Developmental accumulation of thebaine and some gene transcripts in different organs of Papaver bracteatum

Industrial Crops and Products 80 (2016) 262–268

Contents lists available at ScienceDirect

Industrial Crops and Products journal homepage: www.elsevier.com/locate/indcrop

Developmental accumulation of thebaine and some gene transcripts in different organs of Papaver bracteatum Mahdi Rezaei, Mohamad Reza Naghavi ∗ , Abdol Hadi Hoseinzade, Alireza Abbasi Agronomy and Plant Breeding Dept., Agricultural College, University of Tehran, Karaj 31587−11167, Iran

a r t i c l e

i n f o

Article history: Received 29 August 2015 Received in revised form 25 October 2015 Accepted 1 November 2015 Available online 30 November 2015 Keywords: Persian poppy Alkaloids Gene transcript Developmental stages

a b s t r a c t Noted as a rich source of thebaine and a potential alternative to Papaver somniferum for production of codeine and some semi-synthetic antagonist drugs (namely naloxone and naltrexone), Papaver bracteatum is a perennial species belongs to the section oxytona. Benzylisoquinoline alkaloids (BIAs) as a diverse class of alkaloids comprises about 2500 various structures contain medically important pharmaceuticals. Developmental and inducible factors control the alkaloid biosynthesis in opium poppy. To make better understanding on comparative developmental accumulation of alkaloid content and tyrosine/dopa decarboxilase (TYDC), berberine bridge enzyme (BBE), salutardinol acetyl transferase (SAT) and codeinone reductase (COR) gene transcripts in different organs of the species, current study was conducted. The accumulation of thebaine was higher in the capsule at pendulous bud (10.66 mg/gr dry weight) following in the root at bud initiation (10.25 mg/gr dry weight). The minimum amount of thebaine was observed in the petal of flowering stage (4.57 mg/gr dry weight). Although in some cases the fluctuation of thebaine content could be coordinated to the up or down-regulation of gene transcripts, however, the presence of considerable exceptions complicate making of a comprehensive conclusion. © 2015 Elsevier B.V. All rights reserved.

1. Introduction The altitudes from 1500 up to 2500 m in Alborz Mountains, Iranian Kurdistan and northern slope of the Caucasus are the preferential habitats for Persian poppy, Papaver bracteatum. The self-incompatible, out-crossing and attractive flowers for bees and beetles are the species strategy for pollination (Goldblatt, 1974). P. bracteatum, which noted as a rich source of thebaine and a potential alternative to Papaver somniferum for production of codeine (Bohm, 1981) and some semi-synthetic antagonist drugs (namely naloxone and naltrexone) (Mcnicholas and Martine, 1984), is a perennial species belongs to the section oxytona and close relative of Papaver orientale (Goldblatt, 1974). Alkaloids are low molecular weight and nitrogen containing secondary metabolites that roughly founded in 20% of plant species, about 12000 known alkaloids, based on carbon skeletal structure, can be divided into different classes (Ziegler and Facchini, 2008). Benzyl isoquinoline alkaloids (BIAs) as a diverse class of alkaloids comprise about 2500 various structures contain medically important pharmaceuticals such as muscle relaxant

∗ Corresponding author at: Fax: +98 261 2824809. E-mail address: [email protected] (M.R. Naghavi). http://dx.doi.org/10.1016/j.indcrop.2015.11.009 0926-6690/© 2015 Elsevier B.V. All rights reserved.

