribosomal DNA PCR-based diagnosis
a b s t r a c t Coccidiosis are the major parasitic diseases in poultry and other domestic animals including the domestic rabbit (Oryctolagus cuniculus). Eleven distinct Eimeria species have been identified in this host, but no PCR-based method has been developed so far for unequivocal species differentiation. In this work, we describe the development of molecular diagnostic assays that allow for the detection and discrimination of the 11 Eimeria species that infect rabbits. We determined the nucleotide sequences of the ITS1 ribosomal DNAs and designed species-specific primers for each species. We performed specificity tests of the assays using heterologous sets of primers and DNA samples, and no cross-specific bands were observed. We obtained a detection limit varying from 500 fg to 1 pg, which corresponds approximately to 0.8–1.7 sporulated oocysts, respectively. The test reported here showed good reproducibility and presented a consistent sensitivity with three different brands of amplification enzymes. These novel diagnostic assays will permit population surveys to be performed with high sensitivity and specificity, thus contributing to a better understanding of the epidemiology of this important group of coccidian parasites. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Coccidiosis are the major parasitic diseases in poultry and other domestic animals, including rabbits. Eleven distinct Eimeria species have been identified in rabbits (Oryctolagus cuniculus), with 10 species colonizing the intestinal tract and one species (E. stiedai) infecting the biliary ducts of the liver (Coudert, 1989; Licois and Coudert, 1982). Most of these Eimeria species affect the rabbit production and, according to their level of pathogenicity,
∗ Corresponding author. Tel.: +55 11 30917274; fax: +55 11 30917417. E-mail address: [email protected] (A. Gruber). 1 Currently retired. 2 Current address: The College of European and Regional Studies o.p.s., ˇ Zˇ iˇzkova 6, 370 01 Ceské Budˇejovice, Czech Republic. 0304-4017/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2010.10.054
can cause reduced growth rate and feed conversion, and increased mortality. Also, marked differences observed in rabbit production and management across many countries may influence species composition and pathogenicity of rabbit coccidia (Pakandl, 2009). Eimeria species differentiation in rabbits has been classically performed using a set of biological features such as oocyst size and morphology (curvature, presence/absence of oocyst residuum, conspicuous/inconspicuous micropyle, etc.), prepatent period, site of colonization, amongst other aspects (Coudert et al., 1995; Pakandl, 2009). Even though oocyst morphology allows a good differentiation of rabbit Eimeria, it is practically impossible to carefully evaluate thousands of oocysts just to assess if a given strain is really pure. Moreover, a small portion of oocysts may differ from the typically expected morphology, posing a challenge to a correct diagnosis. In addition, all these biological fea-
276
U.C. Oliveira et al. / Veterinary Parasitology 176 (2011) 275–280
Table 1 Primer sequences used for the generic amplification of ITS1 Eimeria spp. and each one of the 11 Eimeria species of domestic rabbit. Eimeria species
Eimeria spp. (all species) E. coecicola E. exigua E. flavescens E. intestinalis E. irresidua
Primer Name
Sequence
ITS1-F ITS1-R Ecoe-ITS1-F Ecoe-ITS1-R Eexi-ITS1-F Eexi-ITS1-R Efla-ITS1-F Efla-ITS1-R Eint-ITS1-F Eint-ITS1-R Eirr-ITS1-F Eirr-ITS1-R
GGGAAGTTGCGTAAATAGA CTGCGTCCTTCATCGAT AGCTTGGTGGGTTCTTATTATTGTAC CTAGTTGCTTCAACAAATCCATATCA GAATAAGTTCTGCCTAAAGAGAGCC TATATAGACCATCCCCAACCCAC GAATATTGTTGCAGTTTACCACCAA CCTCAACAACCGTTCTTCATAATC TGTTTGTACCACCGAGGGAATA AACATTAAGCTACCCTCCTCATCC TTTGGTGGGAAAAGATGATTCTAC TTTGCATTATTTTTAACCCATTCA
tures may present a variable level of overlap, hampering in some cases an accurate Eimeria species identification (Long and Joyner, 1984). In the case of chicken Eimeria, various molecular differentiation assays have been proposed, using distinct targets such as ITS1 (Schnitzler et al., 1998, 1999), ITS2 (Woods et al., 2000; Gasser et al., 2001), and SCARs (Fernandez et al., 2003a, 2003b). For a comprehensive review on the molecular diagnosis of avian coccidiosis, the reader is referred to Morris and Gasser (2006). Finally, real-time PCR assays have also been described (Blake et al., 2008; Morgan et al., 2009), permitting quantitative studies of the distinct Eimeria species. Conversely, no PCR-based method has been developed for the unequivocal differentiation of the 11 Eimeria species that infect rabbits. Ceré et al. (1995) described a RAPD assay for the differentiation of nine Eimeria species, but this method presents low reproducibility. Also, the typical multiband character makes it unsuitable for testing mixed field samples. Ceré et al. (1996) developed a specific and sensitive PCR assay for E. media, but this approach has not been extended to the remaining species. The precise diagnosis of all species of rabbit coccidia is very important for several reasons. First, individual Eimeria species present dramatic differences in their pathogenicity (Coudert et al., 1995). Second, an accurate Eimeria species differentiation method would represent an essential tool for monitoring the purity of strains in the production of a future multivalent vaccine. Finally, a correct species identification would allow research laboratories to assess the purity of the strains under study. In this work, we report the development of molecular diagnostic assays for the detection and discrimination of the 11 Eimeria species that infect the domestic rabbit. 2. Materials and methods 2.1. Parasites Isolates of the 11 Eimeria species that infect the domestic rabbit (Oryctolagus cuniculus f. domesticus) were used throughout the work. E. coecicola, E. flavescens, E. irresidua, E. piriformis, E. stiedai and E. vejdovskyi isolates were originally obtained from field samples in the Czech Republic. E. exigua, E. intestinalis, E. magna, E. media and E. perforans were isolated in France. All samples were propagated