((+)-tubocurarine and papaverine), narcotic analgesics (morphine and codeine), cough suppressant and anticancer agent (noscapine), antimicrobial agent (sanguinarine) and cholesterol-lowering drug (berberine) isolated from Papaver species specially P. somniferum as a commercial source (Farrow et al., 2012; Hagel and Facchini, 2013; Beaudoin and Facchini, 2014). In addition, developmental and inducible factors control the alkaloid biosynthesis in opium poppy has been reported by Facchini (2001). Is the scheme for thebaine biosynthesis in P. bracteatum the same as P. somniferum? It was a question that, Hodges et al. (1977), consistent with Stermitz and Rapoport (1961), answered “yes”. They fed radiolabeled 1,2-Dehydroreticulinium chloride and (±) reticuline to P. bracteatum plants and reported the incorporation of the former into reticuline and thebaine and the later into thebaine, suggesting the resemblance of thebaine biosynthesis in the opium and Persian poppies. One year later Brochmann-Hanssen and Wunderly (1978) confirmed this claims. Nowadays we are confronting with precious growing resources of gene and cDNA sequences which provide an opportunity to study secondary metabolite biosynthesis pathways including benzylisoquinoline alkaloid pathways. Although the spatial accumulation of specific alkaloids has been correlated with the gene transcripts encoding some biosynthetic enzymes in the plant, however, some

M. Rezaei et al. / Industrial Crops and Products 80 (2016) 262–268

notable exceptions also have been reported (Facchini and Park, 2003). To make better understanding on comparative developmental accumulation of alkaloid content and tyrosine/dopadecarboxilase (TYDC), berberine bridge enzyme (BBE), salutardinol acetyl transferase (SAT) and codeinone reductase (COR) gene transcripts in different organs of the species, current study was conducted. TYDC is responsible for the transformation of l-tyrosine and l-dopa to tyramine and dopamine, respectively (Fig. 1). The BBE catalyzes the conversion of (S)-reticuline to (S)-scoulerine (Facchini et al., 1996b). Salutaridinol-7-O-acetate is the output of SAT function on the (7S)-salutaridinol (Goldblatt et al., 2001). COR action leads to the conversion of codeinone to codeine (Unterlinner et al., 1999). 2. Materials and methods 2.1. Plant materials Considering the fact that Persian poppy needs cold or gibberellic acid for transition from vegetative phase to reproductive phase

263

in greenhouse conditions and difficulty of its clonal propagation because of high alkaloid content, Seven developmental stage of P. bracteatum including annual rosette (rosette plant in first growing season), perennial rosette (rosette plant with residual stem from last year), bud initiation (incidence of flower bud), pendulous bud (large flower bud was pendular and topmost part of stem was soft), pre-flowering (large flower bud was straight and topmost part of stem was stiff), flowering (petal opening) and lancing (one week after petal falling) were collected from Polour region, Damavand, as one of the natural habitat of this species in Iran. Plant materials were immediately froze in liquid nitrogen and then stored in −80 ◦ C. Depend upon developmental stage, sampling was performed on roots (2 cm from top and 2 cm from down parts), 2 cm from lowest part of stems, two terminal leaves, 2 cm from topmost part of stems, petals, capsules wall and capsules contents. Assuming that plants with similar developmental stage have similar genetic background, five plants were sampled from every developmental stage and corresponding parts were pooled equally in order to weaken genetic background effect on further experiments.

Fig. 1. A part of benzylisoquiniline alkaloids pathways. The arrows indicate the enzymes which are involved in morphine biosynthesis. The yellow arrows show the investigated genes. Dashed arrows show the multi-enzymatic steps from substrate to final product. Abbreviations: TYDC tyrosine/DOPA decarboxylase, NCS norcoclaurine synthase, 6OMT norcoclaurine 6-O-methyltransferase, CNMT coclaurine N-methyltransferase, NMCH N-methylcoclaurine, 4 OMT 3 -hydroxyl-N-methylcoclaurine 4 -Omethyltransferase 3 -hydroxylase, BBE berberine bridge enzyme, SalSynsalutaridine synthase, SalRsalutaridinereductase, SAT salutaridinol 7-O-acetyltransferase, T6ODM thebaine 6-O-demethylase, COR codeinonereductase, CODM codeine O-demethylase.

264

M. Rezaei et al. / Industrial Crops and Products 80 (2016) 262–268

12 11 10 9

Intensity (Volt)

8 capsule at Pendulous bud stage

7 6 5

Pure thebaine spectrum

4 3 2 1

Background spectrum

0 2

3

4

5

6

7

8

9

10

11

12

13

14

Time (milisecond) Fig. 2. Ion mobility spectra of the background (red), pure thebaine (blue) and capsule wall at pendulous bud stage. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Table 1 List of primer sequences (5 -3 ) used for qRT-PCR in P. bracteatum.

Table 2 IMS operation parameters.

Primer name

Sequence (5 -3 )

Parameter

Setting

B-COR-F B-COR-R B-SAT-F B-SAT-R B-TYDC-F B-TYDC-R B-BBE-F B-BBE-R Elf1a-F Elf1a-R

CCACCATTTGACCAGCATTTAG GGGCTCATCTCCACCTTAATC TGGAAGTCCGTGATGAAATCC GCTGGTAAGAACGCCGAAAC AACCCACTAGACCCTGATGA GACCTGGCTTCTAACTGGATAAC GGGTTTACTGCTGGTTGGT ATCGCATCCACGACGTTATC AGATGATTCCAACCAAGCCCA CCTTGATGACACCAACAGCAACT

CORona voltage Drift field Drift gas flow (N2) Carrier gas flow (N2) Drift tube temperature Injection temperature Drift tube length Shutter grid pulse

2.1 K.V 700 Vcm−1 1000 ml min−1 500 ml min−1 200 ◦ C 260 ◦ C 11 cm 120 ␮s

2.2. RNA extraction and qRT-PCR 2.3. Measurement of alkaloids Plant tissues were powdered using cold mortar and pestle in liquid nitrogen. Then 0.1 g of powder was used for RNA extraction and the rest for alkaloid extraction. RNA extraction was carried out by p-BIOZOL and based on manufacturer (BIOFLUX) instruction. Afterwards, 1 ␮g of RNA was treated by DNase and first strand cDNA synthesis using Oligo-dT primers were performed based on FERMENTAS instructions. Coding sequence of TYDC, BBE, SAT and COR genes were obtained from NCBI (National Center for Biotechnology Information). Primers were designed by Primer Quest and Primer 3. In addition, Oligo Analyzer, Oligo Calculator and Primer Blast applied on suggested primers for checking the primers quality factors including hairpin, self-dimer, hetero-dimer and specificity to the templates. The primer sequences (5 -3 ) are listed in the Table 1. Solis BioDyne5x master mix (without ROX), whose intercalating dye is Eva Green, was employed for qRT-PCR. Temporal and thermal condition of cycles and concentration of reaction components were set rely on manufacturer instruction. To ensure specific amplification, Melt curves obtained after amplifications and no reverse transcription controls and no template controls were used as negative controls. qRT-PCR reactions with tree technical replications were run in Rotor-Gene 6000 which is the product of Qiagen Company. Based on Hagel and Facchini (2010) we used Elongation Factor 1 alpha (ELF1␣) as reference gene.

The rest of the plant powder was freeze-dried for alkaloid extraction. Then one ml of 70% ethanol were added to 100 mg of powder and homogenized in sonicator at 4 ◦ C for 30 min in 2 ml tubes. Samples were vortexed at maximum speed for one min and then centrifuged at 16000 g, 4 ◦ C for 10 min on the tubes. The supernatants were used for measurements. Ion Mobility Spectrometer (IMS-200, TOF Tech Pars) apparatus with the continuous corona discharge as ionization source was used for measurement of alkaloids. IMS is a well-known technique, which offers low detection limit, fast response, simplicity, and portability. The main advantages of IMS relative to other methods such as GC–MS are its simplicity and portability. The main parts of the instrument are: the IMS cell, the needle for producing the corona, two high voltage power supplies, a pulse generator, an analog to digital converter and a computer. More information about the instrument there are in Tabrizchi et al. (2000), Khayamian et al. (2006), Tabrizchi and Shamlouea (2010) and Eiceman et al. (2013). Thebaine, as standard material, was provided from Sigma Aldrich Company. The optimized experimental conditions for obtaining the ion mobility spectra of the compounds extracted from (Khayamian et al., 2006) with little changes and are listed in Table 2. Experiments were performed with three replications. Ion mobility spectra of thebaine and background are represented in Fig. 2.