Eimeria species
Primer Name
Sequence
E. magna
Emag-ITS1-F Emag-ITS1-R Emed-ITS1-F Emed-ITS1-R Eper-ITS1-F Eper-ITS1-R Epir-ITS1-F Epir-ITS1-R Esti-ITS1-F Esti-ITS1-R Evej-ITS1-F Evej-ITS1-R
TTTACTTATCACCGAGGGTTGATC CGAGAAAGGTAAAGCTTACCACC GATTTTTTTCCACTGCGTCC TTCATAACAGAAAAGGTAAAAAAAGC TTTTATTTCATTCCCATTTGCATCC CTTTTCATAACAGAAAAGGTCAAGCTTC ACGAATACATCCCTCTGCCTTAC ATTGTCTCCCCCTGCACAAC GTGGGTTTTCTGTGCCCTC AAGGCTGCTGCTTTGCTTC GTGCTGCCACAAAAGTCACC GCTACAATTCATTCCGCCC
E. media E. perforans E. piriformis E. stiedai E. vejdovskyi
in specific pathogen-free rabbits (Charles River Laboratories, Germany – supplied in the Czech Republic by AnLab Prague) and purified according to the standard protocols (Coudert et al., 1995). Oocysts were sporulated in a 2.5% potassium dichromate solution at room temperature under shaking, to ensure good aeration, and stored at 4 ◦ C until use. Purity of the samples was regularly monitored by visual inspection of the purified oocysts. Experimental procedures employing animals followed the institutional guidelines for the care and use of animals for research purposes. 2.2. Genomic DNA extraction and purification A total of 3–5 × 107 oocysts were washed with distilled water by several centrifugations (2500 × g/5 min) to remove the potassium dichromate solution, treated with sodium hypochlorite solution (5–6%) for 10 min at 4 ◦ C, and washed three times in distilled water. DNA extraction followed the protocol described by Fernandez et al. (2003a), with exception that before the glass-bead cracking step, the oocysts were pre-treated with SDS (0.5%) and proteinase K (100 g/ml) in extraction buffer (Tris–HCl 10 mM, pH 8.0; EDTA 50 mM, pH 8.0) for 2 h at 50 ◦ C. This step was introduced to facilitate the subsequent oocyst disruption and increase the final DNA yield. 2.3. ITS1 amplification and sequencing We designed a pair of primers to amplify the ITS1 region based on the E. tenella ribosomal cistron sequence (accession number AF026388). DNA samples of the 11 Eimeria species of rabbit were used as templates. PCR amplification was performed using 10 ng of template DNA, 1 U of Platinum® Taq DNA Polymerase High Fidelity (Invitrogen Corporation, Carlsbad, CA, USA), 1× High Fidelity PCR Buffer, 1.5 mM MgCl2 , 200 M dNTP mix, and 0.4 M of each ITS1-F and ITS1-R primers (Table 1). After an initial denaturation step of 2 min at 94 ◦ C, amplification was carried out for 30 cycles consisting of 1 min at 94 ◦ C, 1 min at 58 ◦ C and 1 min at 72 ◦ C, with a final extension step of 7 min at 72 ◦ C. The amplicons were analyzed on 1.5% agarose gels stained with 0.5 g/mL ethidium bromide. The amplification bands were quickly visualized with a portable longwave UV lamp, excised from the gel, purified
U.C. Oliveira et al. / Veterinary Parasitology 176 (2011) 275–280
277
Fig. 1. Amplification products separated by electrophoresis on 1.5% agarose gels and stained with ethidium bromide. DNA samples from the 11 Eimeria species of domestic rabbit were PCR amplified using homologous and heterologous primer pairs to test the specificity of the reactions. Samples with no DNA, used as negative controls, are also indicated. Horizontal strips of the gels are shown for space saving purpose only. No additional amplification bands have been observed in remaining areas of the gels (see Supplementary Material – Fig. 2).
with spun-columns (GFX PCR DNA and Gel Band Purification Kit, GE Healthcare Biosciences, Pittsburgh PA, USA) and eluted with TE (10 mM Tris–HCl pH 7.4; 1 mM EDTA). DNA sequencing of the ITS1 amplicons was performed using the ABI PRISM Big DyeTM Terminator Cycle Sequencing v 3.1 kit (Applied Biosystems, Foster City CA, USA) in an ABI PRISM 3100 Genetic Analyzer with POP-6 polymer. All fragments were sequenced in both strands with at least three replicates, the reads were pre-processed using EGene package (Durham et al., 2005) and assembled with CAP3 (Huang and Madan, 1999). Sequences were considered finished when fully covered by at least three distinct reads in both strands with no high-quality discrepancies. The nucleotide sequences determined here were deposited in the GenBank database under accession numbers HM768881 to HM768891.
primers is presented in Table 1. We standardized a single PCR amplification condition for all rabbit Eimeria species, which typically consisted of 10 ng of template DNA, 1 U of AmpliTaq Gold® DNA Polymerase (Applied Biosystems, Foster City, CA, USA), 1× GeneAmp PCR Buffer II; 1.5 mM MgCl2 , 200 M dNTP mix, and 0.4 M of each primer (Table 1). Cycling conditions comprised an initial denaturation step of 5 min at 95 ◦ C, 30 cycles of 45 s at 95 ◦ C, 45 s at 54 ◦ C and 1 min at 72 ◦ C, and a final extension step of 7 min at 72 ◦ C. Amplified products were electrophoretically separated on 1.5% agarose gels and stained with 0.5 g/mL ethidium bromide.
2.4. ITS1 diagnostic assays
The ITS1 sequences of the 11 Eimeria species that infect the domestic rabbit were amplified using a pair of primers common to the genus Eimeria (Table 1). The amplification products varied from circa 400 bp to 600 bp (see Supplementary Material – Fig. 1). The amplicons were fully sequenced and species-specific primers were designed for each Eimeria species (Table 1) in order to present similar values of melting temperature (Tm ). The size of the amplification targets ranged from 166 to 289 bp (Supplementary Material – Table 1). All reactions were tested for the ability
The ITS1 sequences of the 11 rabbit Eimeria species were submitted to a multiple sequence alignment using ClustalX (Larkin et al., 2007). The alignment was inspected and edited on BioEdit – Biological Sequence Alignment Editor (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Species-specific polymorphic regions were manually identified and primers were designed for the amplification of each one of the 11 Eimeria species. A complete list of the
3. Results 3.1. Development of PCR-based species diagnostic assays
278
U.C. Oliveira et al. / Veterinary Parasitology 176 (2011) 275–280
Fig. 2. Sensitivity of the PCR amplifications using serially diluted samples of purified DNA of each rabbit Eimeria species. Amplification products were separated on 1.5% agarose gels and stained with ethidium bromide. The Eimeria species used for each sample and the respective DNA quantities are indicated. Samples with no starting DNA were used as negative controls and are also indicated.
to amplify the specific targets of homologous DNA samples, and optimized for a maximum product yield. We standardized all reactions with the same PCR conditions, thus facilitating the set up of reactions destined for the amplification of multiple Eimeria species. 3.2. Specificity tests We conducted a series of specificity tests using the standardized PCR conditions. We tested all combinations of species-specific primer pairs and DNA samples of all Eimeria species of domestic rabbit. No cross-specific band has been observed using heterologous sets of primers and DNA samples (Fig. 1). A full set of pictures displaying uncut versions of all gels is available (Supplementary Material – Fig. 2). 3.3. Sensitivity tests We evaluated the sensitivity of the 11 species-specific reactions by serially diluting the DNA of each Eimeria species from 1 ng to 10 fg and performing the reactions under the standardized PCR conditions. As can be seen in Fig. 2, we obtained a detection limit of 500 fg for most species. In the case of E. flavescens, E. magna, E. perforans and E. piriformis, a detection limit of 1 pg has been observed. Considering a DNA content of 75 fg per
sporozoite (Cornelissen et al., 1984), the detection threshold varies from 6.7 to 13.3 sporozoites, which corresponds to approximately 0.8–1.7 sporulated oocysts, respectively. To assess the robustness and reliability of the assay, we carried out sensitivity tests using two additional brands of polymerases (recombinant Taq DNA Polymerase – Fermentas International, Ontario, Canada; BIOLASETM DNA Polymerase – Bioline, London, UK). The same detection limits were observed (Supplementary Material – Fig. 3). 4. Discussion In this work, we described the development of molecular diagnostic assays that allow the detection and discrimination of the 11 Eimeria species that infect the domestic rabbit (O. cuniculus). The assays are based on the use of species-specific ITS1 rDNA sequences as molecular targets for PCR amplification and, to our knowledge, represents the world’s first Eimeria differentiation test for this vertebrate host. The method reported here uses ITS1, a very well established molecular marker that has been used in a plethora of diagnostic assays. Despite the fact that ITS1 comprises a relatively short sequence, varying from 400 to 600 bp, and presents a relatively high A+T content (above 55%), we succeeded to develop species-specific primers for all rabbit Eimeria species. Our ITS1 sequence data, determined from single-oocyst derived lines, clearly
U.C. Oliveira et al. / Veterinary Parasitology 176 (2011) 275–280
validate the individual character and purity of the respective Eimeria species used throughout this work. The test reported here showed good reproducibility, even when performed with three different brands of amplification enzymes. In terms of sensitivity, our detection limit varied from 500 fg to 1 pg of DNA, thus corresponding to approximately 0.8–1.7 sporulated oocysts. This result is similar or even better than typical results of PCR-based assays described in the literature. Schnitzler et al. (1998) reported a detection limit of 25 oocysts for E. brunetti, using an ITS1-based PCR assay. Using ITS2 as a target, Gasser et al. (2001) observed a detection limit of 5–10 pg for chicken Eimeria. Fernandez et al. (2003b) obtained a sensitivity of 1 pg using either individual or multiple anonymous SCAR markers of Eimeria of domestic fowl. All these reports used serially diluted DNA for calculating sensitivity, but real-life situations may present a quite lower sensitivity. We have reported for oocysts of chicken Eimeria (Fernandez et al., 2003b) that DNA yield is not linear in respect to the oocyst amount, due probably to a decreasing efficiency of the mechanical oocyst disruption, especially in low-concentration samples. This may account for one order-of-magnitude reduction of the sensitivity. Several approaches for either chemical or combined mechanical/chemical oocyst disruption have been proposed but, in our opinion, a reproducible method for breaking up the oocyst wall and recovering high yields of DNA is still to be created. Despite this limitation, the observed sensitivity of our ITS1-based PCR assays is still high enough to detect parasite amounts that are much lower than those required to cause clinical signs and/or economic losses. Such a good sensitivity is particularly important for the detection of species that present very high reproductive potential. In E. intestinalis, for example, inoculation of immunologically naïve rabbits may result in the production of 3–5 × 108 oocysts per animal and 50% mortality (Coudert et al., 1995). Thus, the presence of even tiny amounts of this species should be promptly detected in field samples, before clinical signs and production losses be observed. Also, since E. intestinalis is very prevalent, and its population can rapidly overcome other Eimeria species, all rabbit Eimeria lines used for laboratory or field trials should be regularly monitored in respect to potential cross contaminations. This application may become even more critical for parasite lines destined to compose a future multivalent coccidia vaccine for rabbits. An accurate species identification is also important in the field practice because of the variable pathogenicity level of the different species. For instance, E. coecicola and E. perforans are non-pathogenic or slightly pathogenic, whereas other species, namely E. intestinalis and E. flavescens, are highly pathogenic (Coudert et al., 1995). Hence, the assays reported here may contribute to reveal the ethiology of rabbit coccidiosis outbreaks. In conclusion, we have developed a set of novel diagnostic assays that permit the differentiation of all Eimeria species that infect the domestic rabbit. These assays will permit population surveys to be performed with a high sensitivity and specificity, thus contributing for a better understanding of the epidemiology of this important group of coccidian parasites.