M. Rezaei et al. / Industrial Crops and Products 80 (2016) 262–268

2.4. Data analysis Gene expression data at each tissue during developmental stages were analyzed by REST 2009 software which uses Ratio=

(Efficency of Target Gene)

cp of target gene

(Efficency of reference Gene)cp reference gene

formula for quantifica-

tion which cp = mean control − mean sample (Pfaffl, 2004). Efficiency of reactions was obtained from the software of rotor gene 6000 which is able to calculate efficiencies based on fluorescence increase in exponential phase of the reaction. In any tissue during developmental stages the transcriptional fold changes were measured relative to the first stage at which the tissue was present. SAS 9.3.1 Portable, Microsoft Excel 2013 and Sigma Plot 10 soft wares were used for IMS data analysis based on completely randomized design with three replications. 3. Results 3.1. Relative expression of genes in each organ during developmental stages Relative expression of genes in each organ during developmental stages is reported in Table 3. The relative expression of COR, SAT and BBE genes in the roots had two peaks at bud initiation, the maximum rate, and flowering stages. The maximum peaks of TYDC transcripts accumulation were at the bud initiation and lancing stages. In case of the leaves, the expression of COR, increased until pre-flowering and then decreased. Transcription of SAT and BBE enhanced till pendulous bud stage and then reduced. The maximum expression rate of TYDC was at bud initiation stage and therefore declined. The data illustrated that the incidence of flower bud coincided with the maximum expression of the four genes in the bottom part of the stems. The peaks of transcription for COR, SAT and TYDC in the capsules wall were at flowering, pre-flowering and bud initiation, respectively. The relative expression of BBE in the capsule at all stages was relatively equivalent. In addition, all of the genes were at their maximum transcription level in the petals at pre-flowering stage. In topmost part of the stems, lancing for COR and SAT and flowering for BBE and TYDC were the stages at which the transcript levels were maximum. The resulted data from capsules content indicated that the peaks of transcription level for all of genes were at pre-flowering stage. The data showed that the TYDC gene was not transcribed in the capsules wall after pendulous bud stage. The up-regulation pattern of the SAT and COR genes in the capsules wall were not correspondent with fluctuations of thebaine during the stages (Table 3, Fig. 3). The maximum rate of TYDC transcripts were detected in the roots at bud initiation stage. The peak of BBE transcripts accumulation was identified in the roots and bottom part of the stems at bud initiation stage. Bottom part of the stems at bud initiation and leaves at pre-flowering stage had the uttermost quantity of COR transcripts. The spatial accumulation of SAT was more universal in the plant organs so that the most accumulating organs were roots (at bud initiation), leaves (at pendulous bud), stems (at pendulous bud), petals (at pre-flowering) and capsules content (at pre-flowering) (Table 3). 3.2. Measurement of alkaloids in each organ during developmental stages Measurement of alkaloids during developmental stages (Fig. 3) illustrated that the thebaine enhanced during vegetative rosettes and a considerable increment coincided with onset of flower buds

265

Table 3 The fold change, positive and negative error in expression rate of COR, SAT, BBE and TYDC in different organs of P. bracteatum during developmental stages. The red, yellow and white colors show up-regulation, down- regulation and similar regulation of transcription, respectively. Fold changes are relative to the first developmental stage which the organ was presented at it. (For interpretation of the references to colour in this Table legend, the reader is referred to the web version of this article.)

266

M. Rezaei et al. / Industrial Crops and Products 80 (2016) 262–268

Fig. 3. Thebaine content of root, down part of stem (stem), upper part of stem (upper stem), leaf, capsule wall, petal and capsule content during developmental stages including annual rosette, perennial rosette, bud initiation, pendulous bud, pre-flowering, flowering and lancing in P. bracteatum. Columns with at least one similar alphabetic character are not significantly different.

Thebaine content(mg/ gr dry weight)

12

10

8

6

4

2

0 Annual rosee

Perennial rosee

Bud iniaon pendolous bud Preflowering

Flowering

Lancing

Developmental stages Root

Leaf

Fig. 4. The fluctuations of thebaine content in roots and leaves of P. bracteatum during seven developmental stages.

Table 4 Thebaine content (mg/gr dry weight) of different organs at different developmental stage in P. bracteatum. organ

Annual rosette

Perennial rosette

Bud initiation

Pendulous bud

Pre-flowering

Flowering

Lancing

Root Stem Upper stem Leaf Capsule Petal Capsule content

7.59 – – 6.73 – – –

8.32 – – 5.84 – – –

10.25 5.36 6.76 5.03 6.67 – –

7.89 8.90 8.98 6.42 10.66 7.521 –

8.58 9.07 9.42 6.36 9.3485 7.32 7.60

8.60 6.52 7.41 5.86 6.9604 4.57 6.43

7.88 7.55 9.26 5.52 8.7185 – 6.88

M. Rezaei et al. / Industrial Crops and Products 80 (2016) 262–268

was evidence din the roots. The least thebaine content of the roots during the developmental stages was detected at annual rosette stage. Generally, the accumulation of thebaine in the topmost part of the stems was higher than the bottom. Pre-flowering was the stage that the maximum amount of thebaine in the bottom part of the stems was identified. In addition, accumulation of thebaine in the leaves from annual rosette to bud initiation stage continuously decreased so that the thebaine content of the leaf at this stage was the least during the stages. After the bud initiation, thebaine content of the leaf enhanced but after pre-flowering continually declined. The data demonstrated a dramatic enhancement in thebaine content of the capsules wall at pendulous bud stage. Thereafter the accumulation of thebaine in the capsules wall reduced until the lancing at which the thebaine content increased again. The concentration of thebaine in the plant petals ceaselessly diminished. The pattern of thebaine accumulation in the capsules content was similar to corresponding developmental stages in the capsule wall but in lesser quantity. Totally the minimum amount of thebaine was observed in the petal of flowering stage (4.57 mg/gr dry weight) and the maximum of that was detected in the capsule and root at pendulous bud (10.66 mg/gr dry weight) and bud initiation (10.25 mg/gr dry weight) stages, respectively (Table 4).

4. Discussion However, sanguinarine were not detected in the species in our experiments, the peak of BBE transcripts accumulation were identified in the roots and lower part of the stems at bud initiation stage. Also lower part of the stems at bud initiation and leaves at pre-flowering stage had the uttermost quantity of COR transcripts while codeine was not detected in this study. Consistently, Huang and Kutchan (2000) reported that BBE transcripts were more abundant in the roots and stems and COR were predominant in the capsules, stems and leaves of the P. somniferum. In addition, they reported the transcription of BBE and COR in the Papaver rhoeas, P. orientale, P. bracteatum. Although the transcription of BBE in these species is compatible with the presence of nor-sanguinarine (Southon and Buckingham, 1989), the transcription of COR, despite the absence of codeinone and codeine in these species, is not justifiable. The transcription of COR in these species interpreted as an ‘evolutionary remnant’ by Huang and Kutchan (2000). Since the sanguinarine accumulates in the roots, thus the presence of BBE mRNAs (Facchini et al., 1996a) and enzyme activity in the aerial part of plant (Steffens et al., 1985) is unexpected and proposes the possibility of sanguinarine intermediates biosynthesis in the shoot which transposed to the root for production of sanguinarine (Facchini and Bird, 1998). Hodges et al. (1977) fed radiolabeled codeinone to P. bracteatum plant and observed that the codeinone was effectively converted to codeine with the same rate as happens in P. somniferum, suggesting that the COR enzyme is an acting enzyme in P. bracteatum. However, they were unaware from the presence of COR in the species and attributed the catalyzing activity to the nonspecific action of salutaridine reductase on codeinone. Surprisingly, although the transcription level of SAT and COR genes in the capsules and upper part of the stems were significantly lower than the bottom part of the stems and leaves, the thebaine content of the capsules and upper part of the stems were considerably higher than them (personal communication). The specific biosynthetic enzymes of morphinan alkaloids are more active in the stems and roots than the capsules which suggests the translocation of these alkaloids from the stems and roots to the capsules along with the latex in opium poppy (Gerardy and Zenk, 1993a,b). Facchini and De Luca (1995) founded out the maximum accumula-