279
Conflicts of Interest None.
Acknowledgements U.C.O. received a fellowship from CNPq (143125/20060) and the work presented herein formed part of her Ph.D. thesis. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.vetpar.2010.10.054. References Blake, D.P., Qin, Z., Cai, J., Smith, A.L., 2008. Development and validation of real-time polymerase chain reaction assays specific to four species of Eimeria. Avian Pathol. 37, 89–94. Ceré, N., Humbert, J.F., Licois, D., Corvione, M., Afanassieff, M., Chanteloup, N., 1996. A new approach for the identification and the diagnosis of Eimeria media parasite of the rabbit. Exp. Parasitol. 82, 132– 138. Ceré, N., Licois, D., Humbert, J.F., 1995. Study of the inter- and intraspecific variation of Eimeria spp. from the rabbit using random amplified polymorphic DNA. Parasitol. Res. 81, 324–328. Cornelissen, A.W., Overdulve, J.P., van der Ploeg, M., 1984. Determination of nuclear DNA of five eucoccidian parasites, Isospora (Toxoplasma) gondii, Sarcocystis cruzi, Eimeria tenella. E. acervulina and Plasmodium berghei, with special reference to gamontogenesis and meiosis in I. (T.) gondii. Parasitology 88, 531–553. Coudert, P., 1989. Some peculiarities of rabbit coccidiosis. In: Yvoré, P. (Ed.), Coccidia and Coccidiomorphs, Vth International Coccidiosis Conference, Tours, France, 17–20 October. Les Colloques de l’INRA séries, vol. 49, INRA, Paris, pp. 481–488. Coudert, P., Licois, D., Drouet-Viard, F., 1995. Eimeria species and strains of rabbit. In: Eckert, J., Braun, R., Shirley, M. W., Coudert, P. (Eds.), COST. 89/820. Biotechnology: Guidelines on Techniques in Coccidiosis Research. Office for Official Publications of the European Communities, Luxembourg, pp. 52–73. Durham, A.M., Kashiwabara, A.Y., Matsunaga, F.T., Ahagon, P.H., Rainone, F., Varuzza, L., Gruber, A., 2005. EGene: a configurable pipeline generation system for automated sequence analysis. Bioinformatics 21, 2812–2813. Fernandez, S., Costa, A.C., Katsuyama, A.M., Madeira, A.M., Gruber, A., 2003a. A survey of the inter- and intraspecific RAPD markers of Eimeria spp. of the domestic fowl and the development of reliable diagnostic tools. Parasitol. Res. 89, 437–445. Fernandez, S., Pagotto, A.H., Furtado, M.M., Katsuyama, A.M., Madeira, A.M., Gruber, A., 2003b. A multiplex PCR assay for the simultaneous detection and discrimination of the seven Eimeria species that infect domestic fowl. Parasitology 127, 317–325. Gasser, R.B., Woods, W.G., Wood, J.M., Ashdown, L., Richards, G., Whithear, K.G., 2001. Automated, fluorescence-based approach for the specific diagnosis of chicken coccidiosis. Electrophoresis 22, 3546– 3550. Huang, X., Madan, A., 1999. CAP3: a DNA sequence assembly program. Genome Res. 9, 868–877. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins, D.G., 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947–2948. Licois, P., Coudert, P., 1982. Coccidioses et diarrhées du lapin à l’engraissement. Bull. GTV 5, 109–122. Long, P.L., Joyner, L.P., 1984. Problems in the identification of species of Eimeria. J. Protozool. 31, 535–541. Morgan, J.A., Morris, G.M., Wlodek, B.M., Byrnes, R., Jenner, M., Constantinoiu, C.C., Anderson, G.R., Lew-Tabor, A.E., Molloy, J.B., Gasser, R.B., Jorgensen, W.K., 2009. Real-time polymerase chain reaction (PCR) assays for the specific detection and quantification of seven Eimeria species that cause coccidiosis in chickens. Mol. Cell. Probes. 23, 83–89.
280
U.C. Oliveira et al. / Veterinary Parasitology 176 (2011) 275–280
Morris, G.M., Gasser, R.B., 2006. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol. Adv. 24, 590–603. Pakandl, M., 2009. Coccidia of rabbit: a review. Folia Parasitol. 56, 153–166. Schnitzler, B.E., Thebo, P.L., Mattsson, J.G., Tomley, F.M., Shirley, M.W., 1998. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, 490–497.
Schnitzler, B.E., Thebo, P.L., Tomley, F.M., Uggla, A., Shirley, M.W., 1999. PCR identification of chicken Eimeria: a simplified read-out. Avian Pathol. 28, 89–93. Woods, W.G., Richards, G., Whithear, K.G., Anderson, G.R., Jorgensen, W.K., Gasser, R.B., 2000. High-resolution electrophoretic procedures for the identification of five Eimeria species from chickens, and detection of population variation. Electrophoresis 21, 3558–3563.