267

tion of TYDC mRNAs in the metaphloem of the stems and roots and low level of it in the developing capsules of opium poppy. However, TYDC enzyme catalyzes a variety of biochemical reactions in opium poppy and is not a unique marker for alkaloid biosynthesis (Facchini and De Luca, 1994; Maldonado-Mendoza et al., 1996). Facchini et al. (1996b) could not detect BBE transcripts in the leaf of P. somniferum, but Huang and Kutchan (2000) and Facchini and Park (2003) detected these transcripts. In the current study, the level of BBE and TYDC transcripts in the leaves declined and totally disappeared after pre-flowering and pendulous bud stages of the Persian poppy life cycle, respectively. In addition, Facchini and Park (2003) founded the highest levels of BBE, SAT and COR in the stem of P. somniferum, followed by flower bud and root. Interestingly, our results showed that the most accumulating organs in case of SAT transcripts were root (at bud initiation), leaf (at pendulous bud), stem (at pendulous bud), petal (at pre-flowering) and capsule content (at pre-flowering). Moreover, they reported root as the most accumulating TYDC transcripts which is consistent with our results. RNA gel blot analysis revealed that COR1 and SalAT transcripts were present in root, stem, leaf and capsule of the mature opium poppy plant and neither of them had organ specific expression (Unterlinner et al., 1999; Huang and Kutchan, 2000; Goldblatt et al., 2001). As depicted in the Fig. 4, the thebaine content of the roots increased during rosette stages and reached its maximum level at the bud initiation stage followed by a decrease in thebaine content at pendulous bud stage and subsequent increase at preflowering and flowering stages. Afterward at lancing stage the thebaine content of the roots insignificantly decreased. Complied with bud initiation and flowering stages, a remarkable accumulation of the genes transcripts was detected (Table 4). Similarly Levy et al. (1988) observed that the thebaine content of the P. bracteatum roots became more and more during vegetative rosette stage and coincided with incidence of flower bud attained its maximum rate. Subsequently a considerable decrease during reproductive phase was seen followed by a light enhancement in thebaine content at the end of flowering stage. Amplification of COR and SAT transcripts in the leaves of the plant were not compatible with the pattern of thebaine accumulation (Table 3, Fig. 3). It seems that the accumulation of thebaine in the roots and leaves of the plant, until flowering, were reciprocally related and afterward reduced both of them (Fig. 4). However, whether this negative correlation stems from a competition for pathway intermediates or is a chancy observation needs to be investigated. Despite of interesting similarity between the profiles of thebaine accumulation in the bottom and topmost part of the stems during developmental stages, the thebaine content of the topmost part of the stems was higher than the bottom part (Fig. 3). When transcription of COR and SAT comprised between corresponding stages of these two parts (data not shown), down-regulated or similar transcription in the topmost part relative to the bottom part were evidenced. Consistently, the morphinan alkaloid content of upper part of the stems than lower part of the stem was higher in the experiments of Larkin et al. (2007). The long distance transposition of the alkaloids and/or gene transcripts and the age of the tissues might be involved in the observed differences between alkaloid content of upper and lower parts of the stems. Eventually, it can be concluded that although in some cases the fluctuation of thebaine content could be coordinated to the up or down-regulation of gene transcripts in P. bracteatum, the presence of considerable exceptions complicate making of a comprehensive conclusion. Also consistently, Facchini and Park (2003) founded that although the spatial accumulation of specific alkaloids has been correlated to the gene transcripts encoding some biosynthetic enzymes in the plant, some notable exceptions also