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Short communication
Development of molecular assays for the identification of the 11 Eimeria species of the domestic rabbit (Oryctolagus cuniculus) Ursula C. Oliveira a , Jane S. Fraga a , Dominique Licois b,1 , Michal Pakandl c,2 , Arthur Gruber a,∗ a b c
Departamento de Parasitologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo SP 05508-000, Brazil INRA, UR 1282 Infectiologie Animale et Santé Publique, Laboratory of Animal Infection and Public Health, F-37380 Nouzilly, France ˇ Institute of Parasitology, Biology Centre of the Academy of Sciences of the Czech Republic, Braniˇsovská 31, 370 05 Ceské Budˇejovice, Czech Republic
a r t i c l e
i n f o
Article history: Received 24 August 2010 Received in revised form 20 October 2010 Accepted 27 October 2010 Keywords: Eimeria Rabbit Coccidiosis ITS1 Ribosomal DNA PCR-based diagnosis
a b s t r a c t Coccidiosis are the major parasitic diseases in poultry and other domestic animals including the domestic rabbit (Oryctolagus cuniculus). Eleven distinct Eimeria species have been identified in this host, but no PCR-based method has been developed so far for unequivocal species differentiation. In this work, we describe the development of molecular diagnostic assays that allow for the detection and discrimination of the 11 Eimeria species that infect rabbits. We determined the nucleotide sequences of the ITS1 ribosomal DNAs and designed species-specific primers for each species. We performed specificity tests of the assays using heterologous sets of primers and DNA samples, and no cross-specific bands were observed. We obtained a detection limit varying from 500 fg to 1 pg, which corresponds approximately to 0.8–1.7 sporulated oocysts, respectively. The test reported here showed good reproducibility and presented a consistent sensitivity with three different brands of amplification enzymes. These novel diagnostic assays will permit population surveys to be performed with high sensitivity and specificity, thus contributing to a better understanding of the epidemiology of this important group of coccidian parasites. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Coccidiosis are the major parasitic diseases in poultry and other domestic animals, including rabbits. Eleven distinct Eimeria species have been identified in rabbits (Oryctolagus cuniculus), with 10 species colonizing the intestinal tract and one species (E. stiedai) infecting the biliary ducts of the liver (Coudert, 1989; Licois and Coudert, 1982). Most of these Eimeria species affect the rabbit production and, according to their level of pathogenicity,
∗ Corresponding author. Tel.: +55 11 30917274; fax: +55 11 30917417. E-mail address: [email protected] (A. Gruber). 1 Currently retired. 2 Current address: The College of European and Regional Studies o.p.s., ˇ Zˇ iˇzkova 6, 370 01 Ceské Budˇejovice, Czech Republic. 0304-4017/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2010.10.054
can cause reduced growth rate and feed conversion, and increased mortality. Also, marked differences observed in rabbit production and management across many countries may influence species composition and pathogenicity of rabbit coccidia (Pakandl, 2009). Eimeria species differentiation in rabbits has been classically performed using a set of biological features such as oocyst size and morphology (curvature, presence/absence of oocyst residuum, conspicuous/inconspicuous micropyle, etc.), prepatent period, site of colonization, amongst other aspects (Coudert et al., 1995; Pakandl, 2009). Even though oocyst morphology allows a good differentiation of rabbit Eimeria, it is practically impossible to carefully evaluate thousands of oocysts just to assess if a given strain is really pure. Moreover, a small portion of oocysts may differ from the typically expected morphology, posing a challenge to a correct diagnosis. In addition, all these biological fea-
276
U.C. Oliveira et al. / Veterinary Parasitology 176 (2011) 275–280
Table 1 Primer sequences used for the generic amplification of ITS1 Eimeria spp. and each one of the 11 Eimeria species of domestic rabbit. Eimeria species
Eimeria spp. (all species) E. coecicola E. exigua E. flavescens E. intestinalis E. irresidua
Primer Name
Sequence
ITS1-F ITS1-R Ecoe-ITS1-F Ecoe-ITS1-R Eexi-ITS1-F Eexi-ITS1-R Efla-ITS1-F Efla-ITS1-R Eint-ITS1-F Eint-ITS1-R Eirr-ITS1-F Eirr-ITS1-R
GGGAAGTTGCGTAAATAGA CTGCGTCCTTCATCGAT AGCTTGGTGGGTTCTTATTATTGTAC CTAGTTGCTTCAACAAATCCATATCA GAATAAGTTCTGCCTAAAGAGAGCC TATATAGACCATCCCCAACCCAC GAATATTGTTGCAGTTTACCACCAA CCTCAACAACCGTTCTTCATAATC TGTTTGTACCACCGAGGGAATA AACATTAAGCTACCCTCCTCATCC TTTGGTGGGAAAAGATGATTCTAC TTTGCATTATTTTTAACCCATTCA
tures may present a variable level of overlap, hampering in some cases an accurate Eimeria species identification (Long and Joyner, 1984). In the case of chicken Eimeria, various molecular differentiation assays have been proposed, using distinct targets such as ITS1 (Schnitzler et al., 1998, 1999), ITS2 (Woods et al., 2000; Gasser et al., 2001), and SCARs (Fernandez et al., 2003a, 2003b). For a comprehensive review on the molecular diagnosis of avian coccidiosis, the reader is referred to Morris and Gasser (2006). Finally, real-time PCR assays have also been described (Blake et al., 2008; Morgan et al., 2009), permitting quantitative studies of the distinct Eimeria species. Conversely, no PCR-based method has been developed for the unequivocal differentiation of the 11 Eimeria species that infect rabbits. Ceré et al. (1995) described a RAPD assay for the differentiation of nine Eimeria species, but this method presents low reproducibility. Also, the typical multiband character makes it unsuitable for testing mixed field samples. Ceré et al. (1996) developed a specific and sensitive PCR assay for E. media, but this approach has not been extended to the remaining species. The precise diagnosis of all species of rabbit coccidia is very important for several reasons. First, individual Eimeria species present dramatic differences in their pathogenicity (Coudert et al., 1995). Second, an accurate Eimeria species differentiation method would represent an essential tool for monitoring the purity of strains in the production of a future multivalent vaccine. Finally, a correct species identification would allow research laboratories to assess the purity of the strains under study. In this work, we report the development of molecular diagnostic assays for the detection and discrimination of the 11 Eimeria species that infect the domestic rabbit. 2. Materials and methods 2.1. Parasites Isolates of the 11 Eimeria species that infect the domestic rabbit (Oryctolagus cuniculus f. domesticus) were used throughout the work. E. coecicola, E. flavescens, E. irresidua, E. piriformis, E. stiedai and E. vejdovskyi isolates were originally obtained from field samples in the Czech Republic. E. exigua, E. intestinalis, E. magna, E. media and E. perforans were isolated in France. All samples were propagated
Eimeria species
Primer Name
Sequence
E. magna
Emag-ITS1-F Emag-ITS1-R Emed-ITS1-F Emed-ITS1-R Eper-ITS1-F Eper-ITS1-R Epir-ITS1-F Epir-ITS1-R Esti-ITS1-F Esti-ITS1-R Evej-ITS1-F Evej-ITS1-R
TTTACTTATCACCGAGGGTTGATC CGAGAAAGGTAAAGCTTACCACC GATTTTTTTCCACTGCGTCC TTCATAACAGAAAAGGTAAAAAAAGC TTTTATTTCATTCCCATTTGCATCC CTTTTCATAACAGAAAAGGTCAAGCTTC ACGAATACATCCCTCTGCCTTAC ATTGTCTCCCCCTGCACAAC GTGGGTTTTCTGTGCCCTC AAGGCTGCTGCTTTGCTTC GTGCTGCCACAAAAGTCACC GCTACAATTCATTCCGCCC
E. media E. perforans E. piriformis E. stiedai E. vejdovskyi
in specific pathogen-free rabbits (Charles River Laboratories, Germany – supplied in the Czech Republic by AnLab Prague) and purified according to the standard protocols (Coudert et al., 1995). Oocysts were sporulated in a 2.5% potassium dichromate solution at room temperature under shaking, to ensure good aeration, and stored at 4 ◦ C until use. Purity of the samples was regularly monitored by visual inspection of the purified oocysts. Experimental procedures employing animals followed the institutional guidelines for the care and use of animals for research purposes. 2.2. Genomic DNA extraction and purification A total of 3–5 × 107 oocysts were washed with distilled water by several centrifugations (2500 × g/5 min) to remove the potassium dichromate solution, treated with sodium hypochlorite solution (5–6%) for 10 min at 4 ◦ C, and washed three times in distilled water. DNA extraction followed the protocol described by Fernandez et al. (2003a), with exception that before the glass-bead cracking step, the oocysts were pre-treated with SDS (0.5%) and proteinase K (100 g/ml) in extraction buffer (Tris–HCl 10 mM, pH 8.0; EDTA 50 mM, pH 8.0) for 2 h at 50 ◦ C. This step was introduced to facilitate the subsequent oocyst disruption and increase the final DNA yield. 2.3. ITS1 amplification and sequencing We designed a pair of primers to amplify the ITS1 region based on the E. tenella ribosomal cistron sequence (accession number AF026388). DNA samples of the 11 Eimeria species of rabbit were used as templates. PCR amplification was performed using 10 ng of template DNA, 1 U of Platinum® Taq DNA Polymerase High Fidelity (Invitrogen Corporation, Carlsbad, CA, USA), 1× High Fidelity PCR Buffer, 1.5 mM MgCl2 , 200 M dNTP mix, and 0.4 M of each ITS1-F and ITS1-R primers (Table 1). After an initial denaturation step of 2 min at 94 ◦ C, amplification was carried out for 30 cycles consisting of 1 min at 94 ◦ C, 1 min at 58 ◦ C and 1 min at 72 ◦ C, with a final extension step of 7 min at 72 ◦ C. The amplicons were analyzed on 1.5% agarose gels stained with 0.5 g/mL ethidium bromide. The amplification bands were quickly visualized with a portable longwave UV lamp, excised from the gel, purified
U.C. Oliveira et al. / Veterinary Parasitology 176 (2011) 275–280
277
Fig. 1. Amplification products separated by electrophoresis on 1.5% agarose gels and stained with ethidium bromide. DNA samples from the 11 Eimeria species of domestic rabbit were PCR amplified using homologous and heterologous primer pairs to test the specificity of the reactions. Samples with no DNA, used as negative controls, are also indicated. Horizontal strips of the gels are shown for space saving purpose only. No additional amplification bands have been observed in remaining areas of the gels (see Supplementary Material – Fig. 2).
with spun-columns (GFX PCR DNA and Gel Band Purification Kit, GE Healthcare Biosciences, Pittsburgh PA, USA) and eluted with TE (10 mM Tris–HCl pH 7.4; 1 mM EDTA). DNA sequencing of the ITS1 amplicons was performed using the ABI PRISM Big DyeTM Terminator Cycle Sequencing v 3.1 kit (Applied Biosystems, Foster City CA, USA) in an ABI PRISM 3100 Genetic Analyzer with POP-6 polymer. All fragments were sequenced in both strands with at least three replicates, the reads were pre-processed using EGene package (Durham et al., 2005) and assembled with CAP3 (Huang and Madan, 1999). Sequences were considered finished when fully covered by at least three distinct reads in both strands with no high-quality discrepancies. The nucleotide sequences determined here were deposited in the GenBank database under accession numbers HM768881 to HM768891.
primers is presented in Table 1. We standardized a single PCR amplification condition for all rabbit Eimeria species, which typically consisted of 10 ng of template DNA, 1 U of AmpliTaq Gold® DNA Polymerase (Applied Biosystems, Foster City, CA, USA), 1× GeneAmp PCR Buffer II; 1.5 mM MgCl2 , 200 M dNTP mix, and 0.4 M of each primer (Table 1). Cycling conditions comprised an initial denaturation step of 5 min at 95 ◦ C, 30 cycles of 45 s at 95 ◦ C, 45 s at 54 ◦ C and 1 min at 72 ◦ C, and a final extension step of 7 min at 72 ◦ C. Amplified products were electrophoretically separated on 1.5% agarose gels and stained with 0.5 g/mL ethidium bromide.