268

M. Rezaei et al. / Industrial Crops and Products 80 (2016) 262–268

have been reported. A collection of related molecular, biochemical, and cellular factors are responsible for control of benzilisoquinoline alkaloid biosynthesis pathway. However, some aspects of biosynthesis and accumulation of alkaloids in P. somniferum are regulated at transcription level (Facchini and Park, 2003). Although the scale of our experiments is too small to be adequate for making a conclusion about the pathway, fortunately nowadays there are helpful and effective toolbox including next generation sequencing, system biology methods and multiple algorithms for large scale analysis of transcriptomic, metabolic data which make the total conclusions more comprehensive. Acknowledgments The authors would like to acknowledge the University of Tehran for the financial support of this work. We also thank Dr. Houshang Alizadeh for his helpful guidance. References Beaudoin, G.A.W., Facchini, P.J., 2014. Benzylisoquinoline alkaloid biosynthesis in opium poppy. Planta 240, 19–32. Bohm, H., 1981. Papaver bracteatum Lindl: results and problems of the research on a potential medicinal plant. Pharmazie 36, 660–667. Brochmann-Hanssen, F., Wunderly, S.W., 1978. Biosynthesis of morphinan alkaloids in Papaver bracreatum Lindl. J. Pharm. Sci. 67, 103–106. Eiceman, G.A., Karpas, Z., Hill Jr., H.H., 2013. Ion Mobility Spectrometry. CRC Press. Facchini, P.J., Bird, D.A., 1998. Developmental regulation of benzylisoquinoline alkaloid biosynthesis in opium poppy plants and tissue cultures. In Vitro Cell. Dev. Biol. Plant 34, 69–79. Facchini, P.J., De Luca, V., 1994. Differential and tissue-specific expression of a gene family for tyrosine/dopa decarboxylase in opium poppy. J. Biol. Chem. 269, 26684–26690. Facchini, P.J., De Luca, V., 1995. Phloem-specific expression of tyrosine/ DOPA decarboxylase genes and the biosynthesis of isoquinoline alkaloids in opium poppy. Plant Cell 7, 1811–1821. Facchini, P.J., Johnson, A.G., Poupart, J., de Luca, V., 1996a. Uncoupled defense gene expression and antimicrobial alkaloid accumulation in elicited opium poppy cell cultures. Plant Physiol. 111, 687–697. Facchini, P.J., Penzes, C., Johnson, A., Bull, D., 1996b. Molecular characterization of berberine bridge enzyme genes from opium poppy. Plant Physiol. 112, 1669–1677. Facchini, P.J., Park, S.U., 2003. Developmental and inducible accumulation of gene transcripts involved in alkaloid biosynthesis in opium poppy. Phytochemistry 64, 177–186. Facchini, P.J., 2001. Alkaloid biosynthesis in plants: biochemistry, cell biology, molecular regulation, and metabolic engineering applications. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52, 29–66. Farrow, S.C., Hagel, J.M., Facchini, P.J., 2012. Transcript and metabolite profiling in cell cultures of 18 plant species that produce benzylisoquinoline alkaloids. Phytochemistry 77, 79–88.