2.4. ITS1 diagnostic assays
The ITS1 sequences of the 11 Eimeria species that infect the domestic rabbit were amplified using a pair of primers common to the genus Eimeria (Table 1). The amplification products varied from circa 400 bp to 600 bp (see Supplementary Material – Fig. 1). The amplicons were fully sequenced and species-specific primers were designed for each Eimeria species (Table 1) in order to present similar values of melting temperature (Tm ). The size of the amplification targets ranged from 166 to 289 bp (Supplementary Material – Table 1). All reactions were tested for the ability
The ITS1 sequences of the 11 rabbit Eimeria species were submitted to a multiple sequence alignment using ClustalX (Larkin et al., 2007). The alignment was inspected and edited on BioEdit – Biological Sequence Alignment Editor (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Species-specific polymorphic regions were manually identified and primers were designed for the amplification of each one of the 11 Eimeria species. A complete list of the
3. Results 3.1. Development of PCR-based species diagnostic assays
278
U.C. Oliveira et al. / Veterinary Parasitology 176 (2011) 275–280
Fig. 2. Sensitivity of the PCR amplifications using serially diluted samples of purified DNA of each rabbit Eimeria species. Amplification products were separated on 1.5% agarose gels and stained with ethidium bromide. The Eimeria species used for each sample and the respective DNA quantities are indicated. Samples with no starting DNA were used as negative controls and are also indicated.
to amplify the specific targets of homologous DNA samples, and optimized for a maximum product yield. We standardized all reactions with the same PCR conditions, thus facilitating the set up of reactions destined for the amplification of multiple Eimeria species. 3.2. Specificity tests We conducted a series of specificity tests using the standardized PCR conditions. We tested all combinations of species-specific primer pairs and DNA samples of all Eimeria species of domestic rabbit. No cross-specific band has been observed using heterologous sets of primers and DNA samples (Fig. 1). A full set of pictures displaying uncut versions of all gels is available (Supplementary Material – Fig. 2). 3.3. Sensitivity tests We evaluated the sensitivity of the 11 species-specific reactions by serially diluting the DNA of each Eimeria species from 1 ng to 10 fg and performing the reactions under the standardized PCR conditions. As can be seen in Fig. 2, we obtained a detection limit of 500 fg for most species. In the case of E. flavescens, E. magna, E. perforans and E. piriformis, a detection limit of 1 pg has been observed. Considering a DNA content of 75 fg per
sporozoite (Cornelissen et al., 1984), the detection threshold varies from 6.7 to 13.3 sporozoites, which corresponds to approximately 0.8–1.7 sporulated oocysts, respectively. To assess the robustness and reliability of the assay, we carried out sensitivity tests using two additional brands of polymerases (recombinant Taq DNA Polymerase – Fermentas International, Ontario, Canada; BIOLASETM DNA Polymerase – Bioline, London, UK). The same detection limits were observed (Supplementary Material – Fig. 3). 4. Discussion In this work, we described the development of molecular diagnostic assays that allow the detection and discrimination of the 11 Eimeria species that infect the domestic rabbit (O. cuniculus). The assays are based on the use of species-specific ITS1 rDNA sequences as molecular targets for PCR amplification and, to our knowledge, represents the world’s first Eimeria differentiation test for this vertebrate host. The method reported here uses ITS1, a very well established molecular marker that has been used in a plethora of diagnostic assays. Despite the fact that ITS1 comprises a relatively short sequence, varying from 400 to 600 bp, and presents a relatively high A+T content (above 55%), we succeeded to develop species-specific primers for all rabbit Eimeria species. Our ITS1 sequence data, determined from single-oocyst derived lines, clearly
U.C. Oliveira et al. / Veterinary Parasitology 176 (2011) 275–280
validate the individual character and purity of the respective Eimeria species used throughout this work. The test reported here showed good reproducibility, even when performed with three different brands of amplification enzymes. In terms of sensitivity, our detection limit varied from 500 fg to 1 pg of DNA, thus corresponding to approximately 0.8–1.7 sporulated oocysts. This result is similar or even better than typical results of PCR-based assays described in the literature. Schnitzler et al. (1998) reported a detection limit of 25 oocysts for E. brunetti, using an ITS1-based PCR assay. Using ITS2 as a target, Gasser et al. (2001) observed a detection limit of 5–10 pg for chicken Eimeria. Fernandez et al. (2003b) obtained a sensitivity of 1 pg using either individual or multiple anonymous SCAR markers of Eimeria of domestic fowl. All these reports used serially diluted DNA for calculating sensitivity, but real-life situations may present a quite lower sensitivity. We have reported for oocysts of chicken Eimeria (Fernandez et al., 2003b) that DNA yield is not linear in respect to the oocyst amount, due probably to a decreasing efficiency of the mechanical oocyst disruption, especially in low-concentration samples. This may account for one order-of-magnitude reduction of the sensitivity. Several approaches for either chemical or combined mechanical/chemical oocyst disruption have been proposed but, in our opinion, a reproducible method for breaking up the oocyst wall and recovering high yields of DNA is still to be created. Despite this limitation, the observed sensitivity of our ITS1-based PCR assays is still high enough to detect parasite amounts that are much lower than those required to cause clinical signs and/or economic losses. Such a good sensitivity is particularly important for the detection of species that present very high reproductive potential. In E. intestinalis, for example, inoculation of immunologically naïve rabbits may result in the production of 3–5 × 108 oocysts per animal and 50% mortality (Coudert et al., 1995). Thus, the presence of even tiny amounts of this species should be promptly detected in field samples, before clinical signs and production losses be observed. Also, since E. intestinalis is very prevalent, and its population can rapidly overcome other Eimeria species, all rabbit Eimeria lines used for laboratory or field trials should be regularly monitored in respect to potential cross contaminations. This application may become even more critical for parasite lines destined to compose a future multivalent coccidia vaccine for rabbits. An accurate species identification is also important in the field practice because of the variable pathogenicity level of the different species. For instance, E. coecicola and E. perforans are non-pathogenic or slightly pathogenic, whereas other species, namely E. intestinalis and E. flavescens, are highly pathogenic (Coudert et al., 1995). Hence, the assays reported here may contribute to reveal the ethiology of rabbit coccidiosis outbreaks. In conclusion, we have developed a set of novel diagnostic assays that permit the differentiation of all Eimeria species that infect the domestic rabbit. These assays will permit population surveys to be performed with a high sensitivity and specificity, thus contributing for a better understanding of the epidemiology of this important group of coccidian parasites.
279
Conflicts of Interest None.
Acknowledgements U.C.O. received a fellowship from CNPq (143125/20060) and the work presented herein formed part of her Ph.D. thesis. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.vetpar.2010.10.054. References Blake, D.P., Qin, Z., Cai, J., Smith, A.L., 2008. Development and validation of real-time polymerase chain reaction assays specific to four species of Eimeria. Avian Pathol. 37, 89–94. Ceré, N., Humbert, J.F., Licois, D., Corvione, M., Afanassieff, M., Chanteloup, N., 1996. A new approach for the identification and the diagnosis of Eimeria media parasite of the rabbit. Exp. Parasitol. 82, 132– 138. Ceré, N., Licois, D., Humbert, J.F., 1995. Study of the inter- and intraspecific variation of Eimeria spp. from the rabbit using random amplified polymorphic DNA. Parasitol. Res. 81, 324–328. Cornelissen, A.W., Overdulve, J.P., van der Ploeg, M., 1984. Determination of nuclear DNA of five eucoccidian parasites, Isospora (Toxoplasma) gondii, Sarcocystis cruzi, Eimeria tenella. E. acervulina and Plasmodium berghei, with special reference to gamontogenesis and meiosis in I. (T.) gondii. Parasitology 88, 531–553. Coudert, P., 1989. Some peculiarities of rabbit coccidiosis. In: Yvoré, P. (Ed.), Coccidia and Coccidiomorphs, Vth International Coccidiosis Conference, Tours, France, 17–20 October. Les Colloques de l’INRA séries, vol. 49, INRA, Paris, pp. 481–488. Coudert, P., Licois, D., Drouet-Viard, F., 1995. Eimeria species and strains of rabbit. In: Eckert, J., Braun, R., Shirley, M. W., Coudert, P. (Eds.), COST. 89/820. Biotechnology: Guidelines on Techniques in Coccidiosis Research. Office for Official Publications of the European Communities, Luxembourg, pp. 52–73. Durham, A.M., Kashiwabara, A.Y., Matsunaga, F.T., Ahagon, P.H., Rainone, F., Varuzza, L., Gruber, A., 2005. EGene: a configurable pipeline generation system for automated sequence analysis. Bioinformatics 21, 2812–2813. Fernandez, S., Costa, A.C., Katsuyama, A.M., Madeira, A.M., Gruber, A., 2003a. A survey of the inter- and intraspecific RAPD markers of Eimeria spp. of the domestic fowl and the development of reliable diagnostic tools. Parasitol. Res. 89, 437–445. Fernandez, S., Pagotto, A.H., Furtado, M.M., Katsuyama, A.M., Madeira, A.M., Gruber, A., 2003b. A multiplex PCR assay for the simultaneous detection and discrimination of the seven Eimeria species that infect domestic fowl. Parasitology 127, 317–325. Gasser, R.B., Woods, W.G., Wood, J.M., Ashdown, L., Richards, G., Whithear, K.G., 2001. Automated, fluorescence-based approach for the specific diagnosis of chicken coccidiosis. Electrophoresis 22, 3546– 3550. Huang, X., Madan, A., 1999. CAP3: a DNA sequence assembly program. Genome Res. 9, 868–877. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins, D.G., 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947–2948. Licois, P., Coudert, P., 1982. Coccidioses et diarrhées du lapin à l’engraissement. Bull. GTV 5, 109–122. Long, P.L., Joyner, L.P., 1984. Problems in the identification of species of Eimeria. J. Protozool. 31, 535–541. Morgan, J.A., Morris, G.M., Wlodek, B.M., Byrnes, R., Jenner, M., Constantinoiu, C.C., Anderson, G.R., Lew-Tabor, A.E., Molloy, J.B., Gasser, R.B., Jorgensen, W.K., 2009. Real-time polymerase chain reaction (PCR) assays for the specific detection and quantification of seven Eimeria species that cause coccidiosis in chickens. Mol. Cell. Probes. 23, 83–89.
280
U.C. Oliveira et al. / Veterinary Parasitology 176 (2011) 275–280
Morris, G.M., Gasser, R.B., 2006. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol. Adv. 24, 590–603. Pakandl, M., 2009. Coccidia of rabbit: a review. Folia Parasitol. 56, 153–166. Schnitzler, B.E., Thebo, P.L., Mattsson, J.G., Tomley, F.M., Shirley, M.W., 1998. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, 490–497.
Schnitzler, B.E., Thebo, P.L., Tomley, F.M., Uggla, A., Shirley, M.W., 1999. PCR identification of chicken Eimeria: a simplified read-out. Avian Pathol. 28, 89–93. Woods, W.G., Richards, G., Whithear, K.G., Anderson, G.R., Jorgensen, W.K., Gasser, R.B., 2000. High-resolution electrophoretic procedures for the identification of five Eimeria species from chickens, and detection of population variation. Electrophoresis 21, 3558–3563.