Gerardy, R., Zenk, M.H., 1993a. Formation of salutaridine from (R)-reticuline by a membrane-bound cytochrome P-450 enzyme from Papaver somniferum. Phytochemistry 32, 79–86. Gerardy, R., Zenk, M.H., 1993b. Purification and characterization of salutaridine: NADPH 7-oxidoreductase from Papaver somniferum. Phytochemistry 34, 125–132. Goldblatt, P., 1974. Biosystematic studies in Papaversection oxytona. Ann. Mol. Bot. Gard. 61, 264–296. Goldblatt, T., Lenz, R., Kutchan, T.M., 2001. Molecular characterization of the salutaridinol 7-Oacetyltransferase involved in morphine biosynthesis in opium poppy P. somniferum. J. Biol. Chem. 276, 30717–30723. Hagel, J.M., Facchini, P.J., 2013. Benzylisoquinoline alkaloid metabolism:a century of discovery and a brave new world. Plant Cell Physiol. 54, 647–672. Hagel, J.M., Facchini, P.J., 2010. Dioxygenases catalyze the O-demethylation steps of morphine biosynthesis in opium poppy. Nat. Chem. Biol. 6, 273–275. Hodges, C.C., Horn, J.S., Rapoport, H., 1977. Morphinan alkaloids in Papaverbracteatum: biosynthesis and fate. Phytochemistry 16, 1932–1942. Huang, F.C., Kutchan, T.M., 2000. Distribution of morphinan and benzo[c]phenanthridine alkaloid gene transcript accumulation in Papaver somniferum. Phytochemistry 53, 555–564. Khayamian, T., Tabrizchi, M., Jafari, M.T., 2006. Quantitative analysis of morphine and noscapine using corona discharge ion mobility spectrometry with ammonia reagent gas. Talanta 69, 795–799. Larkin, P.J., Miller, J.A.C., Allen, R.S., Chitty, J.A., Gerlach, W.L., Frick, S., Kutchan, T.M., Fist, A.J., 2007. Increasing morphinan alkaloid production by over-expressing codeinonereductase in transgenic P. somniferum. Plant Biotechnol. J. 5, 26–37. Levy, A., Milo, J., Palevitch, D., 1988. Accumulation and distribution of thebaine in the roots of Papaver bracteatum during plant development. Planta Med. 54, 299–301. Mcnicholas, L.F., Martine, W.R., 1984. New and experimental therapeutic roles for naloxone and related opioid antagonists. Drugs 27, 81–93. Maldonado-Mendoza, I.E., Loapez-Meyer, M., Galef, J.R., Burnett, R.J., Nessler, C.L., 1996. Molecular analysis of a new member of the opium poppy tyrosine/3,4-dihydroxyphenylalanine decarboxylase gene family. Plant Physiol. 110, 43–49. Pfaffl, M.W., 2004. Quantification strategies in real-time PCR. In: Bustin, S.A. (Ed.), A–Z of Quantitative PCR. IUL Biotechnology Series. International University Line, La Jolla, CA, pp. 87–120. Southon, I.W., Buckingham, J., 1989. Dictionary of Alkaloids. Chapman and Hall Ltd., New York. Steffens, P., Nagakura, N., Zenk, M.H., 1985. Purification and characterization of the berberine bridge enzyme from Berberis beaniana cell cultures. Phytochemistry 24, 2577–2583. Stermitz, F.R., Rapoport, H., 1961. The biosynthesis of opium alkaloids: alkaloids interconversions in Papaver somniferum and P. oriental. J. Am. Chem. Soc. 83, 4045–4050. Tabrizchi, M., Khayamian, T., Taj, N., 2000. Design and optimization of a corona discharge ionization source for ion mobility spectrometry. Rev. Sci. Instrum. 71, 2321–2328. Tabrizchi, M., Shamlouea, H.R., 2010. Relative transmission of different ions through shutter grid. Intern. J. Mass Spectrom. 291, 67–72. Unterlinner, B., Lenz, R., Kutchan, T.M., 1999. Molecular cloning and functional expression of codeinonereductase: the penultimate enzyme in morphine biosynthesis in the opium poppy P. somniferum. Plant J. 18, 465–475. Ziegler, J., Facchini, P.J., 2008. Alkaloid biosynthesis: metabolism and trafficking. Annu. Rev. Plant Biol. 59, 735–769.